Bufalin: a potential drug for regulating EGFR-TKIs resistance in lung cancer via the EGFR-PI3K/Akt-mTOR signaling
Original Article

Bufalin: a potential drug for regulating EGFR-TKIs resistance in lung cancer via the EGFR-PI3K/Akt-mTOR signaling

Yueqin Bai1#, Yabin Gong2#, Ruifang Cui1, Qingpeng Deng3, Xiaozhen Zhao4, Chang Liu5, Longke Dong6

1Department of Medical Oncology, the First Clinical Medical College of Shaanxi University of Chinese Medicine, Xianyang, China; 2Department of Medical Oncology, Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai, China; 3Department of Orthopedics and Traumatology, the First Clinical Medical College of Shaanxi University of Chinese Medicine, Xianyang, China; 4Department of Medical Oncology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; 5Department of Emergency, Longhua Hospital (Hangtou Campus), Shanghai University of Traditional Chinese Medicine, Shanghai, China; 6Department of Medical Oncology, Baoji Central Hospital, Baoji, China

Contributions: (I) Conception and design: Y Bai, Y Gong, L Dong; (II) Administrative support: C Liu, L Dong; (III) Provision of study materials or patients: R Cui, Q Deng, X Zhao; (IV) Collection and assembly of data: Y Bai, Y Gong, R Cui, Q Deng; (V) Data analysis and interpretation: Y Bai, Y Gong, X Zhao, C Liu; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

#These authors contributed equally to this work.

Correspondence to: Longke Dong, MM. Department of Medical Oncology, Baoji Central Hospital, No. 8 Jiangtan Road, Weibin District, Baoji 721000, China. Email: Donglongke_89798@126.com.

Background: Bufalin has shown potential in overcoming cancer resistance to osimertinib and sorafenib in epidermal growth factor receptor (EGFR)-mutated lung cancer. This study investigated the regulatory effect of bufalin on EGFR tyrosine kinase inhibitors (TKIs) resistance in lung cancer.

Methods: The cell experiments including the MTT assay, flow cytometry, and real-time polymerase chain reaction (RT-PCR) were used to determine the effects of bufalin and/or EGFR-TKIs gefitinib on the growth, proliferation, cycle, apoptosis, and expressions of genes linked to the EGFR-phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt)-mammalian target of rapamycin (mTOR) signal pathway of human non-small cell lung cancer cell line H1975. In animal experiments, a model of H1975 cell subcutaneous graft tumor in severe combined immune deficiency (SCID) mice was created. Then bufalin and gefitinib were administered for three weeks by gavage and intraperitoneal injection, respectively. Tumor weight, volume, and other indicators were analyzed. In the meantime, RT-PCR and immunohistochemistry were performed to quantify key genes and proteins that were related to the EGFR-PI3K/Akt-mTOR signal pathway, including EGFR, PI3K, Akt, mTOR, 70 kDa ribosomal protein S6 kinase (p70S6K), and eukaryotic translation initiation factor 4E-binding protein (4E-BP) in tumor tissues of various intervention groups.

Results: Bufalin and gefitinib could control the cell cycle, induce apoptosis, and impede H1975 cell development and growth. Furthermore, bufalin and gefitinib inhibited the growth of lung cancer tumor and decreased the expression of proteins pertinent to the EGFR-PI3K/Akt-mTOR pathway, including EGFR, Akt, mTOR, and p70S6K. These effects were more pronounced in the combined intervention group.

Conclusions: Bufalin can overcome gefitinib resistance in lung cancer by modulating the EGFR-PI3K/Akt-mTOR signaling pathway.

Keywords: Bufalin; gefitinib; non-small cell lung cancer (NSCLC); EGFR-PI3K/Akt-mTOR


Submitted Jun 10, 2025. Accepted for publication Sep 25, 2025. Published online Dec 22, 2025.

doi: 10.21037/tcr-2025-1217


Highlight box

Key findings

• Bufalin regulates epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) resistance in lung cancer. In vitro/in vivo, it (alone/combined with gefitinib) impacts H1975 cell growth, apoptosis, and EGFR-PI3K/Akt-mTOR-related gene/protein expressions. Combined intervention shows stronger effects on cell cycle, apoptosis, tumor growth, and pathway-related proteins.

What is known and what is new?

• EGFR-TKIs mitigate lung cancer but face resistance. The EGFR-PI3K/Akt-mTOR pathway relates to tumor progression and TKI resistance.

• Bufalin is a potential agent against EGFR-TKIs resistance. It modulates the pathway in H1975 cells (in vitro/xenografts) and enhances effects with gefitinib, offering a new resistance-overcoming approach.

What is the implication, and what should change now?

• Bufalin may act as an EGFR-TKIs (such as gefitinib) adjuvant for resistant lung cancer, improving efficacy via pathway targeting.

• Conduct more pre-clinical research on mechanisms/dosing. Perform clinical trials to test bufalin’s safety/efficacy in resistant patients, accelerating translation.


Introduction

Due to a fatality rate of almost 21%, lung cancer is presently one of the leading culprits of cancer-related deaths worldwide (1). Non-small cell lung cancer (NSCLC) accounts for 80% to 90% of lung cancer patients (2), and about 60% of NSCLC patients are diagnosed at advanced or metastatic stages (2). Epidermal growth factor receptor (EGFR), a member of the tyrosine kinases family, is a key transmembrane glycoprotein that regulates the proliferation, survival, differentiation and metastasis of cancer cells (3,4).

Previous research has revealed that NSCLC development is accompanied by activated EGFR mutations and overexpression of EGFR protein in malignant tumors, based on which targeted treatment regimens for EGFR continue to evolve (5). First-generation EGFR-tyrosine kinase inhibitors (TKIs), such as gefitinib and erlotinib, have been initially established as first-line options for patients with classic activating mutations (e.g., exon 19 deletions or L858R) (6). However, acquired resistance invariably develops, and its mechanisms are complicated, mainly including target gene modification replacement pathway activation and histological or phenotypic transformation, with the EGFR T790M mutation as the most prevalent mechanism (3,7,8). The second-generation TKIs have therefore been designed and developed to address T790M resistance, such as dacomitinib and afatinib. However, their clinical utility is limited by low selectivity for mutant EGFR and potential toxicity (9). Osimertinib, a third-generation, central nervous system (CNS)-active TKI designed to target the T790M mutation, has now become the preferred first-line standard of care due to its superior efficacy and improved tolerability profile compared to earlier agents (6). The evolution of these therapies and their associated resistance mechanisms remains a focus of ongoing research. Some studies have found that EGFR-TKIs combined with cytotoxic drugs can synergically ameliorate EGFR-mutated lung cancer, such as erlotinib combined with cisplatin that can prevent lung cancer cells from proliferating, and pemetrexed treatment that can reduce the acquired resistance of EGFR-mutated lung cancer cells to gefitinib (10,11). These new treatment strategies offer promising alternatives for lung cancer patients who are resistant to EGFR-TKIs.

Bufalin is a natural digoxin component derived from traditional Chinese medicine, Chan Su, which has significant anti-tumor effects and has been confirmed as an effective inhibitor of NSCLC cell proliferation among various extracts of toads (12,13). Its broad anti-cancer effects have been widely unveiled across multiple cancer types, including lung (14,15), liver (16), breast (17), head and neck (18), as well as melanoma (19) cancers. The anti-cancer mechanisms of bufalin mainly consist of promoting apoptosis of cancer cells, inducing cell cycle arrest, and inhibiting cell differentiation, migration and inflammation (20). For instance, bufalin can promote the apoptosis of oral and bladder cancer cells through mitochondria-dependent pathway, and can also impede the growth of stomach or colorectal cancer cells by interfering with the cell cycle (18). In the treatment of lung cancer, bufalin can hinder the growth of NSCLC cells and cause cell death by regulating circ_0046264/miR-522-3p pathway, inhibiting the expression of CDK9, and down-regulating Axl protein and other mechanisms (12,21,22). It is worth noting that bufalin has also shown potential in overcoming cancer resistance to osimertinib and sorafenib in EGFR-mutated lung cancer (23,24). While previous research has demonstrated that bufalin can reverse HGF-induced EGFR-TKI resistance by inhibiting the Met/phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway (25), its efficacy against the intrinsic resistance driven by the EGFR T790M mutation remains unclear. Furthermore, its impact on the downstream mammalian target of rapamycin (mTOR) signaling axis, a critical component of the PI3K network, has not been explored. Therefore, this study aims to investigate the effect and underlying mechanism of bufalin alone and in combination with gefitinib, on overcoming L858R/T790M-mediated resistance in vitro and in vivo, with a specific focus on the complete EGFR-PI3K/Akt-mTOR signaling pathway.

In this work, we used both in vitro and in vivo tests to examine the impact of bufalin on NSCLC patients’ acquired resistance to gefitinib, and explored the relevant mechanism of action. Our study found that bufalin can improve EGFR-TKIs gefitinib resistance in H1975 cells (harboring the classic EGFR L858R/T790M mutation complex) and severe combined immune deficiency (SCID) mice with H1975 xenografts by modulating the EGFR-PI3K/Akt-mTOR signaling pathway. These findings offer a fresh approach to treating lung cancer patients’ resistance to EGFR-TKIs. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1217/rc).


Methods

Materials and reagents

The cell bank of the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (SCSP-597, Shanghai, China), provided the NCI-H1975 cell line (human lung adenocarcinoma cells), which was identified by STR. Bufalin was obtained from the MedChemExpress (HY-N0877, Monmouth Junction, NJ, USA). Gefitinib was provided by Selleck (S1025, Houston, TX, USA). Figure 1 lists the chemical structures of bufalin and gefitinib.

Figure 1 The chemical structures of bufalin and gefitinib.

Antibodies used in this experiment included: EGFR (4267, Cell Signaling Technology, Danvers, MA, USA, dilution: 1:50), PI3K (MA1-74183, Thermo Fisher Scientific, Waltham, MA, USA, dilution: 1:200), Akt (4060, Cell Signaling Technology, dilution: 1:200), mTOR (2983, Cell Signaling Technology, dilution: 1:200), eukaryotic translation initiation factor 4E-binding protein (4E-BP; 9644, Cell Signaling Technology, dilution: 1:1,200), and 70 kDa ribosomal protein S6 kinase (p70S6K; 34475, Cell Signaling Technology, dilution: 1:150).

Animal ethics

Sixty male SCID mice of the CB-17 series, weighing 22±3 g and aged 6–8 weeks, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd (Beijing, China). SCID mice were raised in the specific pathogen-free (SPF) barrier of the Laboratory Animal Center of Shanghai University of Traditional Chinese Medicine, with 5 mice in a cage (18–22 ℃, humidity of 40–70%). Mice were provided with normal diet with freely available food. After one week of adaptive feeding, a series of experiments was conducted. All animal experiments were performed under a project license granted by the Experimental Animal Ethics Committee of Shaanxi University of Chinese Medicine, in compliance with national guidelines for the care and use of animals.

MTT assay

RPMI-1640 media (11875093, Thermo Fisher Scientific) with 10% fetal bovine serum (FBS, A5670701, Gibco, Grand Island, NY, USA) and 100 U/mL penicillin and streptomycin (15140122, Gibco) were regularly used to culture NCI-H1975 cells at 37 ℃ in an incubator with 5% CO2 saturated humidity. Then, cells were digested and passed by 0.25% trypsin digestion (25200056, Gibco). The NCI-H1975 cells of logarithmic growth stage were centrifuged at 1,000 rpm for 5 min. The supernatant was discarded, and the single cell suspension was obtained by blowing evenly with the culture solution. The cells were counted with a hemocyte counter plate (C200FL, RWD Life Science, Shenzhen, China), then diluted to 5×104 cells/mL and seeded (100 µL) into each well of a 96-well plate, followed by 24-h culture in an incubator (D165H, RWD Life Science). The cells were divided into two groups: the bufalin group [treatment with bufalin (2.5, 5, 10, 20, 40 ng/mL)] and the gefitinib group [treatment with gefitinib (1, 3, 5, 10, 20 µM)]. Each concentration was provided with 5 multiple holes. After incubation for 48 h, 20 µL MTT (C0009S, Beyotime, Shanghai, China) (5 mg/mL) was added to the well, and the plate was returned to the incubator for an additional 4 h. Thereafter, the supernatant was discarded, and 150 µL of dimethyl sulfoxide (HY-Y0320, MedChemExpress) was added to each well to dissolve the formazan crystals. The absorbance was then measured at 490 nm on the multi-functional enzyme-labeled instrument (Varioskan LUX, Thermo Fisher Scientific) after 10 min of light avoidance oscillation. Every MTT experiment was conducted at least three times.

Flow cytometry

NCI-H1975 cells at logarithmic growth stage were collected and counted after digestion to ensure that the number of target cells and the final detection concentration were greater than 1×106/mL. Then the cells were inoculated into 6-well plates for 24 h, and RPMI-1640 without FBS was added for 12-h culture to synchronize the cells. Afterwards, cells were treated with bufalin (3 ng/mL) and/or gefitinib (1 µM) (MTT screened dose) for 48 h, and a control group was set up. The culture media were disposed of, and cells were digested using pancreatic enzyme without ethylene diamine tetraacetic acid (EDTA; HY-Y0682, MedChemExpress), centrifuged at 1,000 rpm for 5 min, washed with pre-cooled PBS 2 times, and detected by Annexin V-FITC/PI Apoptosis Kit (E-CK-A211, Elabscience, Wuhan, China) and Cell Cycle Assay Kit (E-CK-A351, Elabscience) according to the instructions. Apoptosis and cell cycle were determined using flow cytometry (CytoFLEX, Beckman Coulter, Brea, CA, USA). Every sample had three wells set up, and the experiment was repeated at least three times.

Real-time polymerase chain reaction (RT-PCR) analysis

NCI-H1975 cells were digested, and RPMI-1640 medium with 100 U/mL penicillin-streptomycin and 10% FBS were prepared into single-cell suspension, which was evenly spread in 6-well plates with 3 multiple wells in each group. When the cell density reached about 80%, the cells were treated with bufalin (3.33 ng/mL) and/or gefitinib (1 µM), and three parallel control wells were created at the same time. Cells were grown in an incubator at 37 ℃ and 5% CO2 saturated humidity. After 48 h, the culture medium was aspirated and cells were rinsed twice with PBS. The total RNA of the cells was extracted using 1 mL of Trizol reagent (15596026CN, Invitrogen, Carlsbad, CA, USA), and reversely transcribed into cDNA. Fluorescence quantitative PCR was performed employing RT kit (RR014A, Takara, Kusatsu, Japan). The reaction system of fluorescence quantitative PCR was as follows: template of 1 µL, upper and downstream primers of 1 µL, SYBR green of 10 µL, ddH2O of 7 µL, and the total reaction volume of 20 µL. Reaction conditions were listed below: predenaturation at 95 ℃ for 30 s; 40 thermal cycles (95 ℃ denaturation for 3 s, 60 ℃ extension for 30 s). The reaction procedure of dissolution curve generation was as follows: 95 ℃ for 15 s, 60 ℃ for 1 min, and 95 ℃ for 15 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 60004-1-IG, Proteintech, Rosemont, IL, USA) was used as the internal reference gene. The detection method was a real-time fluorescence quantitative PCR system (CFX Opus 96, Bio-Rad, Hercules, CA, USA). Table 1 contains a list of the primers.

Table 1

Primer sequences utilized in the RT-PCR experiment

Target gene Forward primer (5'-3') Reverse primer (5'-3')
GAPDH ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAACAATA
EGFR AGGCACGAGTAACAAGCTCAC ATGAGGACATAACCAGCCACC
PI3K CTGGCAACCCAGAACTGATAG TGTAGCCACCCTTTTCGTCAT
Akt AACCCTTTCTGGAGCATGTCT CGTCCCCTGTTAATGTCTTCTC
mTOR ATGCTTGGAACCGGACCTG TCTTGACTCATCTCTCGGAGTT
p70S6K CGGGACGGCTTTTACCCAG TTTCTCACAATGTTCCATGCCA
4EBP CTATGACCGGAAATTCCTGATGG CCCGCTTATCTTCTGGGCTA

RT-PCR, real-time polymerase chain reaction.

Animal experimental design

A protocol was prepared before the study without registration. NCI-H1975 cells were cultured in vitro for 2 weeks in advance, and when the growth density exceeded 90%, the monolayer cultured cells were digested, centrifuged, and diluted into a single-cell suspension of about 2×106/mL with normal saline. The cells were then gently mixed, transferred into a centrifuge tube, and quickly inserted into an ice box and taken to the animal room as soon as possible. One day in advance, the skin of each mouse was disinfected. The cells were shaken well and 150 µL of cell suspension was injected into each mouse rapidly to establish a human NSCLC H1975 SCID mouse subcutaneous graft tumor model. When the tumor mass diameter was about 3 mm, 4 groups of 60 SCID mice were randomly established, control group [0.4 mL normal saline (ST341, Beyotime) by intragastric administration and 0.2 mL normal saline by intraperitoneal injection], gefitinib group (0.012 mL/g gefitinib by intragastric administration and 0.2 mL normal saline by intraperitoneal injection), bufalin group (0.4 mL of normal saline injected intragastrically and 0.008 mL/g of bufalin injected intraperitoneally), and gefitinib combined with bufalin administration group (0.012 mL/g of gefitinib by gavage and 0.008 mL/g of bufalin by intraperitoneal injection) (23,26). The treatment was administered once daily for 21 days.

Calculation of Body weight, tumor volume and weight

The mouse body weights were assessed every three days during the administration period, and vernier calipers were used to measure the tumors’ longest (a) and shortest (b) diameters three times per week to calculate the volume of the transplanted tumors, V (mm3) = 0.5 × a (mm) × b2 (mm2) (27). On the 22nd day, the mice were killed after anesthesia, and the tumor tissues were harvested, blotted to remove surface blood and fluid, and later weighed. Subsequently, some tissues were fixed with 4% formaldehyde (A501912-0500, Sangon Biotech, Shanghai, China), and the remaining parts were frozen at −80 °C for later use.

Immunohistochemistry

Fixed tissues were trimmed to the desired size according to the experimental requirements. The sections were sequentially placed in the following solutions for incubation, 75% ethanol (1094611000, Supelco, USA) for 1 h, 85% ethanol for 50 min, 95% ethanol for 30 min, 100% ethanol (I) for 30 min, 100% ethanol (II) for 30 min, 1/2 xylene (A530011-0500, Sangon Biotech) (xylene/anhydrous ethanol=1/1) for 10 min, xylene (I) for 20 min, and xylene (II) for 10 min. The sections were then transferred into fully dissolved paraffin and placed at 60 ℃ for 120–150 min. The paraffin-embedded sections were sliced into blocks, and cut into 3 consecutive slices with a thickness of 4 µm. The slices were routinely dewaxed to water and washed 3 times with PBS for 3 min each time. Next, the slices were reacted with 0.01 M citric acid buffer (1094611000, Supelco) of pH 6.0 (microwave at 3 levels for 20 min) to achieve heat-induced repair, cooled naturally at room temperature, and rinsed by PBS three times for 3 min each. Endogenous peroxidase was inhibited by 0.3% H2O2 for 20 min at room temperature. After washing 3 times with PBS for 3 min each time, the slices were incubated with 20% normal sheep serum (C0265, Beyotime) at room temperature for 30 min without washing, cultured at 37 ℃ for 2 h with drops plus monoclonal antibody, and washed 3 times with PBS for 3 min each time. Treatment with EnVision reagent (K500711-2, Fansbio, China) at 37 ℃ for 30 min and washing with PBS 3 times for 3 min each time were then performed. After being stained with diaminobenzidine (DAB; P0203, Beyotime) for 8–12 min and then with hematoxylin (C0105S, Beyotime), the slices were dried and finally sealed with neutral resin. Under the microscope (THUNDER Imager Tissue, Leica, Wetzlar, Germany), the background was purple-blue, and the positive product was brownish yellow or yellow.

Statistical analysis

Data were presented as mean ± standard deviation (SD) from at least three independent experiments. With Graphpad 8.0 software, statistical analysis was carried out. The parameters of the half-maximal inhibitory concentration (IC50) were estimated using nonlinear regression (four-parameter logistic regression). For multi-group comparison, one-way analysis of variance (ANOVA) and Tukey’s post-hoc test were employed. Statistics were deemed significant if P<0.05.


Results

Bufalin reduces the survival rate of H1975 cells

The growth of H1975 cells was inhibited concentration-dependently by bufalin and gefitinib, resulting in progressive reduction of cell viability. The IC50 of gefitinib was 1.16±0.25 µM and that of bufalin was 3.37±0.39 ng/mL (Figure 2A,2B). Therefore, both gefitinib and bufalin showed a dose-dependent inhibiting effect on H1975 cell survival, and the effect of gefitinib was stronger than that of bufalin. The H1975 cell growth of drug groups was observed under a 200-fold microscope. The volume and density of treated cells were lower than those of the normal cells, and there were varying degrees of shedding and fragmentation as well as cellular deformation and crumpling in treated cells. The morphological changes of the cells in the combined treatment group were more obvious (Figure 2C). The cell survival assay results demonstrated that both bufalin and gefitinib could significantly lower the survival rate of H1975 cells, but the survival rate declined more obviously after the combined administration (P<0.05, Figure 2D), which was approximately reduced by 2- and 1.6-fold compared to the gefitinib and bufalin treatment alone, respectively. These findings indicated that both gefitinib and bufalin could prevent the proliferation of H1975 cells to varying degrees, but their combined use had a more significant effect.

Figure 2 Bufalin reduces resistance to gefitinib in vitro. (A,B) MTT was used to detect the survival rate of cells treated with different concentrations of drugs for 48 h. (C) Cell morphology (200×). (D) MTT was performed to measure the survival rate of cells after bufalin, gefitinib and combination treatments. (E) Representative flow cytometry plots and (F) quantification of apoptosis. (G) The cell cycle was measured by flow cytometry. (H-M) Expressions of genes related to EGFR-PI3K/Akt-mTOR signaling pathway were measured by RT-PCR. *P<0.05, **P<0.01, ***P<0.001 vs. control; ++P<0.01, +++P<0.001 vs. gefitinib; ^P<0.05 vs. bufalin. CI, confidence interval; EGFR, epidermal growth factor receptor; IC50, half-maximal inhibitory concentration; RT-PCR, real-time polymerase chain reaction.

Flow cytometry was conducted to detect cell growth. According to the results of apoptosis experiment, both gefitinib and bufalin could induce apoptosis (Figure 2E,2F), while the apoptosis rate of combined administration group was approximately increased 1.8- and 1.4-fold compared to the gefitinib and bufalin groups, respectively. After 48 hours, gefitinib, bufalin, and their combination had varying effects on the cell growth cycle. In monotherapy groups, cell proportion in the G0/G1 phase was dramatically decreased while that in the S phase was significantly increased (P<0.01, Figure 2G). The percentage of cells in the G0/G1 phase was lower in the combination treatment group (P<0.001, Figure 2G), whereas that in the S phase was elevated (P<0.05, Figure 2G) compared to monotherapy group. These findings demonstrated that bufalin and gefitinib can both, to differing degrees, suppress the development of H1975 cells, with the combined use exerting stronger signal effects.

Bufalin inhibits the expressions of EGFR-PI3K/Akt-mTOR signal-related genes

Following pharmacological intervention, RT-PCR was used to identify the expressions of EGFR, PI3K, Akt, mTOR, p70S6K, and 4E-BP in the EGFR-PI3K/Akt-mTOR signaling pathway in H1975 cells of each group (Figure 2H-2M). The findings demonstrated a declining tendency in these expression levels after gefitinib or bufalin treatment (P<0.05, Figure 2H,2J-2L). p70S6K and mTOR expressions presented more evident down-regulation in the combination therapy group compared to the gefitinib treatment group; it was approximately reduced by 2.5-fold and 2.7-fold, respectively (P<0.01, Figure 2K,2L). These findings suggest that both gefitinib and bufalin can inhibit EGFR-PI3K/Akt-mTOR signaling, and their combined use can more effectively inhibit the expression levels of mTOR and p70S6K genes in this signaling pathway.

Bufalin suppresses the growth of tumor cells in lung cancer

In order to prove that bufalin can reduce the resistance of lung cancer mice to gefitinib in vivo, we established a subcutaneous transplanted tumor model of human NSCLC H1975 SCID mice, and then administered gefitinib and/or bufalin.

The findings demonstrated that as time went on, the weight of the mice in every group was decreased. Overall, the bufalin group showed the slowest weight loss. At days 9–21, the mice in the gefitinib group had a substantial drop in body weight compared to those in the control group (P<0.01, Figure 3A). At days 3, 6, 9, 12, 18, and 21, the weight of the mice in the combination therapy group was higher than that in the gefitinib group (P<0.05, Figure 3A). Only on day 6, the mouse weight in the combination therapy group was greater than that in the bufalin group (P<0.001, Figure 3A).

Figure 3 Bufalin reduces gefitinib resistance in vivo. (A) Changes of body weight of mice in each group after administration (n=10). (B) Tumor volume in mice (n=10). (C) Representative images of tumors from each group (n=10). (D) Tumor weight in mice (n=10). (E-J) The expressions of genes related to EGFR-PI3K/Akt-mTOR signaling in mouse tumor tissues were examined by RT-PCR. *P<0.05, **P<0.01, ***P<0.001 vs. control; +P<0.05, ++P<0.01, +++P<0.001 vs. gefitinib; ^P<0.05, ^^P<0.01, ^^^P<0.001 vs. bufalin. EGFR, epidermal growth factor receptor; RT-PCR, real-time polymerase chain reaction.

The tumor volume and weight of mice were measured. Tumor volume of mice in the control group was gradually increased with time, but was significantly improved after drug treatment. At days 4, 7, 13, 19, and 21, the tumor volume of the mice in the bufalin or gefitinib group was substantially smaller than that of the control group (P<0.05, Figure 3B). Additionally, at days 19 and 21, the tumor volume in the combination treatment group was substantially smaller than that in the monotherapy group (P<0.001, Figure 3B). On day 21, the combination therapy group presented the smallest tumor volume compared to other groups (Figure 3C). Furthermore, gefitinib or bufalin treatment was able to considerably lower the tumor weight of mice, and the tumor weight of mice in the combination therapy group was much lower than that of mice receiving gefitinib treatment, it was approximately reduced by 0.7-fold (P<0.05, Figure 3D). These findings suggested that bufalin and gefitinib together may further improve treatment outcomes in lung cancer mice.

Bufalin dampens the EGFR-PI3K/Akt-mTOR signaling pathway

The expressions of EGFR, PI3K, Akt, mTOR, p70S6K and 4E-BP in tumor tissues of H1975 tumor-bearing SCID mice were detected by RT-PCR (Figure 3E-3J). The findings demonstrated that the administration of gefitinib or bufalin could dramatically lower the expression levels of EGFR, Akt, mTOR, and p70S6K in mouse tumor tissues, and the expression level of PI3K was significantly decreased by gefitinib treatment (P<0.01, Figure 3E-3I). The combined treatment considerably reduced the expressions of EGFR, mTOR and p70S6K when compared to the gefitinib group, which was approximately reduced by 0.7-, 0.85- and 0.84-fold compared to the gefitinib alone (P<0.05, Figure 3E,3H,3I). The expression levels of EGFR, PI3K, and Akt were considerably lower in the combination therapy group than in the bufalin group, it was approximately reduced by 0.8-fold (P<0.05, Figure 3E-3G). Immunostaining data showed that EGFR, PI3K, Akt, mTOR, and p70S6K proteins in tumor tissues of mice in the control group had high positive expression rates and deep staining, while these proteins in gefitinib or bufalin groups had low expression rates and light staining. All groups showed high expression of 4E-BP, and there was no difference in the expression of 4E-BP protein among all groups (Figure 4).

Figure 4 The expressions of EGFR-PI3K/Akt-mTOR signaling-related proteins are detected by immunohistochemistry (200×).

In summary, both gefitinib and bufalin could improve lung cancer by inhibiting EGFR-PI3K/Akt-mTOR signaling pathway in tumor tissue cells of lung cancer mice, with the combined use superior to monotherapy.


Discussion

NSCLC is a leading cause of cancer-related mortality globally, and EGFR-TKI is an effective treatment method for patients with advanced NSCLC (28,29). Unfortunately, the efficacy of these agents is limited by the development of acquired resistance and associated side effects, leading to a low cure rate of patients with advanced lung cancer, which makes the treatment and recovery of lung cancer patients more challenging (24). Therefore, there is an urgent need to identify novel therapeutic approaches that can overcome EGFR-TKI resistance. EGFR mutations are among the most common oncogenic mutations in NSCLC, and EGFR-TKIs gefitinib is the first-line treatment for NSCLC (30). More studies have found that the effective active components in traditional Chinese medicine may have anti-cancer effects (31-33). Bufalin, an effective active component in the Chansu, has broad and powerful anticancer properties and can be involved in regulating cell proliferation, apoptosis, cell cycle and immunity to improve cancer (18,34). Previous studies have shown that bufalin can improve the resistance of lung cancer to EGFR-TKIs sorafenib and osimertinib, but whether bufalin can improve the acquired resistance of gefitinib and the underlying mechanism remains unclear (23,24). Therefore, we conducted in vivo and in vitro studies to verify our speculation and hope to provide certain reference value for prospective studies on acquired drug resistance in NSCLC.

There are three main mechanisms of acquired resistance to EGFR-TKIs: the targeting mechanism of secondary EGFR mutations, the off-target mechanism of activation of bypass signaling pathways, and histological transformation (35,36). Secondary EGFR mutations that impact the inhibitor’s ability to bind to the receptor are the source of on-target resistance (37). The T790M gatekeeping mutation at the ATP-binding region of EGFR is the most prevalent route of acquired resistance to first-generation EGFR-TKIs, and it affects roughly 50–60% of patients who relapse following an initial response to gefitinib or erlotinib (38). Studies have shown that T790M mutation leads to EGFR-TKIs resistance by increasing the affinity between EGFR and ATP, reducing the binding of EGFR to EGFR-TKIs, and causing continuous activation of downstream signaling pathways such as PI3K/Akt/mTOR(39,40). In certain cases, events that can circumvent EGFR signaling lead to off-target resistance. For example, the amplification of c-Met proto-oncogene causes the activation of PI3K/Akt signaling pathway, which enables tumor cells to bypass the inhibited EGFR signaling pathway and to proliferate and survive, resulting in EGFR-TKIs resistance (38,41).

Herein, we investigated if bufalin could resensitize H1975 lung cancer cells to gefitinib. Both in vitro and in vivo experiment results demonstrated that bufalin and gefitinib individually inhibited H1975 cell growth, and their combination generated stronger anti-tumor effects. In cell-based assays, the combination treatment notably induced apoptosis and arrested the cell cycle in the S phase. Similarly, in a mouse xenograft model, tumors treated with both agents showed greater reductions in volume and weight compared to those receiving monotherapy. In order to explore the anti-lung cancer mechanism of bufalin combined with gefitinib, we conducted RT-PCR and immunohistochemistry to quantify the expressions of EGFR and Met-related signaling pathway genes and proteins in mouse tumor tissues and H1975 cells. The outcomes demonstrated that the combination medication considerably reduced the protein expressions of EGFR, PI3K, Akt, mTOR, and p70S6K when compared to the monotherapy, but their regulatory effects on 4E-BP protein was insignificant, as p70S6K and 4E-BP are markers of the mTOR pathway (42,43). Therefore, we speculated that bufalin might enhance the anti-tumor effect of gefitinib by blocking the EGFR-PI3K/Akt-mTOR signaling pathway. Our detailed analysis of drug interaction revealed that the effects of bufalin and gefitinib were not strictly additive or synergistic in all the experiments. For instance, the induction of late apoptosis by the combination treatment was sub-additive, possibly due to overlapping target cell populations of both drugs or cell cycle-mediated reductions in apoptotic susceptibility induced by the other agent. Of note, across all experiments, the combined therapy consistently demonstrated superior anti-tumor effects relative to the single-drug treatment, highlighting the potential of bufalin to effectively enhance the therapeutic efficacy of gefitinib against L858R/T790M-mutant NSCLC.

Our findings that bufalin overcame gefitinib resistance in H1975 cells were consistent with the existing evidence that bufalin targets signaling pathways critical to cancer cell survival. Besides, our work significantly extended the findings of previous research such as that by Kang et al. (25), who pointed out that bufalin counteracts extrinsic resistance driven by HGF-activated Met signaling. By contrast, our study provided the first evidence that bufalin was also effective against intrinsic resistance mediated by the EGFR L858R/T790M mutation, a cornerstone mechanism in clinical EGFR-TKI resistance. Mechanistically, while both studies observed inhibition of the PI3K/Akt pathway, our analysis delved deeper into the downstream cascade. We demonstrated that bufalin-mediated suppression led to significant downregulation of mTOR and its key effector molecules, p70S6K and 4E-BP. This suppression likely contributed to the observed cell cycle arrest and apoptosis, offering a more comprehensive view of how bufalin hinders this oncogenic pathway. Finally, a key distinction of our study is the in vivo validation of these effects in a xenograft model, strengthening the translational potential of bufalin for treating L858R/T790M-positive NSCLC.


Conclusions

In conclusion, this study reveals that combination therapy of bufalin and gefitinib significantly inhibits the proliferation and induces apoptosis in H1975 cells. In addition, the combination therapy also effectively suppresses tumor growth in NSCLC mice. On the other hand, bufalin may increase the anti-tumor activity of gefitinib and the lung cancer cells sensitivity to drugs through the control of the EGFR-PI3K/Akt-mTOR signaling pathway. Our findings that bufalin reverses resistance in the H1975 (L858R/T790M) model suggest a potential therapeutic strategy for a subset of patients with acquired resistance to first-generation EGFR-TKIs. However, there are some questions to be addressed, such as how to reduce bufalin’s side effects (cardiotoxicity), whether bufalin can mitigate resistance to other EGFR-TKIs, and whether bufalin is involved in modulating other signaling pathways, including the Met signaling pathway, to improve EGFR-TKIs resistance induced by c-Met amplification.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1217/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1217/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1217/prf

Funding: This work was supported by the Special Research Program Project of Shaanxi Provincial Department of Education (No. 20JK0600) and the Discipline Construction Project of Shaanxi University of Chinese Medicine (No. 2020XK05).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1217/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.All animal experiments were performed under a project license granted by the Experimental Animal Ethics Committee of Shaanxi University of Chinese Medicine, in compliance with national guidelines for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Siegel RL, Kratzer TB, Giaquinto AN, et al. Cancer statistics, 2025. CA Cancer J Clin 2025;75:10-45. [Crossref] [PubMed]
  2. Ciardiello F, Hirsch FR, Pirker R, et al. The role of anti-EGFR therapies in EGFR-TKI-resistant advanced non-small cell lung cancer. Cancer Treat Rev 2024;122:102664. [Crossref] [PubMed]
  3. Kolesar J, Peh S, Thomas L, et al. Integration of liquid biopsy and pharmacogenomics for precision therapy of EGFR mutant and resistant lung cancers. Mol Cancer 2022;21:61. [Crossref] [PubMed]
  4. Sabbah DA, Hajjo R, Sweidan K. Review on Epidermal Growth Factor Receptor (EGFR) Structure, Signaling Pathways, Interactions, and Recent Updates of EGFR Inhibitors. Curr Top Med Chem 2020;20:815-34. [Crossref] [PubMed]
  5. Hayashi H, Nadal E, Gray JE, et al. Overall Treatment Strategy for Patients With Metastatic NSCLC With Activating EGFR Mutations. Clin Lung Cancer 2022;23:e69-82. [Crossref] [PubMed]
  6. Laudadio E, Mangano L, Minnelli C. Chemical Scaffolds for the Clinical Development of Mutant-Selective and Reversible Fourth-Generation EGFR-TKIs in NSCLC. ACS Chem Biol 2024;19:839-54. [Crossref] [PubMed]
  7. Li YS, Jie GL, Wu YL. Novel systemic therapies in the management of tyrosine kinase inhibitor-pretreated patients with epidermal growth factor receptor-mutant non-small-cell lung cancer. Ther Adv Med Oncol 2023;15:17588359231193726. [Crossref] [PubMed]
  8. Nagasaka M, Zhu VW, Lim SM, et al. Beyond Osimertinib: The Development of Third-Generation EGFR Tyrosine Kinase Inhibitors For Advanced EGFR+ NSCLC. J Thorac Oncol 2021;16:740-63. [Crossref] [PubMed]
  9. Hirsh V. Next-Generation Covalent Irreversible Kinase Inhibitors in NSCLC: Focus on Afatinib. BioDrugs 2015;29:167-83. [Crossref] [PubMed]
  10. Marin-Acevedo JA, Pellini B, Kimbrough EO, et al. Treatment Strategies for Non-Small Cell Lung Cancer with Common EGFR Mutations: A Review of the History of EGFR TKIs Approval and Emerging Data. Cancers (Basel) 2023;15:629. [Crossref] [PubMed]
  11. Nishihara S, Yamaoka T, Ishikawa F, et al. Mechanisms of EGFR-TKI-Induced Apoptosis and Strategies Targeting Apoptosis in EGFR-Mutated Non-Small Cell Lung Cancer. Genes (Basel) 2022;13:2183. [Crossref] [PubMed]
  12. Yang L, Zhou F, Zhuang Y, et al. Acetyl-bufalin shows potent efficacy against non-small-cell lung cancer by targeting the CDK9/STAT3 signalling pathway. Br J Cancer 2021;124:645-57. [Crossref] [PubMed]
  13. Zhang W, Fan Y, Zhang J, et al. Cell membrane-camouflaged bufalin targets NOD2 and overcomes multidrug resistance in pancreatic cancer. Drug Resist Updat 2023;71:101005. [Crossref] [PubMed]
  14. Wang Z, Liu F, Huang C, et al. Bufalin inhibits epithelial-mesenchymal transition and increases radiosensitivity of non-small cell lung cancer via inhibition of the Src signaling. J Thorac Dis 2023;15:123-34. [Crossref] [PubMed]
  15. Zhu Z, Sun H, Ma G, et al. Bufalin induces lung cancer cell apoptosis via the inhibition of PI3K/Akt pathway. Int J Mol Sci 2012;13:2025-35. [Crossref] [PubMed]
  16. Zhang H, Yang J, Song Q, et al. UBA3 promotes the occurrence and metastasis of intrahepatic cholangiocarcinoma through MAPK signaling pathway. Acta Biochim Biophys Sin (Shanghai) 2024;56:199-209. [Crossref] [PubMed]
  17. Zhang D, Jia T, Chen X, et al. Bufalin reverses ABCB1-mediated resistance to docetaxel in breast cancer. Heliyon 2023;9:e13840. [Crossref] [PubMed]
  18. Mhaidly N, Barake N, Trelcat A, et al. Bufalin Suppresses Head and Neck Cancer Development by Modulating Immune Responses and Targeting the β-Catenin Signaling Pathway. Cancers (Basel) 2024;16:2739. [Crossref] [PubMed]
  19. Soumoy L, Genbauffe A, Mouchart L, et al. ATP1A1 is a promising new target for melanoma treatment and can be inhibited by its physiological ligand bufalin to restore targeted therapy efficacy. Cancer Cell Int 2024;24:8. [Crossref] [PubMed]
  20. Soumoy L, Ghanem GE, Saussez S, et al. Bufalin for an innovative therapeutic approach against cancer. Pharmacol Res 2022;184:106442. [Crossref] [PubMed]
  21. Jin J, Yao Z, Qin H, et al. Bufalin inhibits the malignant development of non-small cell lung cancer by mediating the circ_0046264/miR-522-3p axis. Biotechnol Lett 2021;43:1229-40. [Crossref] [PubMed]
  22. Kim NY, Suh YA, Kim S, et al. Bufalin down-regulates Axl expression to inhibit cell proliferation and induce apoptosis in non-small-cell lung cancer cells. Biosci Rep 2020;40:BSR20193959. [Crossref] [PubMed]
  23. Cao F, Gong YB, Kang XH, et al. Degradation of MCL-1 by bufalin reverses acquired resistance to osimertinib in EGFR-mutant lung cancer. Toxicol Appl Pharmacol 2019;379:114662. [Crossref] [PubMed]
  24. Kuo JY, Liao CL, Ma YS, et al. Combination Treatment of Sorafenib and Bufalin Induces Apoptosis in NCI-H292 Human Lung Cancer Cells In Vitro. In Vivo 2022;36:582-95. [Crossref] [PubMed]
  25. Kang XH, Xu ZY, Gong YB, et al. Bufalin Reverses HGF-Induced Resistance to EGFR-TKIs in EGFR Mutant Lung Cancer Cells via Blockage of Met/PI3k/Akt Pathway and Induction of Apoptosis. Evid Based Complement Alternat Med 2013;2013:243859. [Crossref] [PubMed]
  26. Huang AC, Yang MD, Hsiao YT, et al. Bufalin inhibits gefitinib resistant NCI-H460 human lung cancer cell migration and invasion in vitro. J Ethnopharmacol 2016;194:1043-50. [Crossref] [PubMed]
  27. Okada Y, Zama T, Itonaga T, et al. Association between PET-CT accumulation in the hypothalamic/pituitary regions and neuron-specific enolase/primary tumor in limited-stage small cell lung cancer: a case-controlled retrospective study. EJNMMI Rep 2024;8:4. [Crossref] [PubMed]
  28. Canale M, Andrikou K, Priano I, et al. The Role of TP53 Mutations in EGFR-Mutated Non-Small-Cell Lung Cancer: Clinical Significance and Implications for Therapy. Cancers (Basel) 2022;14:1143. [Crossref] [PubMed]
  29. Tian J, Shi Z, Zhao L, et al. Revolutionizing NSCLC Treatment: Immunotherapy Strategies for EGFR-TKIs Resistance. Clin Respir J 2024;18:e70037. [Crossref] [PubMed]
  30. Su PL, Chen CW, Wu YL, et al. First-line treatment with irreversible tyrosine kinase inhibitors associated with longer OS in EGFR mutation-positive non-small cell lung cancer. Thorac Cancer 2021;12:287-96. [Crossref] [PubMed]
  31. Gao C, Pan H, Ma F, et al. Centipeda minima active components and mechanisms in lung cancer. BMC Complement Med Ther 2023;23:89. [Crossref] [PubMed]
  32. Ning ZX, Yang XY, Kun Gao, et al. Research progress on the mechanisms of traditional Chinese medicine extracts-induced oxidative stress in the treatment of colorectal cancer. Guidelines and Standards in Chinese Medicine 2025;3:106-12. [Crossref]
  33. Li JX, Li RZ, Sun A, et al. Metabolomics and integrated network pharmacology analysis reveal Tricin as the active anti-cancer component of Weijing decoction by suppression of PRKCA and sphingolipid signaling. Pharmacol Res 2021;171:105574. [Crossref] [PubMed]
  34. Chen J, Wang H, Jia L, et al. Bufalin targets the SRC-3/MIF pathway in chemoresistant cells to regulate M2 macrophage polarization in colorectal cancer. Cancer Lett 2021;513:63-74. [Crossref] [PubMed]
  35. Fukuda S, Suda K, Hamada A, et al. Potential Utility of a 4th-Generation EGFR-TKI and Exploration of Resistance Mechanisms-An In Vitro Study. Biomedicines 2024;12:1412. [Crossref] [PubMed]
  36. Chmielecki J, Gray JE, Cheng Y, et al. Candidate mechanisms of acquired resistance to first-line osimertinib in EGFR-mutated advanced non-small cell lung cancer. Nat Commun 2023;14:1070. [Crossref] [PubMed]
  37. Zhang Y. Targeting Epidermal Growth Factor Receptor for Cancer Treatment: Abolishing Both Kinase-Dependent and Kinase-Independent Functions of the Receptor. Pharmacol Rev 2023;75:1218-32. [Crossref] [PubMed]
  38. Chhouri H, Alexandre D, Grumolato L. Mechanisms of Acquired Resistance and Tolerance to EGFR Targeted Therapy in Non-Small Cell Lung Cancer. Cancers (Basel) 2023;15:504. [Crossref] [PubMed]
  39. Delahaye C, Figarol S, Pradines A, et al. Early Steps of Resistance to Targeted Therapies in Non-Small-Cell Lung Cancer. Cancers (Basel) 2022;14:2613. [Crossref] [PubMed]
  40. Liu N, Zheng X, Yan J, et al. Reversing MET-Mediated Resistance in Oncogene-Driven NSCLC by MET-Activated Wnt Condensative Prodrug. Adv Sci (Weinh) 2024;11:e2400603. [Crossref] [PubMed]
  41. Koulouris A, Tsagkaris C, Corriero AC, et al. Resistance to TKIs in EGFR-Mutated Non-Small Cell Lung Cancer: From Mechanisms to New Therapeutic Strategies. Cancers (Basel) 2022;14:3337. [Crossref] [PubMed]
  42. Sergeeva XV, Sharlo KA, Tyganov SA, et al. Molecular Signaling Effects behind the Spontaneous Soleus Muscle Activity Induced by 7-Day Rat Hindlimb Suspension. Int J Mol Sci 2024;25:8316. [Crossref] [PubMed]
  43. Liu XL, Luo L, Mu RH, et al. Fluoxetine regulates mTOR signalling in a region-dependent manner in depression-like mice. Sci Rep 2015;5:16024. [Crossref] [PubMed]
Cite this article as: Bai Y, Gong Y, Cui R, Deng Q, Zhao X, Liu C, Dong L. Bufalin: a potential drug for regulating EGFR-TKIs resistance in lung cancer via the EGFR-PI3K/Akt-mTOR signaling. Transl Cancer Res 2025;14(12):8642-8654. doi: 10.21037/tcr-2025-1217

Download Citation