SNX24 serves as a potential prognostic biomarker and a therapeutic target in uterine corpus endometrial carcinoma according to bioinformatics and experimentations
Highlight box
Key findings
• Sorting nexin 24 (SNX24) expression is elevated in tumors and associates with worse outcome for patients with uterine corpus endometrial carcinoma (UCEC).
• SNX24 drives proliferation and invasion of UCEC cells.
What is known and what is new?
• SNX24 promotes maturation of α-granule to facilitate cargo delivery in megakaryocytes. In breast cancer cells, SNX24 is regulated by estrogen.
• The comprehensive bioinformatic analysis reveals a critical role of SNX24 in UCEC which is further validated in cells.
What is the implication, and what should change now?
• The expression of SNX24 is a potential biomarker for diagnosis of UCEC.
• Further studies using cellular and animal models are needed to explore the molecular mechanism of SNX24 in UCEC tumorigenesis
Introduction
Uterine corpus endometrial carcinoma (UCEC) remains a common gynecologic malignancy and a major cause of cancer-related morbidity in females worldwide (1). In 2022, there were 420,242 new cases and 97,704 deaths which were related to corpus uteri globally (2). Unfortunately, the morbidity and mortality of UCEC keep increasing because of the change in lifestyle (3). The cause of endometrial carcinoma (EC) remains ambiguous, which possibly on account of body mass index, diabetes, age at menarche, oral contraceptive use, and parity (4). Even though the majority of patients with early UCEC can be cured through hysterectomy/adjuvant radiotherapy, those with late UCEC exhibit a poorer prognosis (5). The 5-year survival rate during 2014–2018 is 86.4%, and there is a clear age gradient, reducing from 89.3% for age <55 years old to 80.5% for age >74 years old (6), which is a serious threat to women’s health worldwide. However, diagnostic algorithms for EC differ among countries, affected by local resources, protocols, as well as the availability of diagnostic methods (7). Consequently, the importance of accurate initial diagnosis is a key for the management of EC.
Researches on EC are mounting as a result of large sample databases, whereas, it is depressing that clinical screening trials for UCEC and current markers remain not yet ready for routine clinical diagnosis or prognostic evaluation (8). Current study aims to utilize different bioinformatics and various online databases for characterizing EC. Recently, more and more reports have demonstrated that the bioinformatics are reliable for the study of cancer (9). For instance, Fang et al. demonstrated that non-SMC condensin I complex subunit G (NCAPG) is a potential cancer biomarker for the diagnosis and prognosis of pan-cancer with multiple bioinformatics from the public database (10); Ma et al. proposed that cyclin-dependent kinase inhibitor 2 A (CDKN2A) functions in UCEC and serves as a prognostic biomarker and therapeutic target for UCEC (11).
Up to now, no research has reported a role of sorting nexin 24 (SNX24) in UCEC. Herein, we evaluated the expression of SNX24 in UCEC based on bioinformatics and attempted to investigate the potential molecular mechanisms by which SNX24 regulates the development of UCEC. In brief, data of UCEC in the Human Protein Atlas (HPA), The University of ALabama at Birmingham CANcer data analysis Portal (UALCAN), and Encyclopedia of RNA Interactomes (ENCORI) were used to screen novel biomarkers, which revealed that UCEC patients with elevated SNX24 had shorter overall survival (OS). Subsequently, we explored the potential protein expression of SNX24 in UCEC pathological sections by immunohistochemical (IHC) staining as well as the potential interaction molecules. Furthermore, SNX24 was studied in relation to clinical characteristics, for instance, age, clinical stage, and histological type/grade. At last, the functions of SNX24 in UCEC were further identified in vitro. This study focuses on SNX24 in the context of EC to demonstrate it as an effective and potential biomarker for filling in the knowledge gap in previous studies. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1345/rc).
Methods
Screening of prognostic factors
The unfavorable factors and favorable factors for UCEC were screened by HPA (https://www.proteinatlas.org/), UALCAN (https://ualcan.path.uab.edu/analysis.html), and ENCORI (https://rnasysu.com/encori/).
The prognostic factors with the corresponding up- or down- regulation of expression in UCEC were analyzed by ENCORI and UALCAN.
The heatmap of the 12 overlapped factors in UCEC was exhibited by UALCAN.
Proteomics analysis
HPA maps human proteins from cells and tissues via integrating diverse omics technologies. HPA was utilized to evaluate protein-based differences between UCEC and normal tissues. IHC staining, including pathological features as well as subcellular localization, of SNX24, and casein kinase 1 (CSNK1A1 and CSNK1E) in EC patients were downloaded from HPA. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.
Association of SNX24 expression with multiple clinicopathological features in UCEC
Pan-cancer analyses, as well as the correlation between SNX24 and clinicopathological features including histological subtype, clinical stage, menopausal status, and age, are exhibited by UALCAN database.
Interaction between SNX24 and CSNK1A1/CSNK1E
BioGrid, BioPlex and OpenCell were adopted to predict the molecules which could interact with SNX24.
Cell culture
Benign endometrial epithelial cells (hEEC, or EM, #354984) were obtained from BeNa Culture Collection (Xinyang, China). UCEC cell line AN3-CA (Cat no. HTB-111) was obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were grown in DMEM/F12 (Sigma-Aldrich, St. Louis, MO, USA), which was supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific, Carlsbad, CA, USA) and 100 g/mL Normocin (Invivogen, San Diego, CA, USA) in an incubator with 5% CO2 at 37 ℃.
Cell transfection
In brief, AN3-CA cells were transfected with SNX24-targeting shRNAs (2 µg, sc-91904-SH, Santa Cruz Biotechnology, Dallas, USA) or control shRNA (2 µg, sc-108060, Santa Cruz Biotechnology) by Lipofectamine 3000 (Thermo Fisher Scientific). At 72 h later, AN3-CA cells were collected for the conduction of the following experimentations.
Quantitative real-time polymerase chain reaction (qRT-PCR)
TRIzol (Thermo Fisher Scientific) was adopted for isolating RNA from EM as well as AN3-CA cells. RNA concentration was assessed by NanoDrop ND-2000 (Thermo Fisher Scientific). Reverse transcription was carried out by Reverse Transcription Kit (Takara, Shiga, Japan) to obtain complementary DNA (cDNA). Prime-Script RT-PCR kit (Takara) was used in the qRT-PCR experiments, which were carried out on a CFX‑96 RT‑qPCR System (Bio‑Rad, Hercules, USA). The mRNA expressions of SNX24, CSNK1A1, and CSNK1E were normalized to β-actin mRNA expression. The relative expression of genes was calculated with the 2−ΔΔCq method. The primer sequences were listed in Table 1.
Table 1
| Genes | Forward (5'-3') | Reverse (5'-3') |
|---|---|---|
| SNX24 | TCCAAATGTGGTTATTGAAGGAG | CTCCTTCAATAACCACATTTGGA |
| CSNK1A1 | ACTGCTTTGAGATCTCATTTCAG | CTGAAATGAGATCTCAAAGCAGT |
| CSNK1E | AAGGAATTCAACACAGCCAAGGA | TCCTTGGCTGTGTTGAATTCCTT |
| β-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
Western blot
We used radioimmunoprecipitation assay (RIPA) buffer which contained protease inhibitor cocktail (Roche, Switzerland) for isolating total proteins from EM and AN3-CA cells. Protein concentrations were quantified by bicinchoninic acid assay (BCA). Subsequently, protein samples were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), then transferred onto polyvinylidene fluoride (PVDF) membranes (EMD Millipore, Billerica, MA, USA). Following incubation with the primary antibodies against SNX24 (CSB-EP022369HU, 1:1,000, CUSBIO), CSNK1A1 (ab206652, 1:1,000, Abcam, Cambridge, UK), CSNK1E (#12448, 1:1,000, CST), β-actin (#ab197277, 1:1,000, Abcam), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; ab37168, 1:1,000, Abcam) at 4 ℃ overnight, the polyvinylidene difluoride (PVDF) membrane was washed by Buffered Saline with Tween (TBST) thrice, then incubated with secondary antibodies for 2 h at room temperature. Blots were visualized by SuperSignal Western Blot Enhancer (Thermo Fisher Scientific). Protein bands were analyzed by ImageQuant (GE Healthcare, Chicago, USA). GAPDH acted as an internal control for CSNK1A1 and CSNK1E, β-actin acted as an internal control for SNX24.
Cell proliferation assay
Cell proliferation of AN3-CA cells was assessed by Cell Counting Kit-8 (CCK-8) (Dojindo, Kumamoto, Japan). Briefly, the AN3-CA cells were seeded in each well of a 96‑well plate at a density of 1×105 cells per well. At 72 h later, each well was added with CCK-8 solution (10 µL), followed by further incubation for 4 h. At last, the absorbance at 450 nm was recorded was measured by iMark Microplate Reader (Bio‑Rad).
Transwell assay
Cell invasion of AN3-CA cells was performed in a Matrigel-coated transwell chamber (8 µm, Corning Costar, Lowell, CA, USA). The lower chamber was added with DMEM and 10% FBS, whereas, the upper chamber was seeded with 5×104 AN3-CA cells suspended in serum-free DMEM. Afterwards, AN3-CA cells were cultivated at 37 ℃ for 24 h. Subsequently, AN3-CA cells were fixed by paraformaldehyde and stained by crystal violet. Finally, invaded cells were observed and photographed by an upright microscope (Nikon, Tokyo, Japan).
Statistical analysis
Statistical analysis was conducted by GraphPad Prism (version 6.0, GraphPad Software, Inc., San Diego, CA, USA). Experiments were repeated thrice. Results were expressed as mean ± standard error of the mean. Unpaired Student’s t-tests were used to analyze the differences between two groups. P<0.05 was deemed as significant difference.
Results
Prognostic and dysregulated factors in UCEC
We firstly screened the overlapped prognostic factors by online databases. There were 204 prognostic factors for UCEC exhibited by HPA, and 3,600 prognostic factors for UCEC exhibited by UALCAN, remarkably, 77 prognostic factors were overlapped (Figure 1A), among which, 49 prognostic factors were further overlapped with ENCORI (Figure 1B).
Afterwards, the prognostic factors with the corresponding up- or down-regulation of expression in UCEC were analyzed by ENCORI (n=14) and UALCAN (n=15), noteworthily, 12 prognostic factors were overlapped (Figure 1C), among which, there were ten unfavorable factors with upregulated levels and two favorable factors with downregulated levels (Figure 1D).
The heatmap of the 12 overlapped factors in UCEC was exhibited by UALCAN (Figure 1E).
The detailed information of the 12 factors was listed in Table 2.
Table 2
| Gene symbol | Annotation | TCGA OS† |
|---|---|---|
| STX1A | Syntaxin 1A | 6.37e−7 |
| DLL3 | Delta like canonical Notch ligand 3 | 4.99e−5 |
| TTK | TTK protein kinase | 1.34e−4 |
| CDH18 | Cadherin 18 | 3.09e−4 |
| SST | Somatostatin | 3.47e−4 |
| HOXB9 | Homeobox B9 | 5.07e−4 |
| BARX1 | BARX homeobox 1 | 5.12e−4 |
| SNX24 | Sorting nexin 24 | 5.79e−4 |
| SHISA9 | Shisa family member 9 | 6.65e−4 |
| CLDN9 | Claudin 9 | 6.93e−4 |
| RILPL2 | Rab interacting lysosomal protein like 2 | 3.20e−4 |
| GREB1 | Growth regulating estrogen receptor binding 1 | 5.34e−4 |
†, unfavorable, n=10; favorable, n=2. OS, overall survival; TCGA, The Cancer Genome Atlas.
CDH18, SHISA9, SNX24, and STX1A may be potential prognostic markers for UCEC
Among the aforementioned 12 factors, eight factors have been reported in EC/UCEC, unfavorable factors including BarH-like homeobox 1 (BARX1), claudin9 (CLDN9), delta-like protein 3 (DLL3), homeobox B9 (HOXB9), somatostatin (SST), TTK protein kinase (TTK), as well as favorable factors including Rab interacting lysosomal protein like 2 (RILPL2), and growth regulating estrogen receptor binding 1 (GREB1). For instance, BARX1 promotes the progression of EC by extracellular regulated protein kinases/mitogen-activated protein kinase kinase(ERK/MEK) signaling pathway (12); upregulated expression of CLDN9 is a predictor of poor prognosis in for EC (13); aberrant DLL3 expression is a diagnostic and prognostic marker for EC (14); HOXB9 is upregulated in EC, providing novel insights into the diagnosis and prognosis of HOXB9 in EC (15); targeted chemotherapy with AN-238 (a cytotoxic SST analog) inhibits the growth of EC expressing SST receptors (16); TTK was significantly negatively correlated with OS of UCEC based on an observational study from The Cancer Genome Atlas (TCGA) Program and GEO (17); decrease of RILPL2 indicates poor prognosis in patients with EC, thus RILPL2 may serve as a therapeutic target in EC (18); EC patients with low GREB1 expression show poor OS (19).
Only the roles of CDH18, SHISA9, SNX24, and STX1A have not been reported in UCEC. Aiming to assess the prognostic potential of CDH18, SHISA9, SNX24, and STX1A in UCEC, we probed the influence of their RNA levels on survival curve of patients with UCEC by different approaches.
Firstly, HPA was utilized for plotting survivorships to evaluate the relationship between CDH18, SHISA9, SNX24, STX1A expression and the survival of UCEC patients. The outcomes demonstrated that UCEC patients with high expression of CDH18 (Figure 2A,2B), SHISA9 (Figure 2C,2D), SNX24 (Figure 2E,2F), and STX1A (Figure 2G,2H) exhibited poor OS.
Subsequently, in an analysis on survival of patients with UCEC by UALCAN, it was observed that patients with high expression of CDH18 (Figure 3A,3B), SHISA9 (Figure 3C,3D), SNX24 (Figure 3E,3F), and STX1A (Figure 3G,3H) in UCEC possessed poor OS.
Consistently, in a further survival analysis of UCEC patients by ENCORI, it was found that patients with high expression of CDH18 (Figure 4A,4B), SHISA9 (Figure 4C,4D), SNX24 (Figure 4E,4F), and STX1A (Figure 4G,4H) in UCEC possessed poor OS.
In summary, high CDH18, SHISA9, SNX24, and STX1A expression is considered as a predictor of adverse outcome in UCEC patients.
Protein expression of CDH18, SHISA9, SNX24, and STX1A in UCEC
For the sake of determining CDH18, SHISA9, SNX24, and STX1A expression in UCEC, we investigated their translation levels by HPA. Current study analyzed the expression profile of CDH18 protein among 20 tumors, and found high CDH18 expression in six tumor tissues including carcinoid, melanoma, renal cancer, ovarian cancer, breast cancer, and cervical cancer but not EC or UCEC cell lines (Figure 5A,5B). As for SHISA9 protein expression, it exhibited “Pending cancer tissue analysis” (not shown), and no expression in UCEC cell lines (Figure 5C). Regarding the protein expression of SNX24, it possessed high expression in four tumor types including testis cancer, stomach cancer, pancreatic cancer, and EC/UCEC cell lines (Figure 5D,5E). As for STX1A protein, it possessed high expression in seven tumor tissues, for instance, carcinoid, pancreatic cancer, colorectal cancer, EC, prostate cancer, cervical cancer, and ovarian cancer, but not UCEC cell lines (Figure 5F,5G). Consequently, SNX24 was selected as the research project.
Association of SNX24 expression with multiple clinicopathological features in UCEC
Pan-cancer analysis by UALCAN database demonstrated that SNX24 exerted great research significance in 24 cancer types, which was dysregulated in 16 cancer types, i.e., significantly decreased in six tumor types, including colon adenocarcinoma (COAD) (P<0.001), kidney renal clear cell carcinoma (KIRC) (P<0.001), lung adenocarcinoma (LUAD) (P<0.001), lung squamous cell carcinoma (LUSC) (P<0.001), prostate adenocarcinoma (PRAD) (P<0.01), rectum adenocarcinoma (READ) (P<0.001); and significantly increased in ten tumor types, including bladder urothelial carcinoma (BLCA) (P<0.05), breast invasive carcinoma (BRCA) (P<0.001), cervical squamous cell carcinoma (CESC) (P<0.01), cholangiocarcinoma (CHOL) (P<0.001), glioblastoma multiforme (GBM) (P<0.05), kidney chromophobe (KICH) (P<0.001), liver hepatocellular carcinoma (LIHC) (P<0.001), thyroid carcinoma (THCA) (P<0.001), stomach adenocarcinoma (STAD) (P<0.05), and UCEC (P<0.001) (Figure 6A). Moreover, the estrogen-regulation has been confirmed for SNX24 in breast cancer by Wright et al. in 2009 (20).
To deep investigate the correlation between SNX24 and clinicopathological factors in UCEC, SNX24 expression was compared in UCEC patients according to TCGA-UCEC data. As acknowledged, patients’ prognosis is affected by histological subtypes and clinical stages, thus restraining the development of treatment methods. Concerning the stage groups, UCEC patients at stage I–IV exhibited higher expression of SNX24 than normal people, and SNX24 tended to be upregulated with increasing tumor staging grade (Figure 6B). Concerning the histological group, we observed that endometrioid, serous, and mixed serous-endometrioid UCEC patients exhibited higher expression of SNX24 compared to normal people (Figure 6C).
Meanwhile, SNX24 level was related to menopausal status, which in all periods was higher than that in normal (Figure 6D).
On account of the predilection for perimenopausal and postmenopausal women, aging population might be responsible for the increasing incidence of UCEC. Consistently, SNX24 level was increased in UCEC patients at all age ranges (Figure 6E). In conclusion, SNX24 expression is strongly correlated with various clinicopathological features.
Interaction between SNX24 and CSNK1A1/CSNK1E
Subsequently, we probed the protein expression of SNX24 in UCEC by analyzing normal and UCEC tissues in TCGA, which demonstrated the increase of SNX24 protein level in UCEC (Figure 7A). Also, it was consistent with our expectation. Afterwards, BioGrid exerted that, there were three molecules which could interact with SNX24, including CSNK1D, CSNK1A1 and CSNK1E; BioPlex exhibited that, there were four molecules which could interact with SNX24, including SPATA46, SNX22, VCPIP1 and CSNK1E; OpenCell presented that, CSNK1A1 could interact with SNX24; moreover, the consensus of the aforementioned online databases indicated that there were 2 molecules which could interact with SNX24, i.e., CSNK1A1 and CSNK1E (Figure 7B). Moreover, CSNK1A1 and CSNK1E expressions were probed from normal and UCEC tissues in TCGA, which indicated increased protein expressions of CSNK1A1 (Figure 7C) and CSNK1E (Figure 7D) in UCEC tissues.
As a ubiquitous cytosolic serine/threonine kinase, CK1α regulated Wnt/β-catenin and p53 signaling (21). Aberrant expression of CSNK1A1 was detected in gastric cancer (22). SJ3149 (a selective and potent degrader of CK1α) decreased the viabilities of numerous cell lines which were originated from solid tumors, for instance, female reproductive system EC cell line AN3-CA (23).
CSNK1E was increased in clear cell renal cell carcinoma tissues (24) and thyroid cancer (25), and was identified as a therapeutic target in the aforementioned cancers.
SNX24 promoted the proliferation and invasion of UCEC cells by upregulating CSNK1A1 and CSNK1E
As exerted by HPA, AN3-CA cell line with the highest protein level of SNX24 was selected. In addition, we discovered that the mRNA (1.00±0.15 vs. 5.23±0.30, P<0.001) and protein (1.00±0.06 vs. 3.94±0.25, P<0.001) levels of SNX24 were upregulated in AN3-CA cells compared to EM cells (Figure 8A-8C).
To further elucidate the effects of SNX24 on UCEC cells, we conducted CCK-8 and transwell assays. Before which, the mRNA (1.00±0.13 vs. 0.35±0.04, P<0.01) and protein (1.00±0.08 vs. 0.20±0.03, P<0.001) levels of SNX24 were inhibited by sh-SNX24 in AN3-CA cells (Figure 8D-8F).
Impressively, inhibition of SNX24 significantly impeded the proliferation at 48 h (0.64±0.02 vs. 0.57±0.02, P<0.05) and 72 h (0.75±0.02 vs. 0.66±0.02, P<0.05) (Figure 9A) and invasion (703.30±13.38 vs. 407.70±16.18, P<0.001) of AN3-CA cells (Figure 9B,9C). Moreover, inhibition of SNX24 significantly decreased the mRNA (1.00±0.02 vs. 0.51±0.03, P<0.001; 1.00±0.07 vs. 0.56±0.05, P<0.01) and protein (1.00±0.10 vs. 0.33±0.05, P<0.01; 1.00±0.09 vs. 0.45±0.04, P<0.01) expression of CSNK1A1 and CSNK1E in AN3-CA cells (Figure 9D-9F).
Collectively, there is higher expression of SNX24 in UCEC tissues in comparison with normal tissues. Moreover, SNX24 promotes the proliferation and invasion of UCEC cells by upregulating CSNK1A1 and CSNK1E.
Discussion
A recent study has exhibited the prognostic value of TCGA groups, it also suggests a development in molecular-based risk stratification, for EC, TCGA molecular groups as well as clinicopathological characteristics are incorporated into a new risk stratification model by the European Society of Gynaecological Oncology (ESGO), the European Society for Radiotherapy and Oncology (ESTRO) and the European Society of Pathology (ESP) (26). Preoperative molecular classification is of great importance to guide clinical management by providing earlier and more reliable prognostic information. Consequently, the identification of new biomarkers for the diagnosis and prognosis of EC represents one of the greatest challenges.
In current study, 12 prognostic factors (ten unfavorable factors with upregulated expression and two favorable factors with downregulated expression) were screened by HPA, UALCAN, and ENCORI. Among which, only the role of CDH18, SHISA9, SNX24, and STX1A have not been reported in UCEC, moreover, their high expression in UCEC predicted worse OS, as revealed by HPA, UALCAN, and ENCORI. HPA database demonstrated that, only SNX24 protein was expressed in EC and UCEC cell lines but not CDH18, SHISA9, or STX1A. Consequently, SNX24 was selected as the research project.
The SNXs which are a subfamily of cytoplasmic and membrane-associated proteins, participate in endocytosis, endosomal sorting/signaling, characterized with PX domain which can bind to specific phosphoinositides, thus promoting protein targeting to various endosomal compartments (27). SNXs function during numerous processes, of which its dysfunction is associated with various of human disorders including neurodegenerative diseases, cardiovascular disease, pathological infection, and cancer (28). SNX24 is a little studied PX domain-containing vesicle trafficking protein of 199 amino acids. Despite genome-wide association studies linking SNX24 variants with platelet-crit and volume (29), as one subgroup of the SNXs, SNX24 exerts poor characterization. Through searching literature, it was found that, the estrogen-regulation has been confirmed for SNX24 in breast cancer (20), polymorphisms in SNX24 are genetic markers for the diagnosis and prognosis of coronary artery aneurysm formation in Kawasaki disease (30), SNX24 is indispensable for α-granule biogenesis and cargo delivery of megakaryocytes (31), in a recent systematic review about the genetic determinants of colonic diverticulosis in 2025, SNX24 was identified (32), however, SNX24 expression and its role in the potential diagnosis and prognosis on UCEC has not been investigated.
UALCAN database exerted that SNX24 exhibits profound investigational significance in 16 cancers, including UCEC, which exhibited significant upregulation. Moreover, SNX24 expression is related to various clinicopathological features according to UALCAN database, including tumor staging grade, age, histological groups as well as menopausal status. Subsequently, IHC staining from the TCGA database, suggested an upregulation of SNX24 protein in UCEC tissues.
Altogether, the aforementioned fundings demonstrated SNX24 as a potential prognostic biomarker and a therapeutic target in UCEC.
Afterwards, BioGrid, BioPlex and OpenCell, indicated that SNX24 interacted with CSNK1A1 and CSNK1E, which were upregulated in UCEC tissues, as exerted by IHC staining from the TCGA database. CSNK1A1 is involved in regulation of the viability of EC cell line AN3-CA (23). CSNK1E promotes proliferation and migration of hepatocellular carcinoma (33), besides, CSNK1E exerts a similar expression trend to epithelial-mesenchymal transformation-related genes in melanoma (34). Consequently, the effects of SNX24 on the cell proliferation and invasion of UCEC cell line were explored. It was found that, inhibition of SNX24 reduced the proliferation and invasion, as well as CSNK1A1/CSNK1E mRNA/protein expressions in AN3-CA cells.
However, one research limitation exhibits in the present study, lack of necessary experimental validation data to confirm the interaction between SNX24 and CSNK1A1, CSNK1E. The validation experimentations are being carried out in our ongoing study, which will be addressed in the near future.
Conclusions
In summary, SNX24 promoted the proliferation and invasion of UCEC cells by upregulating CSNK1A1 and CSNK1E. Diverse public databases were utilized to analyze and explore expression and roles of SNX24 in UCEC. We have proposed novel evidences that SNX24 might serve as a diagnostic/prognostic biomarker for poor survival of patients with UCEC. The results demonstrated the function of SNX24 from a novel angle and reinforce the study on SNX24.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1345/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1345/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1345/prf
Funding: None.
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1345/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Siegel RL, Kratzer TB, Giaquinto AN, et al. Cancer statistics, 2025. CA Cancer J Clin 2025;75:10-45. [Crossref] [PubMed]
- Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229-63. [Crossref] [PubMed]
- Baker-Rand H, Kitson SJ. Recent Advances in Endometrial Cancer Prevention, Early Diagnosis and Treatment. Cancers (Basel) 2024;16:1028. [Crossref] [PubMed]
- Peeri NC, Bertrand KA, Na R, et al. Understanding risk factors for endometrial cancer in young women. J Natl Cancer Inst 2025;117:76-88. [Crossref] [PubMed]
- Zheng S, Liu Y, Kinkopf PD, et al. Whole exome sequencing of low risk endometrial cancer patients with isolated local recurrences. Cancer Treat Res Commun 2025;43:100890. [Crossref] [PubMed]
- Zhao XJ, Bing X, Lei QQ, et al. Assessment of Five-Year Relative Survival of Patients With Endometrial Cancer: A Period Analysis. World J Oncol 2024;15:784-91. [Crossref] [PubMed]
- Luzarraga Aznar A, Canton R, Loren G, et al. Current challenges and emerging tools in endometrial cancer diagnosis. Int J Gynecol Cancer 2025;35:100056. [Crossref] [PubMed]
- Rižner TL, Romano A. The discovery of biomarkers for endometrial cancer: update over the last years. Expert Rev Mol Diagn 2025;25:425-52. [Crossref] [PubMed]
- Huang J, Mao L, Lei Q, et al. Bioinformatics tools and resources for cancer and application. Chin Med J (Engl) 2024;137:2052-64. [Crossref] [PubMed]
- Fang M, Wu Z, Xia Z, et al. Diagnostic, prognostic, and immunological roles of NCAPG in pan-cancer: A bioinformatics analysis. Medicine (Baltimore) 2025;104:e41761. [Crossref] [PubMed]
- Ma L, Li Y, Wu J, et al. Bioinformatics approaches to multi-omics analysis of the potential of CDKN2A as a biomarker and therapeutic target for uterine corpus endometrial carcinoma. Sci Rep 2025;15:895. [Crossref] [PubMed]
- Lu Y, Lu H, Yang X, et al. BarH-like homeobox 1 induces the progression of cell malignant phenotype in endometrial carcinoma through the regulation of ERK/MEK signaling pathway. Reprod Biol 2021;21:100502. [Crossref] [PubMed]
- Endo Y, Sugimoto K, Kobayashi M, et al. Claudin 9 is a novel prognostic biomarker for endometrial cancer. Int J Oncol 2022;61:135. [Crossref] [PubMed]
- Wang J, Zhang K, Liu Z, et al. Upregulated delta-like protein 3 expression is a diagnostic and prognostic marker in endometrial cancer: A retrospective study. Medicine (Baltimore) 2018;97:e13442. [Crossref] [PubMed]
- Xu Y, Zhang M, Shi Q, et al. Identification of HOXB9 to predict prognosis of endometrial cancer based on comprehensive bioinformatics analysis. Eur J Med Res 2023;28:79. [Crossref] [PubMed]
- Engel JB, Schally AV, Halmos G, et al. Targeted therapy with a cytotoxic somatostatin analog, AN-238, inhibits growth of human experimental endometrial carcinomas expressing multidrug resistance protein MDR-1. Cancer 2005;104:1312-21. [Crossref] [PubMed]
- Luo G, Bo C, Li J. Identification and validation of hub genes in uterine corpus endometrioid carcinoma: An observational study from TCGA and GEO. Medicine (Baltimore) 2025;104:e42338. [Crossref] [PubMed]
- Liu J, Xu M, Wu Z, et al. Low Expression of RILPL2 Predicts Poor Prognosis and Correlates With Immune Infiltration in Endometrial Carcinoma. Front Mol Biosci 2021;8:670893. [Crossref] [PubMed]
- Tong Z, Liu Y, Yu X, et al. The transcriptional co-activator NCOA6 promotes estrogen-induced GREB1 transcription by recruiting ERα and enhancing enhancer-promoter interactions. J Biol Chem 2019;294:19667-82. [Crossref] [PubMed]
- Wright PK, May FE, Darby S, et al. Estrogen regulates vesicle trafficking gene expression in EFF-3, EFM-19 and MCF-7 breast cancer cells. Int J Clin Exp Pathol 2009;2:463-75.
- Jiang S, Zhang M, Sun J, et al. Casein kinase 1α: biological mechanisms and theranostic potential. Cell Commun Signal 2018;16:23. [Crossref] [PubMed]
- Demirci U, Orenay-Boyacioglu S, Kasap E, et al. Overexpressions of RHOA, CSNK1A1, DVL2, FZD8, and LRP5 genes enhance gastric cancer development in the presence of Helicobacter pylori. Arab J Gastroenterol 2023;24:91-7. [Crossref] [PubMed]
- Nishiguchi G, Mascibroda LG, Young SM, et al. Selective CK1α degraders exert antiproliferative activity against a broad range of human cancer cell lines. Nat Commun 2024;15:482. [Crossref] [PubMed]
- Lin YC, Sun DP, Hsieh TH, et al. Targeting CK1δ and CK1ε as a New Therapeutic Approach for Clear Cell Renal Cell Carcinoma. Pharmacology 2024;109:330-40. [Crossref] [PubMed]
- Chi SY, Hsu YC, Tsai CH, et al. Identifying CSNK1E as a therapeutic target in thyroid cancer among the core circadian clock genes. Histochem Cell Biol 2025;163:30. [Crossref] [PubMed]
- Concin N, Matias-Guiu X, Cibula D, et al. ESGO-ESTRO-ESP guidelines for the management of patients with endometrial carcinoma: update 2025. Lancet Oncol 2025;26:e423-35. [Crossref] [PubMed]
- Haft CR, de la Luz Sierra M, Barr VA, et al. Identification of a family of sorting nexin molecules and characterization of their association with receptors. Mol Cell Biol 1998;18:7278-87. [Crossref] [PubMed]
- Hanley SE, Cooper KF. Sorting Nexins in Protein Homeostasis. Cells 2020;10:17. [Crossref] [PubMed]
- Vuckovic D, Bao EL, Akbari P, et al. The Polygenic and Monogenic Basis of Blood Traits and Diseases. Cell 2020;182:1214-1231.e11. [Crossref] [PubMed]
- Lin YJ, Chang JS, Liu X, et al. Sorting nexin 24 genetic variation associates with coronary artery aneurysm severity in Kawasaki disease patients. Cell Biosci 2013;3:44. [Crossref] [PubMed]
- Lacey J, Webster SJ, Heath PR, et al. Sorting nexin 24 is required for α-granule biogenesis and cargo delivery in megakaryocytes. Haematologica 2022;107:1902-13. [Crossref] [PubMed]
- Nehring P, Przybyłkowski A. Genetic Determinants of Colonic Diverticulosis-A Systematic Review. Genes (Basel) 2025;16:581. [Crossref] [PubMed]
- Zhou J, Wang YH, Li YL, et al. Casein kinase 1 family member CSNK1E can regulate proliferation and migration in hepatocellular carcinoma. J Cancer Res Clin Oncol 2025;151:269. [Crossref] [PubMed]
- Hong W, Wang X, Huang X, et al. CSNK1E is involved in TGF-β1 induced epithelial mesenchymal transformationas and related to melanoma immune heterogeneity. Front Pharmacol 2025;15:1501849. [Crossref] [PubMed]

