Demethylzeylasteral alleviates myeloid leukemia through PERK/eIF2α/ATF4/CHOP-mediated cell apoptosis
Highlight box
Key findings
• This study found that demethylzeylasteral (DML) exerts potent anti-leukemic effects through PERK-dependent unfolded protein response pathway mediated apoptosis, highlighting its therapeutic potential as a naturally derived agent for leukemia treatment.
What is known and what is new?
• DML, a natural terpenoid primary extract from Tripterygium, has demonstrated antitumor properties across various cancer types, such as, liver cancer and colorectal cancer. However, its functions and mechanisms in myeloid leukemia have not been clearly elucidated.
• In this study, DML treatment significantly reduced myeloid leukemia cell viability while inducing G0/G1 phase arrest and apoptosis, accompanied by characteristic endoplasmic reticulum stress markers. DML activated the PERK/eIF2α/ATF4/CHOP signaling axis, initiating an irrecoverable unfolded protein response that culminated in apoptotic cell death.
What is the implication, and what should change now?
• The study provides both mechanistic insight into terpenoid-mediated leukemia cell death and preclinical evidence supporting further development of DML-based therapies.
Introduction
Background
Leukemia, a hematological malignancy characterized by the blocked differentiation and uncontrolled proliferation of hematopoietic progenitor cells, is divided into lymphocytic and myeloid types (1). Leukemia demonstrates substantial incidence and mortality rates in both male and female populations, representing a significant health concern (2). Leukemia is further categorized into acute and chronic forms, with acute myeloid leukemia (AML) being the most common type in adults (3,4). Current treatments include cytotoxic chemotherapy, hypomethylated drugs, immunotherapy, allogeneic stem cell transplantation and targeted therapy (5). However, particularly in patients over the age of 60 years, adverse outcomes often result from recurrence or non-response to initial treatments (6,7). Although CAR-T/NK therapy has emerged in recent years, challenges remain regarding treatment selection, combination therapies, and high costs (8,9). Chronic myeloid leukemia (CML), accounting for about 15% in new adult leukemia diagnoses, has seen improved survival rates due to tyrosine kinase inhibitors such as imatinib, bosutinib, and nilotinib (10-12). However, about 5% to 10% of patients develop resistance to these inhibitors (13). These factors underscore the urgency of developing new drugs.
In recent years, traditional Chinese medicine has shown unique advantages in alleviating cancer symptoms and reducing the side effects of conventional treatment, leading to increased research into its use for cancer therapy (14). Terpenoids, a large class of natural compounds, exhibit significant anti-inflammatory, antibacterial, antioxidant, detoxification, anti-mutagenic, and anticancer activities (15). Recent studies emphasize the critical roles of terpenoids in cancer therapy, including their ability to induce apoptosis, inhibit metastasis and angiogenesis, and disrupt cell cycle progression in various tumors (16). For example, triptolide can resist head and neck cancer by inducing apoptosis (17), while β-elemene eliminates ovarian cancer cells by regulating cell cycle arrest at the G2/M phase (18). Consequently, 65 natural terpenoids have been elaborately selected to identify potential compounds effectively against leukemia. Notably, among these compounds, albiflorin has demonstrated anti-inflammatory and immunoregulatory effects (19), and cedrol shows promise as a potential treatment in combination with temozolomide for glioblastoma treatment (20).
Demethylzeylasteral (DML), is a primary extract from Tripterygium wilfordii Hook. F. Previous studies have demonstrated that DML has low toxicity compared to other compounds such as triptonide, celastrol, and triptolide (21). DML exerts significant anticancer effects across various tumor types. Specifically, DML reduces the tumorigenicity in liver cancer stem cells by suppressing the lactylation of H3 histones (22), inhibits the expression of MCL1 in melanoma (23), and enhances the therapeutic efficacy of 5-FU in colorectal cancer cells (24). Furthermore, DML showed no significant biotoxic effects in the nude mouse tumor xenograft model, indicating its potential as a safe and effective anticancer agent (22). Compared to traditional chemotherapy and radiation therapy, which are often associated with severe side effects such as hair loss, liver damage, loss of appetite, vomiting, and neurological disorders (25), DML exhibits fewer adverse effects.
In this study, DML was identified owing the inhibitory effects on myeloid leukemia cells. These findings showed that DML induced cell apoptosis and inhibited cell growth, mirroring its effects on other tumors. Additionally, DML activated the PERK/CHOP pathway mediated unfolded protein response (UPR) in response to irreversible endoplasmic reticulum (ER) stress, leading to apoptosis. Treatment with DML also increased the intracellular calcium concentration in leukemia cells, implicating the calcium signaling pathway as a trigger for ER stress. Finally, DML extended the survival of a xenograft mouse model bearing NB4 cell line, supporting its potential as a potential therapeutic candidate for leukemia treatment. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1629/rc).
Methods
Cell culture
The 293T, NB4, K562 and THP-1 cell lines were obtained from the American Type Culture Collection (ATCC) (https://www.atcc.org/). The three myeloid leukemia cell lines (NB4, K562, THP-1) were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium, supplemented 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The 293T cell line was maintained in high-glucose Dulbecco modified Eagle medium (DMEM) containing 10% FBS and 1% penicillin-streptomycin. Primary bone marrow cells from leukemia-afflicted mice were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM), enriched 10% FBS, 1% penicillin-streptomycin, 10 ng/mL mouse recombinant interleukin-3 (IL-3, STEMCELL Technologies, Vancouver, Canada), 10 ng/mL interleukin-6 (IL-6, STEMCELL Technologies), 100 ng/mL stem cell factor (mSCF, STEMCELL Technologies), and 1 mM 2-Mercaptoethanol (21985023, Thermo, Waltham, USA). All cell cultures were incubated at 37 ℃ in a 5% CO2 atmosphere and the culture media were refreshed every 2 days.
Reagents and antibodies
The library of natural terpenoids, containing 65 compounds, was purchased from MedChemExpress (MCE, Shanghai, China). DML was obtained from MedChemExpress (#HY-N0587, Shanghai, China). The Cell Count Kit-8 (CCK-8) was obtained from BIOGOUND (Chongqing, China), and azoramide was obtained from Selleck (#S8304, Shanghai, China). The EdU assay kit used was the Click-iT™ EdU Alexa Fluor™ 488 Flow Cytometry Assay Kit (#C10425, Invitrogen, Carlsbad, USA).
For Western blot analysis, the following antibodies were employed: ACTIN (#AC004, ABclonal, Wuhan, China), GAPDH (#AF1186, Beyotime, Shanghai, China), ATF6 (#A0202, ABclonal, Wuhan, China), IRE1α (#A21021, ABclonal), Phospho-IREIa (#AP0878, ABclonal), XBP1-s (#A22546, ABclonal), PERK (#A18196, ABclonal), Phospho-PERK (#AP0886, ABclonal), eIF2α (#A21221, ABclonal), Phospho-eIF2α (#AP0692, ABclonal), ATF4(#A0201, ABclonal), CHOP (#A5462, Selleck, Shanghai, China), BCL2 (#A20777, ABclonal), CASEPASE-3 (#A19654, ABclonal), PARP (#9542T, Cell Signaling Technology, Danvers, USA). For flow cytometry, the antibodies used including anti-annexinV-APC (#640920, Biolegend, San Diego, USA), 4',6-diamidino-2-phenylindole (DAPI; #C1002, Beyotime), anti-Ki67-PE (#151210, Biolegend), anti-CD45-PE (#304008, Biolegend).
Cell viability detection
The CCK-8 assay was utilized to assess the suppression effects of terpenoids at a concentration of 10 µM on NB4 cells. Additionally, this assay was employed to evaluation of cell proliferation and the calculation of the half-maximal inhibitory concentration (IC50) for NB4, K562, and THP-1 leukemia cell lines following treatment with DML. Cell count was performed using TC10 Counting Slides (Bio-Rad, Hercules, USA, #1450015). For each experiment, 7,000 cells were seeded in each well of 96-well plates with three replicates per experimental condition. Dimethyl sulfoxide (DMSO) served as the control. After 48 hours of culturing, 10 µL of CCK-8 reagent was added to each well, followed by an additional 2-hour incubation. The absorbance at 450 nM [optical density (OD)450] was measured using a microplate reader (TECAN, Spark, Männedorf, Switzerland).
Apoptosis assay
For the apoptosis assessment, NB4 and K562 cells were treated with DMSO or DML at concentrations of 0, 1, 2 and 4 µM, while THP-1 cells were treated at concentrations of 0, 1, 3 and 6 µM. The cells were incubated at 37 ℃ for 48 hours. After treatment, the cells were harvested, washed with 1× binding buffer containing calcium, and then stained with anti-annexin V-APC and DAPI. The cells were analyzed using a BD Canto flow cytometer (BD Biosciences, San Jose, CA, USA).
Cell cycle determination
The cell cycle was assessed using Ki-67 staining and EdU incorporation assay. For Ki-67 staining, 1 million cells were fixed and permeabilized using the Foxp3/Transcription Factor Staining Buffer Set (#00552300, Thermo, USA). Subsequently, the cells were stained with anti-Ki67-PE antibody (Biolegend) and DAPI (8 µg/mL) overnight. For the EdU incorporation assay, EdU was added to the cell culture medium and incubated at 37 ℃ for approximately 1 hour. After treatment, 1 million cells were harvested and stained according to the manufacturer’s instructions using Click-iT™ EdU Assay Kit.
Transwell assay
Prepare the upper chamber of the Transwell by adding the diluted matrix. Suspend the cells (200 µL containing total 1×105 cells) in serum-free RPMI-1640 medium containing varying concentrations of DML and inoculate into the upper chamber. Add RPMI-1640 medium containing 10% FBS to the lower chamber. Incubate the cells at 37 ℃ in 5% CO2 atmosphere for 48 hours. At incubation, fixed the cells with 4% formaldehyde for 20 minutes and stained with crystal violet for 10 minutes. Quantify the cells remaining in the chamber using a light microscope.
Quantification of aggregated proteins (PROTEOSTAT staining)
NB4 and K562 cells were treated with DML and analyzed using PROTEOSTAT® Aggresome Detection Kit (ENZ-51035, Enzo Life Sciences, Farmingdale, USA). Briefly, cells were fixed in Cytofix/Cytoperm Fixation and Permeabilization Solution (#00552300, Thermo, USA) for 30 minutes. The fixed cells were then stained with ProteoStat dye at a 1:20,000 dilution in PBS for 30 minutes. After washing, the cells were analyzed using a BD Canto flow cytometer.
RNA isolation and quantitative reverse transcription polymerase chain reaction (RT-PCR)
Total RNA from cells treated with DML was extracted using the RNAiso plus Kit (Takara, Kusatsu, Japan), following the manufacturer’s instructions precisely. Complementary DNA (cDNA) synthesis was then performed using the PrimeScript RT Reagent Kit with gDNA Eraser (RR047Q, Takara). The expression levels of target genes were quantified using the TB Green Premix Ex Taq Kit (RR420Q, Takara) on a RT-PCR Detection Systems (Bio-Rad). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as an internal control for sample normalization. The sequences of the specific primers used are listed in Table 1.
Table 1
| Genes | Primer sequences (forward/reverse) |
|---|---|
| GAPDH | GTCTCCTCTGACTTCAACAGCG |
| ACCACCCTGTTGCTGTAGCCAA | |
| CEBPB | AGAAGACCGTGGACAAGCACAG |
| CTCCAGGACCTTGTGCTGCGT | |
| CHOP | GGAAACAGAGTGGTCATTCCC |
| CTGCTTGAGCCGTTCATTCTC | |
| ATF4 | CTCCGGGACAGATTGGATGTT |
| GGCTGCTTATTAGTCTCCTGGAC | |
| DR5 | AAGACCCTTGTGCTCGTTGT |
| GACACATTCGATGTCA CTCCA |
PCR, polymerase chain reaction.
RNA sequencing (RNA-seq)
NB4 cells were treated with DML at a concentration of 2 µM for 48 hours before being harvested for RNA-seq. The RNA-seq was carried out externally by Annoroad Gene Technology (Beijing, China) utilizing the Illumina Novaseq S4 platform. Differential gene expression was analyzed by DESeq2 (Version 1.26.0), applying criteria of a false discovery rate (FDR) of less than 0.05 and a fold change (FC) more than 1.5. Subsequently, gene set enrichment analysis (GSEA) was performed using OmicShare tools (Version 6.2), available at https://www.omicshare.com/tools (accessed in February 2023).
Western blotting
Protein concentrations were determined using a bicinchoninic acid (BCA) kit (Beyotime, Shanghai, China). Equal amounts of protein samples were loaded into each well and electrophoresed on a 4–20% FastPAGE precast gel (TSINGKE, Beijing, China). The process included transmembrane transfer followed by incubation in non-fat milk. Subsequently, the membranes with separated proteins were incubated overnight at 4 ℃ with primary antibodies, followed by several washes with TBST. The membranes were then incubated for 1–2 hours at room temperature with secondary antibodies. Protein bands were quantified using Image J software, using GAPDH or β-actin with as internal controls. All blots, including all replicates with clear membrane edges, were provided in Figures S1-S7.
Lentiviral constructs and transduction for short hairpin RNA (shRNA) interference targeting CHOP
CHOP-specific short hairpin RNAs (shCHOP) were prepared by Tsingke (Beijing, China) and cloned into the pLKO.1-copGFP-2A-PURO vector. The oligonucleotide sequences for two shRNAs were ‘CCGG-CTGCACCAAGCATGAACAATT-CTCGAG-AATTGTTCATGCTTGGTGCAG-TTTTTT’ and ‘CCGG-AGGTCCTGTCTTCAGATGAAA-CTCGAG-TTTCATCTGAAGACAGGACCT-TTTTTT’.
For lentiviral production, 293T cells were co-transfected with shCHOP plasmids and the packaging plasmids, psPAX2 and pMD2.G, using polyetherimide (PEI) as the transfection reagent. Viral supernatants were then harvested at 48 and 72 hours post-transfection. The viruses were stored at −80 ℃ until needed. For lentiviral transduction, NB4 cells were infected with the prepared viral supernatants through spinoculation at 2,000 rpm for 2.5 hours in the presence of polybrene (10 µg/mL). This process was repeated twice for enhanced infection efficiency. Following the transduction, cells expressing the shRNAs were selected using 2 µg/mL puromycin for 5 days.
Measurement of the adenosine triphosphate (ATP) levels
The ATP level in NB4 cells treated with DML was measured at 24 and 48 hours using an ATP detection kit (#S0026, Beyotime). After treating the cells with DML for the respective durations, 1 million cells were lysed, and the supernatant was used for the assays. A standard curve was using several fixed concentrations of ATP standards. The ATP levels in the samples were then quantified based on this standard curve.
Reactive oxygen species (ROS) detection
A ROS Assay Kit (#S0033S, Beyotime) was used to measure ROS levels in NB4 cells treated with DML for 48 hours. The treated cells were stained with serum-free DMEM adding DCFH-DA at a final concentration of 10 µM for 20 minutes. After staining, the cell suspension was discarded, and the cells were washed three times with serum-free DMEM. The cells were then analyzed using a BD Canto flow cytometer.
Measurement of intracellular calcium signals
The measurement of intracellular calcium signaling of NB4 cells treated with DML for either 24 or 48 hours was performed using Fluo-4 AM (#S1060, Beyotime). The cells were subsequently analyzed using a BD Canto flow cytometer.
Mice experiments
To evaluate the therapeutic potential of DML against myeloid leukemia in vivo, we established a murine xenograft model. Male NOD-PrkdcscidIl2rgem1/Smoc (M-NSG) mice (4–6 weeks old; Shanghai Model Organisms, Shanghai, China) were conditioned with total body irradiation (0.5 Gy X-ray). Approximately 4–5 hours post-irradiation, 3×106 NB4 cells, suspended in 100 µL sterile PBS, were intravenously injected via the tail vein. Two weeks post-injection, peripheral blood was collected to evaluate the disease progression by detecting the proportion of human CD45-positive cells using an anti-CD45-PE antibody. A sustained elevation of human CD45-positive cells to ≥5% in peripheral blood was defined as successful engraftment and the threshold for established leukemia.
Upon confirmation of leukemia, mice were randomized to treatment groups. The treatment group received DML with intraperitoneal injections at a dosage of 0.5 mg/kg body weight every two days. The control group received an equivalent volume of DMSO vehicle alone. The efficacy of DML in prolonging survival was monitored and compared with the control group. Experiments were performed under a project license (No. IACUC-CQMU-2023-12096) granted by the Ethics Committee of Chongqing Medical University, in compliance with its institutional guidelines for the care and use of animals. A protocol was prepared before the study without registration.
Statistical analysis
Unpaired Student’s t-test was used to assess the statistical significance of data. The P<0.05 was considered statistically significant. GraphPad Prism 9.0 software was used for statistics and graphs, with the significance denoted as follows: *, P<0.05; **, P<0.01; and ***, P<0.001. The results were confirmed in three independent experiments to ensure reproducibility.
Results
DML as a natural compound against myeloid leukemia
In order to identify novel agents against myeloid leukemia, 65 terpenoids were meticulously screened from natural product library (Table S1). DML, toosendanin, and pseudolaric acid B significantly reduced NB4 cells viability at 10 µM concentration determined via CCK-8 assay (Figure 1A). Previous studies have indicated that toosendanin induces cell apoptosis in HL-60 cells and pseudolaric acid B arrests the cell cycle and induces apoptosis in K562 cells (26,27). However, the role and mechanisms of DML in myeloid leukemia cells have not been fully elucidated. We assessed cell viability of three myeloid leukemia cell lines (NB4 and THP-1 for AML, K562 for CML) treated with DML. DML significantly inhibited cell viability of these cells at three given concentrations (Figure 1B). To further evaluate drug efficacy, the IC50 values of DML were determined. The IC50 values for NB4, K562, and THP-1 cells were 1.671, 1.632, and 2.872 µM, respectively (Figure 1C). These findings indicate that DML has inhibitory activity on myeloid leukemia cells and holds potential as a novel molecule for myeloid leukemia treatment.
DML promotes cell cycle arrest and apoptosis in myeloid leukemia cells
DML has inhibitory activity on myeloid leukemia cells, Ki67 and EdU staining were used to assess the impact of DML on cell cycle progression. Compared to DMSO group, DML treatment significantly increased the proportions of G0 phase in both NB4 and K562 cells at 2 and 4 µM concentrations (Figure 2A,2B and Figure S8A,S8B). Additionally, S phase significantly decreased in NB4 cells at 2 and 4 µM concentrations of DML (Figure 2C,2D). Similar changes of S phase were observed in THP-1 cells at all three concentrations of DML (Figure S8C,S8D). These findings confirm that DML effectively inhibits cell growth through G0 phase arrest in myeloid leukemia cells.
NB4 cells treated with DML showed some phenomena such as envelope rupture and nuclear fragmentation in nuclear staining, suggesting that DML may induce apoptosis in NB4 cells (Figure S8E,S8F). Subsequently, early and late apoptosis were assessed in NB4, K562, and THP-1 cells, which treated with various concentrations of DML. The statistical results showed that DML consistently increased early and late apoptosis depending on DML concentrations across three myeloid leukemia cell lines (Figure 3A,3B).
Apoptosis involves two essential pathways: the extrinsic and intrinsic pathways (28). Previous research has shown that DML activates the extrinsic apoptotic signaling pathway in prostate cancer cells, thereby inhibiting cell proliferation (29). To elucidate the mechanism of DML-induced apoptosis in myeloid leukemia cells, we analyzed several key components of these pathways. In the intrinsic pathway, levels of the anti-apoptotic protein BCL-2 were notably decreased in NB4 and K562 cells. Similarly, inactive CASPASE-3 levels were decreased significantly, while downstream active CASPASE-3 and PARP increased in a concentration dependent manner in both cell types (Figure 3C). In the extrinsic pathway, the levels of caspase-8, an exogenous apoptotic marker protein, were significantly increased in NB4 and K562 cells (Figure 3D). DR5, a transmembrane receptor, responds to ligands induced by tumor necrosis factor-related apoptosis and transmit apoptotic signals. Additionally, we observed enhanced expression of death receptor DR5 in NB4 and K562 cells (Figure S8G). Collectively, these results indicate that DML triggers both the intrinsic and extrinsic apoptosis pathways in myeloid leukemia cells.
Additionally, we evaluated the effect of DML on the invasive ability of NB4 cells, and the results showed that DML treatment weakened the invasive ability of NB4 cells (Figure S8H).
DML upregulates ER stress and UPR pathway in myeloid leukemia cells
To elucidate the effects of DML treatment on gene expression in leukemia cells, RNA-seq was performed on NB4 cells treated with DML at 2 µM concentration. 903 differentially expressed genes were identified (with a FC >1.5 and a q-value <0.05), including 588 upregulated and 315 downregulated genes (Figure S9A). Notably, the expression of cell growth-inhibitory genes such as CDKN1A and CDKN1C significantly increased in the DML-treated group, along with genes involved in cell apoptosis, including ATF4, ATF5, CEBPB, CHOP, DR5 (death receptor), IP3R1 and IRE1α (Figure S9A). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses revealed that these differentially expressed genes were enriched in pathways related to apoptosis, MAPK, ROS, TNF, NOD-like, Toll-like, and RNA polymerase (Figure S9B). These pathways are consistent with the phenotypes observed in the DML-treated group, which promote cell death and inhibit cell growth. GSEA reports also showed that apoptotic signaling pathway was upregulated in DML-treated group (Figure 4A, Figure S9C).
The ER is a crucial organelle that regulates calcium storage, as well as the biosynthesis, folding, and maturation of transmembrane and secretory proteins (30). ER stress can be triggered by the accumulation of misfolded or unfolded proteins within the ER. This condition activates a set of signaling pathways known as the UPR, which either restores ER homeostasis or, under irreparable conditions, initiates cell death (31). Intriguingly, DML treatment upregulated both the UPR pathway and the intrinsic apoptotic signaling pathway in response to ER stress (Figure 4B,4C and Figure S9D,S9E). Consequently, we hypothesize that DML treatment leads to the accumulation of an excessive number of unfolded proteins, exceeding the ER’s capacity to manage, which in turn triggers UPR-mediated apoptosis.
Typical genes associated with ER stress and the UPR were further confirmed through q-PCR. ATF4, CHOP, and CEBPB, were upregulated in NB4 and K562 cells following DML treatment (Figure 4D,4E). Additionally, transmission electron microscopy showed severe swelling and dilatation of ER in DML-treated cells (Figure 4F). Under ER stress condition, unfolded or denatured proteins accumulate and form massive protein aggresomes in the ER lumen. The intensity of aggresomes were measured via PROTEO-STAT Staining. The results showed that the signal intensities were significantly increased in NB4 and K562 cells treated with DML at 1 and 2 µM concentration (Figure 4G,4H). However, the intensity dramatically weakened at 4 µM, likely due to extensive cell death caused by this concentration of DML. These observations suggest that DML may trigger apoptosis in myeloid leukemia cells through excessive ER stress and UPR.
DML induces cell apoptosis through ER stress triggered UPR
Azoramide is a small molecule inhibitor of the UPR by improving protein folding capabilities and activating ER chaperone capacities across multiple systems to alleviate cellular ER stress (32). This study aimed to verify whether the DML-induced apoptosis was caused by UPR in response to excessive ER stress. The findings showed that azoramide treatment rescued the apoptosis induced by DML (Figure 5A), significantly reduced the intensity of aggresomes (Figure 5B), and restored the relative expressions of CHOP, CEBPB, and ATF4 to normal levels (Figure 5C). Additionally, transmission electron microscopy results revealed that azoramide restored ER membrane expansion caused by DML treatment (Figure 5D). Collectively, these results suggest cell apoptosis in myeloid leukemia cells induced by DML is caused by UPR in response to irreversible ER stress.
DML induces ER stress by increasing intracellular calcium level
Previous studies have indicated that ATP depletion, ROS accumulation, and calcium displacement affect ER homeostasis (33). To identify the factor contributing to ER stress caused by DML, we measured ATP concentration, ROS generation, mitochondrial membrane potential and intracellular calcium levels. Compared to the control group, ATP levels in cells treated with DML for 48 hours were significantly reduced, while there was only a slight decrease at 24 hours (Figure 6A). Surprisingly, ROS generation was suppressed in DML-treated NB4 and THP-1 cells (Figure 6B). Since mitochondria are the primary sites for ATP and ROS synthesis (34), the reduction in these substances might indicate side effects from mitochondria damage. To further explore the impact of DML treatment on mitochondria, we used JC-1 staining to assess mitochondrial membrane potential. The results showed that a significantly decrease in mitochondrial membrane potential after DML treatment (Figure 6C), indicating significant mitochondria damage, which may contribute to intrinsic apoptosis rather than being primary triggers for ER stress.
The ER is the main site for calcium storage within cells and is crucial for maintaining calcium homeostasis (35). ER stress may arise from a loss of cellular homeostasis and disruption of calcium signaling pathways (36). Therefore, intracellular calcium levels were assessed in NB4 cells and found that calcium level increased with in the concentration and duration of DML treatment (Figure 6D). The inositol 1,4,5-triphosphate receptor (IP3R), a principal channel protein located in the ER, mediates calcium release (37). To determine whether calcium flux was linked to DML-induced apoptosis, we analyzed apoptosis after cotreatment with DML and the IP3R1 inhibitor, 2-aminoethyl diphenylborinate (2-APB). In NB4 cells, apoptosis induced by 2 µM DML could be significantly reversed by 50 µM of 2-APB. Additionally, we verified the changes in intracellular calcium levels in NB4 cells after combined treatment with DML and 2-APB. The results showed that 2-APB could also effectively reverse the increase in calcium levels induced by DML (Figure 6E,6F). These results reveal that an increase in intracellular calcium level is an important factor in ER stress-induced apoptosis in NB4 cells due to DML treatment.
DML triggers UPR by regulating PERK-eIF2α-ATF4-CHOP signaling pathway
In mammalian cells, three transmembrane sensors—PERK, IRE1, and ATF6—are responsible for detecting unfolded and misfolded protein aggregates accumulating in the ER lumen (38). These pathways either reestablish ER homeostasis or, under conditions of irreparable ER stress, initiate cell apoptosis (31). We investigated the key proteins in these three pathways through Western blotting to determine if DML-induced apoptosis in leukemia cells was mediated through ER stress. The results showed that in the NB4 cell line, the expression levels of PERK, phosphorylated PERK (Thr982), eIF2α, phosphorylated eIF2α (Ser51), and ATF4 protein increased with the concentration of DML (Figure 7A). In the PERK signaling pathway, the downstream effector CHOP is known to induce apoptosis (39). Western blotting results showed DML significantly activated CHOP expression in NB4 cells (Figure 7A). However, the level of uncleaved ATF6 protein in the DML treatment group did not change significantly, and cleaved ATF6 was slightly upregulated. The core proteins of the IRE1 signaling pathway, IRE1α and p-IRE1α, were upregulated with increasing DML concentration, and activated XBP1-s was significantly upregulated only in the 4 µM group (Figure 7B). This disconnect is likely a secondary or compensatory event for DML instigates ER stress. In contrast, the expression levels of key components within the PERK/eIF2α/ATF4/CHOP pathway exhibited a clear and concordant increase with DML concentrations. Based on these results, we hypothesize that DML-induced apoptosis is primarily driven by the PERK-eIF2α-ATF4-CHOP signaling pathway. Notably, the increase in PERK and CHOP expression was alleviated by azoramide treatment (Figure 7C,7D). Lastly, silencing CHOP via shRNA in NB4 cells and evaluating apoptosis following DML treatment were performed. The efficacy of RNA interference with two shRNAs targeting CHOP was depicted in Figure 7E. CHOP interference led to a significantly reduction in apoptosis induced by DML in NB4 cells (Figure 7F).
DML exhibits anti-leukemia activity in vivo
To further explore the anti-leukemia effects of DML ex vivo, we analyzed cell apoptosis in primary leukemia blast cells from Hoxa9/Meis1-induced murine AML model. Bone marrow cells from healthy mice served as a control to evaluate the DML’s cytotoxicity. The results indicated that in leukemia bone marrow cells, DML significantly induced both early and late apoptosis at two tested concentrations. In contrast, only late apoptosis in healthy bone marrow cells was slightly increased in 2 µM group and dramatically upregulated in 4 µM group post-DML treatment (Figure 8A). However, DML exhibited less cytotoxicity of normal cells compared to leukemia blast cells. This result provides preliminary evidence for the selective anti-leukemic activity of DML.
Subsequently, we established a NB4 cell line-derived xenograft model in M-NSG mice to assess the DML’s antitumor effects in vivo. Mice were treated with DML (0.5 mg/kg) or an equivalent vehicle every other day, totaling four doses. We monitored the weight changes of the animals during the treatment period. Before the treatment, there was no significant difference in weight between the mice in the drug treatment group and the control group (data not shown). During the treatment, the weight of the control group showed a slight decrease, which could be due to the progression of the disease in the control mice that did not receive treatment. Our findings demonstrated that DML treatment significantly prolonged the survival of the xenograft model compared to vehicle-treated mice (Figure 8B).
Discussion
Natural products are invaluable resources for preventing, inhibiting, or reversing carcinogenesis processes (40). Terpenoids, in particularly, have demonstrated significant anti-cancer activity, offering promising opportunities for cancer therapy (16). In this study, we selected DML from a library of 65 terpenoids for its significant inhibitory effects on myeloid leukemia. Previous studies found that DML inhibited cell proliferation in melanoma and hepatoma carcinoma (23,41), and induced apoptosis in breast cancer (42). We found that DML exhibits anti-proliferative and apoptotic effects in various myeloid leukemia cell lines, including AML cell lines (NB4 and THP-1) and CML cell line (K562). Moreover, DML effectively prolonged survival in an NB4 cell-derived xenograft mouse model. As a novel alternative therapeutic agent, DML shows promising anti- myeloid leukemic potential and may provide new insights for researchers and hematologists in both fundamental and clinical leukemia research. However, this study is limited by its focus solely on myeloid leukemia cell lines, investigating the efficacy and mechanism of DML in ALL and other lymphoid malignancies will be a key direction for our future research.
Previously studies have demonstrated that disturbances in ER functions, whether due to changes in the tumor microenvironment or the effects of anticancer drugs, can lead to the accumulation of unfolded proteins, thereby inducing ER stress. ER stress can lead to outcomes that promote either cell survival or apoptosis (33). The duration and intensity of the UPR in response to ER stress ultimately determine the cell’s fate (43). Sustained, non-lethal ER stress can enable cells to adapt to the cytotoxic effects of chemotherapy, supporting tumor growth (44,45). However, when ER stress becomes intense or prolonged beyond the adaptive capacity of the UPR, it can exceed its protective limits and trigger apoptosis in cancer cells. The primary signaling pathway for ER stress-induced apoptosis is the PERK-eIF2α-ATF4 axis. ER stress can also initiate apoptosis through PERK-CHOP-DR5 axis (46). CHOP reduces the expression of the anti-apoptotic protein BCL2, which inhibits the release of mitochondrial cytochrome c during apoptosis and subsequently activates multiple caspases (47). Notably, previous research has shown that DML induces apoptosis in liver cancer stem cells by upregulating CASPASE8 and BAX proteins and downregulating BCL2 expression (22). Furthermore, phosphorylation of PERK and eIF2α activates ATF4 and CHOP, leading to apoptosis via the caspase pathway (48). Mechanistically, DML influences intracellular calcium concentrations involved in ER stress, primarily activates PERK/eIF2α/ATF4/CHOP signaling axis in response to ER stress, and subsequently induces apoptosis through both intrinsic and extrinsic pathways (Figure 8C). While this study has elucidated the effects of DML on inducing endoplasmic stress and apoptosis, we have not fully analyzed the molecular target of DML’s direct binding that promote these processes. Further in-depth research is required to fully understand these mechanisms.
ROS accumulation is often cited as a crucial factor inducing ER stress (33). In prostate cancer cells, excessive ROS can upregulate UPR markers such as IRE1α and p-PERK, and increase intracellular calcium concentrations (29). However, in our study, DML did not elevate ROS levels in NB4 and THP-1 cells. We speculate that ROS production in mitochondria might initially increase with damage, but as damage intensifies, ROS might exceed the cell’s clearance capacity, leading to exhaustion of the antioxidant system, and ultimately manifesting as decreased ROS levels. We might have captured this state in the later stages of damage. Additionally, we observed a significant decrease in mitochondrial membrane potential after DML treatment. Severe mitochondrial damage could lead to serious dysfunction in the electron transport chain, affecting ROS production pathways and potentially resulting in decreased ROS output. Previous research has shown that calcium displacement impacts ER homeostasis and play a role in apoptosis regulation in eukaryotes (49,50). The IP3R1, a significant channel on the ER membrane, facilitates calcium transport (37). In DML-treated NB4 cells, increased intracellular calcium levels could be mitigated by an IP3R1 inhibitor, partially restoring ER homeostasis.
The UPR is crucial for maintaining the ER homeostasis in both normal hematopoietic stem cells and leukemia stem cells (51,52). Activation of the UPR is essential for leukemia stem cells to meet the increased metabolic demands associated with rapid cell proliferation (53). In leukemia, an excessive response to ER stress can lead to apoptosis (54,55), suggesting that targeting ER stress could be a new therapeutic target for leukemia treatment (51). Our study found that DML induces apoptosis in myeloid leukemia cells directly through PERK/eIF2α/ATF4/CHOP signaling pathway in response to ER stress. Additionally, we demonstrated that intracellular calcium also participates in DML-induced apoptosis.
It should be noted that THP-1 cells exhibited a lower level of late apoptosis compared to NB4 and K562. It is an indication of the heterogeneous nature of myeloid leukemias and multi-faced anti-leukemic capacity of DML.
Previous studies have shown that DML exhibits no significant cytotoxicity on lymphocytes at concentration below 1 µg/mL in vitro (56). Additionally, no significant changes were observed in body weight or blood parameters of rats at an LD50 range of 283.37 to 288.37 mg/kg (21). In this study, we assessed the potential selective toxicity of DML by comparing its effects on bone marrow cells from leukemic mice versus normal mice. We found that DML induced more pronounced apoptosis in the leukemic bone marrow, while its impact on the normal bone marrow was considerably milder. These results highlight the anti-leukemic effects of DML and underscore its potential as a therapeutic agent for leukemia treatment.
Conclusions
In conclusions, our study demonstrates that DML can inhibit the proliferation of myeloid leukemia and promote cell apoptosis, accompanied by characteristic ER stress markers including elevated intracellular calcium, ROS generation, ATP depletion, and unfolded protein accumulation. DML administration significantly prolonged survival in an M-NSG mouse xenograft model engrafted with NB4 leukemia cells. Mechanistically, DML induces apoptosis in myeloid leukemia cells directly through PERK/eIF2α/ATF4/CHOP signaling pathway in response to ER stress.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1629/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1629/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1629/prf
Funding: This work was funded by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1629/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Experiments were performed under a project license (No. IACUC-CQMU-2023-12096) granted by the Ethics Committee of Chongqing Medical University, in compliance with its institutional guidelines for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Goel H, Kumar R, Tanwar P, et al. Unraveling the therapeutic potential of natural products in the prevention and treatment of leukemia. Biomed Pharmacother 2023;160:114351. [Crossref] [PubMed]
- Siegel RL, Kratzer TB, Giaquinto AN, et al. Cancer statistics, 2025. CA Cancer J Clin 2025;75:10-45. [Crossref] [PubMed]
- Khoury JD, Solary E, Abla O, et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Myeloid and Histiocytic/Dendritic Neoplasms. Leukemia 2022;36:1703-19.
- Cammarata-Scalisi F, Girardi K, Strocchio L, et al. Oral Manifestations and Complications in Childhood Acute Myeloid Leukemia. Cancers (Basel) 2020;12:1634. [Crossref] [PubMed]
- Kantarjian HM, DiNardo CD, Kadia TM, et al. Acute myeloid leukemia management and research in 2025. CA Cancer J Clin 2025;75:46-67. [Crossref] [PubMed]
- DiNardo CD, Jonas BA, Pullarkat V, et al. Azacitidine and Venetoclax in Previously Untreated Acute Myeloid Leukemia. N Engl J Med 2020;383:617-29. [Crossref] [PubMed]
- Döhner H, Wei AH, Appelbaum FR, et al. Diagnosis and management of AML in adults: 2022 recommendations from an international expert panel on behalf of the ELN. Blood 2022;140:1345-77. [Crossref] [PubMed]
- Bhansali RS, Pratz KW, Lai C. Recent advances in targeted therapies in acute myeloid leukemia. J Hematol Oncol 2023;16:29. [Crossref] [PubMed]
- Shao R, Li Z, Xin H, et al. Biomarkers as targets for CAR-T/NK cell therapy in AML. Biomark Res 2023;11:65. [Crossref] [PubMed]
- Jabbour E, Kantarjian H. Chronic myeloid leukemia: 2020 update on diagnosis, therapy and monitoring. Am J Hematol 2020;95:691-709. [Crossref] [PubMed]
- Jabbour E, Kantarjian H. Chronic myeloid leukemia: 2018 update on diagnosis, therapy and monitoring. Am J Hematol 2018;93:442-59. [Crossref] [PubMed]
- Sembill S, Ampatzidou M, Chaudhury S, et al. Management of children and adolescents with chronic myeloid leukemia in blast phase: International pediatric CML expert panel recommendations. Leukemia 2023;37:505-17. [Crossref] [PubMed]
- Osman AEG, Deininger MW. Chronic Myeloid Leukemia: Modern therapies, current challenges and future directions. Blood Rev 2021;49:100825. [Crossref] [PubMed]
- Zhang X, Qiu H, Li C, et al. The positive role of traditional Chinese medicine as an adjunctive therapy for cancer. Biosci Trends 2021;15:283-98. [Crossref] [PubMed]
- Gershenzon J, Dudareva N. The function of terpene natural products in the natural world. Nat Chem Biol 2007;3:408-14. [Crossref] [PubMed]
- Chopra B, Dhingra AK, Dhar KL, et al. Emerging Role of Terpenoids for the Treatment of Cancer: A Review. Mini Rev Med Chem 2021;21:2300-36. [Crossref] [PubMed]
- Cai J, Yi M, Tan Y, et al. Correction to: Natural product triptolide induces GSDME-mediated pyroptosis in head and neck cancer through suppressing mitochondrial hexokinase-II. J Exp Clin Cancer Res 2021;40:298. [Crossref] [PubMed]
- Zhang Y, Peng F, Yu C. Therapeutic potential of Curcuma oil and its terpenoids in gynecological cancers. Biomed Pharmacother 2023;157:114016. [Crossref] [PubMed]
- Zhang L, Wei W. Anti-inflammatory and immunoregulatory effects of paeoniflorin and total glucosides of paeony. Pharmacol Ther 2020;207:107452. [Crossref] [PubMed]
- Chang KF, Huang XF, Chang JT, et al. Cedrol suppresses glioblastoma progression by triggering DNA damage and blocking nuclear translocation of the androgen receptor. Cancer Lett 2020;495:180-90. [Crossref] [PubMed]
- Xu W, Lin Z, Yang C, et al. Immunosuppressive effects of demethylzeylasteral in a rat kidney transplantation model. Int Immunopharmacol 2009;9:996-1001. [Crossref] [PubMed]
- Pan L, Feng F, Wu J, et al. Demethylzeylasteral targets lactate by inhibiting histone lactylation to suppress the tumorigenicity of liver cancer stem cells. Pharmacol Res 2022;181:106270. [Crossref] [PubMed]
- Zhao Y, He J, Li J, et al. Demethylzeylasteral inhibits cell proliferation and induces apoptosis through suppressing MCL1 in melanoma cells. Cell Death Dis 2017;8:e3133. [Crossref] [PubMed]
- Yang Y, Han J, Ma Y, et al. Demethylzeylasteral inhibits cell proliferation and enhances cell chemosensitivity to 5-fluorouracil in Colorectal Cancer cells. J Cancer 2020;11:6059-69. [Crossref] [PubMed]
- Cotoraci C, Ciceu A, Sasu A, et al. The Anti-Leukemic Activity of Natural Compounds. Molecules 2021;26:2709. [Crossref] [PubMed]
- Ju J, Qi Z, Cai X, et al. Toosendanin induces apoptosis through suppression of JNK signaling pathway in HL-60 cells. Toxicol In Vitro 2013;27:232-8. [Crossref] [PubMed]
- Jiang L, Wen C, He Q, et al. Pseudolaric acid B induces mitotic arrest and apoptosis in both imatinib-sensitive and -resistant chronic myeloid leukaemia cells. Eur J Pharmacol 2020;876:173064. [Crossref] [PubMed]
- Jan R, Chaudhry GE. Understanding Apoptosis and Apoptotic Pathways Targeted Cancer Therapeutics. Adv Pharm Bull 2019;9:205-18. [Crossref] [PubMed]
- Yang DL, Zhang YJ, He LJ, et al. Demethylzeylasteral (T-96) initiates extrinsic apoptosis against prostate cancer cells by inducing ROS-mediated ER stress and suppressing autophagic flux. Biol Res 2021;54:27. [Crossref] [PubMed]
- Samali A, Fitzgerald U, Deegan S, et al. Methods for monitoring endoplasmic reticulum stress and the unfolded protein response. Int J Cell Biol 2010;2010:830307. [Crossref] [PubMed]
- Zhang L, Bassham DC, Pittendrigh BR. Editorial: Plant ER Stress and the UPR Signaling Pathways. Front Plant Sci 2022;13:968353. [Crossref] [PubMed]
- Fu S, Yalcin A, Lee GY, et al. Phenotypic assays identify azoramide as a small-molecule modulator of the unfolded protein response with antidiabetic activity. Sci Transl Med 2015;7:292ra98. [Crossref] [PubMed]
- Chen X, Cubillos-Ruiz JR. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat Rev Cancer 2021;21:71-88. [Crossref] [PubMed]
- Brinkkoetter PT, Song H, Lösel R, et al. Hypothermic injury: the mitochondrial calcium, ATP and ROS love-hate triangle out of balance. Cell Physiol Biochem 2008;22:195-204. [Crossref] [PubMed]
- Rizzuto R, Marchi S, Bonora M, et al. Ca(2+) transfer from the ER to mitochondria: when, how and why. Biochim Biophys Acta 2009;1787:1342-51. [Crossref] [PubMed]
- Krebs J, Agellon LB, Michalak M. Ca(2+) homeostasis and endoplasmic reticulum (ER) stress: An integrated view of calcium signaling. Biochem Biophys Res Commun 2015;460:114-21. [Crossref] [PubMed]
- Schmitz EA, Takahashi H, Karakas E. Structural basis for activation and gating of IP(3) receptors. Nat Commun 2022;13:1408. [Crossref] [PubMed]
- Hetz C, Zhang K, Kaufman RJ. Mechanisms, regulation and functions of the unfolded protein response. Nat Rev Mol Cell Biol 2020;21:421-38. [Crossref] [PubMed]
- Hu H, Tian M, Ding C, et al. The C/EBP Homologous Protein (CHOP) Transcription Factor Functions in Endoplasmic Reticulum Stress-Induced Apoptosis and Microbial Infection. Front Immunol 2018;9:3083. [Crossref] [PubMed]
- Huang M, Lu JJ, Ding J. Natural Products in Cancer Therapy: Past, Present and Future. Nat Prod Bioprospect 2021;11:5-13. [Crossref] [PubMed]
- Gong H, Xu HM, Ma YH, et al. Demethylzeylasteral targets lactate to suppress the tumorigenicity of liver cancer stem cells: It is attributed to histone lactylation? Pharmacol Res 2023;194:106869. [Crossref] [PubMed]
- Chang J, Yang R, Chen L, et al. Discovery of ARF1-targeting inhibitor demethylzeylasteral as a potential agent against breast cancer. Acta Pharm Sin B 2022;12:2619-22. [Crossref] [PubMed]
- Hetz C, Papa FR. The Unfolded Protein Response and Cell Fate Control. Mol Cell 2018;69:169-81. [Crossref] [PubMed]
- Wang WA, Groenendyk J, Michalak M. Endoplasmic reticulum stress associated responses in cancer. Biochim Biophys Acta 2014;1843:2143-9. [Crossref] [PubMed]
- Kim H, Bhattacharya A, Qi L. Endoplasmic reticulum quality control in cancer: Friend or foe. Semin Cancer Biol 2015;33:25-33. [Crossref] [PubMed]
- Lam M, Marsters SA, Ashkenazi A, et al. Misfolded proteins bind and activate death receptor 5 to trigger apoptosis during unresolved endoplasmic reticulum stress. Elife 2020;9:e52291. [Crossref] [PubMed]
- Oyadomari S, Mori M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ 2004;11:381-9. [Crossref] [PubMed]
- Li X, Zheng J, Chen S, et al. Oleandrin, a cardiac glycoside, induces immunogenic cell death via the PERK/elF2α/ATF4/CHOP pathway in breast cancer. Cell Death Dis 2021;12:314. [Crossref] [PubMed]
- Maurel M, McGrath EP, Mnich K, et al. Controlling the unfolded protein response-mediated life and death decisions in cancer. Semin Cancer Biol 2015;33:57-66. [Crossref] [PubMed]
- Zheng S, Wang X, Zhao D, et al. Calcium homeostasis and cancer: insights from endoplasmic reticulum-centered organelle communications. Trends Cell Biol 2023;33:312-23. [Crossref] [PubMed]
- Khateb A, Ronai ZA. Unfolded Protein Response in Leukemia: From Basic Understanding to Therapeutic Opportunities. Trends Cancer 2020;6:960-73. [Crossref] [PubMed]
- Liu L, Zhao M, Jin X, et al. Adaptive endoplasmic reticulum stress signalling via IRE1α-XBP1 preserves self-renewal of haematopoietic and pre-leukaemic stem cells. Nat Cell Biol 2019;21:328-37. [Crossref] [PubMed]
- Śniegocka M, Liccardo F, Fazi F, et al. Understanding ER homeostasis and the UPR to enhance treatment efficacy of acute myeloid leukemia. Drug Resist Updat 2022;64:100853. [Crossref] [PubMed]
- Hetz C. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol 2012;13:89-102. [Crossref] [PubMed]
- Kharabi Masouleh B, Chevet E, Panse J, et al. Drugging the unfolded protein response in acute leukemias. J Hematol Oncol 2015;8:87. [Crossref] [PubMed]
- Zhu ZL, Qiu XD, Wu S, et al. Blocking Effect of Demethylzeylasteral on the Interaction between Human ACE2 Protein and SARS-CoV-2 RBD Protein Discovered Using SPR Technology. Molecules 2020;26:57. [Crossref] [PubMed]

