The influence of CXCL9 on M2 macrophages in lung cancer development
Original Article

The influence of CXCL9 on M2 macrophages in lung cancer development

Lin Mi1,2 ORCID logo, Liyun Xu3, Zhijun Chen1 ORCID logo, Yeye Zheng4 ORCID logo

1Department of Cardiothoracic Surgery, Zhoushan Hospital, Zhoushan, China; 2Department of Clinical Medicine, Jiamusi University, Jiamusi, China; 3Department of Cell Molecular Biology Laboratory, Zhoushan Hospital, Zhoushan, China; 4Department of Physical Examination Center, Zhoushan Hospital, Zhoushan, China

Contributions: (I) Conception and design: Y Zheng, L Mi; (II) Administrative support: Z Chen; (III) Provision of study materials or patients: L Xu; (IV) Collection and assembly of data: Y Zheng; (V) Data analysis and interpretation: L Mi; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Yeye Zheng, BMed. Department of Physical Examination Center, Zhoushan Hospital, 739 Dingshen Road, Lincheng Street, Dinghai District, Zhoushan 316000, China. Email: zhengyeye@163.com; Zhijun Chen, BMed. Department of Cardiothoracic Surgery, Zhoushan Hospital, 739 Dingshen Road, Lincheng Street, Dinghai District, Zhoushan 316000, China. Email: zschenzhijun@126.com.

Background: Lung cancer has the highest incidence among malignant tumors, and its high degree of metastasis and invasion, tendency to metastasis, and mortality rate are the key factors leading to treatment failure and poor prognosis. Tumor-associated macrophages (TAMs), which often exhibit an M2-polarized phenotype, are known to promote tumor progression. Notably, the chemokine CXCL9 has emerged as a critical regulator that can inhibit M2 macrophage polarization, thereby potentially suppressing tumor growth. This study combined clinical sample testing and prognostic analysis with cell behaviorology and molecular biology to systematically investigate the role and regulatory mechanism of CXCL9 in the tumor microenvironment of lung cancer.

Methods: THP-1 cells were induced to differentiate into M1 and M2 macrophages. The effects of M2 macrophages on the proliferation, migration, and invasion of A549 lung adenocarcinoma cells were detected via Cell Counting Kit-8 cell viability, scratch-wound, and Transwell invasion assays. The effects of CXCL9 on M2 macrophage function and the expression of related proteins were detected via enzyme-linked immunosorbent assay, reverse transcription polymerase chain reaction, and Western blotting.

Results: CXCL9 significantly inhibited the promoting effects of M2 macrophages on the proliferation, migration, metastasis and invasion of A549 cells. Specifically, CXCL9 inhibited M2 macrophage polarization by reducing the expression of surface markers CD16, CD32, and CD206. CXCL9 also inhibited the expression of VEGF-C, MMP9, and MMP2, thereby inhibiting tumor cell invasion and metastasis. Moreover, CXCL9 inhibited the activation of the ERK and AKT signaling pathways, further inhibiting tumor cell proliferation and invasion.

Conclusions: CXCL9 inhibits the proliferation, migration, metastasis and invasion of lung cancer cells by inhibiting M2 macrophage polarization and function, indicating that CXCL9 may serve as a potential therapeutic target for lung cancer.

Keywords: Lung cancer; metastasis and invasion; M2 macrophages; CXCL9


Submitted Oct 24, 2025. Accepted for publication Dec 15, 2025. Published online Dec 29, 2025.

doi: 10.21037/tcr-2025-aw-2336


Highlight box

Key findings

• CXCL9 dose-dependently inhibits the promoting effects of M2 macrophages on the proliferation, migration, and invasion of A549 lung adenocarcinoma cells.

• CXCL9 suppresses M2 macrophage polarization by significantly reducing the expression of surface markers CD206, CD16, and CD32.

• CXCL9 inhibits the production of key pro-tumorigenic factors VEGF-C, MMP2, and MMP9.

• CXCL9 attenuates the activation of both the ERK and AKT signaling pathways in the tumor microenvironment.

What is known and what is new?

• M2 macrophages facilitate tumor progression by enhancing immunosuppression, angiogenesis, and metastasis. CXCL9 is associated with antitumor immune responses but its direct mechanistic role in lung adenocarcinoma remains unclear.

• Our findings constitute the first evidence that CXCL9 directly inhibits M2 macrophage polarization and function in a dose-dependent manner, disrupting macrophage-tumor crosstalk via VEGF-C/MMP suppression and ERK/AKT pathway inhibition.

What is the implication, and what should change now?

• CXCL9 is a potent regulator of the tumor microenvironment and a promising therapeutic target for lung cancer. Future research should prioritize (I) the clinical validation of CXCL9-based therapies, particularly by using nanoparticle delivery to overcome its short half-life; (II) the integration of M2 macrophage biomarkers (e.g., CD206:VEGF-C ratio) into patient stratification strategies for CXCL9-responsive cohorts; and (III) the examination of CXCL9 in combination therapies to counteract resistance mechanisms in advanced lung cancer.


Introduction

Driven by factors including environmental pollution and an aging population, the global incidence of cancer continues to rise, imposing a significant burden on developing countries (1). Among all cancer types, lung cancer maintains the highest incidence and mortality rates, causing approximately 1.5 million deaths annually (1). Non-small cell lung cancer (NSCLC) constitutes the vast majority (about 89%) of these cases (2). A primary reason for its poor prognosis is that most patients are diagnosed at advanced stages, often with existing metastasis, leading to a dismally low 5-year survival rate of only around 5% for metastatic disease (3).

Although treatment modalities for NSCLC have evolved to include targeted therapies and immunotherapy, significant challenges persist. The development of drug resistance and dose-limiting toxicities often curtail the clinical benefits of these advanced treatments, underscoring the urgent need for novel therapeutic strategies that can effectively inhibit tumor progression and metastasis (4-7).

The recent research efforts in lung cancer have been focused on genetic screening and clarifying the mechanisms of target genes, with the aims of identifying clinical markers for early detection, determining the pathogenesis of lung cancer, and developing novel therapeutic targets for personalized treatment. The tumor microenvironment (TME) has emerged as a critical determinant of cancer behavior and therapeutic response, offering a promising frontier for intervention (8).

Our research group has been dedicated to addressing challenges in the clinical diagnosis and treatment of lung cancer. The limitations of current diagnostic approaches have been identified through use of various examination methods including imaging, bronchoscopy, sputum cytology, and lung puncture. With the advancements in tumor molecular biology achieved over the past decade, the focus has shifted to genes, messenger RNA (mRNA) transcripts, and protein expression as potential tumor markers. However, the identification of highly efficient and specific diagnostic targets remains elusive. Large-scale systematic sequencing has revealed that the number of somatic cell mutations in cancer tissues is significantly lower than that originally anticipated (9,10), suggesting that cancer is not solely a hereditary disease and that gene expression regulation is intricately linked to the development of malignant tumors (11).

Macrophages, particularly M2-type macrophages, play a pivotal role in tumor progression. These cells are characterized by their high glucose uptake capacity, which is associated with metabolic remodeling and contributes to tumor metastasis and resistance to chemotherapy (12). M2 macrophages facilitate tumor metastasis through multiple mechanisms, including the enhancement of tumor cell invasiveness, the promotion of epithelial-mesenchymal transition, and the establishment of an immunosuppressive microenvironment that favors tumor spread. For example, some studies have shown that exosomes secreted by primary tumor cells can induce macrophages to upregulate immunosuppressive molecules such as PD-L1 and secrete large amounts of lactic acid, thereby creating an immunosuppressive environment that promotes tumor metastasis (13,14). Given the critical role of M2 macrophages in tumor progression, researchers have been begun to explore therapeutic strategies targeting these cells. Given their pivotal pro-tumorigenic role, strategies to deplete, reprogram, or inhibit the function of M2-like tumor-associated macrophages (TAMs) have become an active area of investigation (15).

CXCL9 has emerged as a key player in cancer, particularly due to its influence on TAMs. More recently, evidence has suggested that CXCL9 may directly influence macrophage polarization. Studies in models of melanoma and breast cancer have linked CXCL9 expression to a shift away from the M2 phenotype towards a more antitumoral state, enhancing overall immune responses (16-18). This positions CXCL9 as a potential key regulator of the TME by modulating the function of one of its most abundant cellular components. However, there remain three key deficiencies in the research in this field: (I) the precise molecular mechanism by which CXCL9 regulates M2 macrophage polarization in lung adenocarcinoma remains undefined. (II) No quantitative evidence exists regarding concentration-dependent effects of CXCL9 on M2-mediated tumor promotion. (III) The interplay between CXCL9 and key signaling pathways (ERK/AKT) in this context has not been systematically investigated. Therefore, we conducted a study aimed at investigating the hypothesis that CXCL9 directly attenuates the pro-tumorigenic functions of M2 macrophages and thereby inhibits the malignant behavior of lung cancer cells. Our objective was to systematically investigate the dose-dependent effects of CXCL9 on M2 macrophage polarization and its subsequent impact on the proliferation, migration, and invasion of A549 lung adenocarcinoma cells, with a specific focus on elucidating the underlying mechanisms involving surface marker expression, pro-metastatic factor secretion, and ERK/AKT signaling pathway activity. This work provides the first experimental evidence defining the direct inhibitory role of CXCL9 on M2 polarization and function in lung cancer, revealing a novel mechanism of action that extends beyond immune cell recruitment. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2336/rc).


Methods

Materials

The human alveolar adenocarcinoma cell line A549 (SCSP-503) and monocytic THP-1 cells (SCSP-567) were acquired from the Shanghai Branch of the Chinese Academy of Sciences Stem Cell Repository. The cells were maintained in RPMI-1640 medium (Yuanpei Biotechnology, L210KJ) supplemented with 10% fetal bovine serum (FBS, Gemini, 9001-108), 1% Penicillin-Streptomycin (P/S, Invitrogen, 15140-122), and 1% L-Glutamine (Gln, BBI, E607004). CXCL9 protein was acquired from MedChemExpress (HY-P7253). Key immunological reagents included VEGF-C detection kits from Nanjing Jiancheng Bioengineering Institute (H046), reverse transcription system HiScript III RT SuperMix (+gDNA wiper) supplied by Vazyme Biotech (R323-01; Nanjing, China), and TRIzol isolation reagent obtained from Thermo Fisher Scientific (15596018CN; Waltham, MA, USA). Antibody reagents comprised rabbit-derived polyclonal antibodies targeting VEGF-C (bs-1586R), MMP2/9 (bs-0412R, bs-4593R), ERK/p-ERK (bs-1020R, bs2469R), AKT/p-AKT (bs-0115R and bs-0876R), and β-actin (bs-0061R) (Bioss Antibodies, Woburn, MA, USA), along with corresponding horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibodies. The key equipment utilized in this study included Ultra Micro Nucleic Acid Analyze (Thermo, Nanodrop One), PCR instrument (Thermo, 2720), Microplate reader (Thermo, MuLTiSKAN MK3) and Real time quantitative PCR instrument (Bole, CFX Connect 3700).

Cell culture

The A549 and THP-1 cell lines were cultured following standard protocols. Briefly, cryopreserved cells were thawed, centrifuged, and resuspended in their respective complete media (DMEM for A549, RPMI-1640 for THP-1) before being maintained at 37 ℃ with 5% CO₂. For co-culture, THP-1 monocytes were seeded into transwell inserts and sequentially induced with 40 nM PMA (24 hours) to generate M0 macrophages, followed by 20 ng/mL IL-4 (48 hours) to polarize them into the M2 phenotype. One day prior to co-culture, A549 cells were seeded in the lower chamber of a 24-well plate. The M2 macrophage-containing inserts were then transferred to the A549-seeded wells, and the system was treated with CXCL9.

M1 and M2 macrophage phenotype induction

For macrophage differentiation, THP-1 monocytes underwent 36-hour priming with 25 ng/mL phorbol ester (PMA; Sigma-Aldrich, St. Louis, MA, USA) in culture medium, succeeded by 24-hour serum-free adaptation. For establishing the inflammatory M1 phenotype, polarized cells received combined stimulation with 20 ng/mL of recombinant interferon-γ (IFN-γ; Sigma-Aldrich) and 100 ng/mL of bacterial lipopolysaccharide (LPS; R&D Systems, Minneapolis, MN, USA) for 24 hours. Alternatively, anti-inflammatory M2 polarization was achieved through 36-hour exposure to 20 ng/mL of interleukin-4 (IL-4; Sigma-Aldrich). Phenotypic validation was performed via flow cytometric analysis of surface differentiation markers.

Cell Counting Kit-8 (CCK-8) proliferation assay

Following the designated co-culture period, the transwell inserts containing M2 macrophages were removed from the 24-well plates. The culture medium in the lower chambers, containing the A549 cells, was carefully aspirated. Subsequently, each well was replenished with 500 µL of fresh DMEM medium containing 10% (v/v) CCK-8 reagent. The plates were then incubated at 37 ℃ under 5% CO₂ for 1 hour. After incubation, 100 µL of the solution from each well was transferred to a 96-well plate for spectrophotometric measurement. The absorbance of each sample was measured at a wavelength of 450 nm using a microplate reader. The absorbance value of a blank control (DMEM medium with 10% CCK-8 reagent without cells) was subtracted from the measurement value of each sample to obtain the final absorbance. The results were analyzed based on these final values.

Enzyme-linked immunosorbent assay

Following a 72-hour pharmacological intervention, cellular supernatants were harvested and subjected to 10-fold dilution. Protein quantification was performed with a bicinchoninic acid (BCA) assay system (Abcam, Cambridge, UK) according to the manufacturer’s specifications. Reference standards and experimental specimens were loaded into microplates and maintained at 37 ℃ for 45 minutes within a humidified chamber, which was followed by triple-rinsing with phosphate-buffered saline (PBS).

The detection protocol continued with application of HRP-conjugated secondary antibodies (Sigma-Aldrich), which was followed by 30-minute thermal incubation and quadruple washing cycles. Chromogenic development was initiated by sequential addition of tetramethylbenzidine (TMB) substrate components, with light-protected incubation at 37 ℃ for 15±5 minutes. Reaction termination was achieved through sulfuric acid addition (2 M), after which solution homogeneity was ensured by vortex mixing prior to spectrophotometric analysis at 450 nm with a microplate reader.

Flow cytometry

Following trypsinization, cells were collected by centrifugation at 600 ×g for 5 min at 4 ℃. The supernatant was discarded, and the cell pellet was washed once with 200 µL of staining buffer (PBS containing 2% FBS). The cells were then resuspended in 50 µL of a pre-mixed surface antibody cocktail (1 µL antibody per sample in PBS with 2% FBS) and incubated at 4 ℃ in the dark for 30 min. After incubation, 150 µL of staining buffer was added to quench the staining reaction, followed by centrifugation at 600 ×g for 5 min at 4 ℃. The cell pellet was washed again with 200 µL of staining buffer and centrifuged. Finally, cells were resuspended in 400 µL of staining buffer for flow cytometric analysis.

Reverse-transcription polymerase chain reaction

For transcriptional profiling of inflammatory mediators (TNF-α, ARG-1, and iNOS), cellular lysates were processed with TRIzol reagent (Thermo Fisher Scientific) in accordance with cold-phase extraction protocols. RNA integrity was verified spectrophotometrically (A260/A280 >1.8) prior to reverse transcription with HiScript III RT SuperMix (Vazyme Biotech) with genomic DNA elimination. The thermal cycling parameters on the CFX96 system (Bio-Rad Laboratories, Hercules, CA, USA) were as follows: initial denaturation at 95 ℃ for 5 minutes, followed by 40 amplification cycles (95 ℃ for 15 seconds of denaturation and 60 ℃ for 60 seconds of annealing extension) and concluding with melt curve analysis (95 ℃ for 15 seconds followed by 60 ℃ for 15 seconds).

Gene-specific primers (Table 1) were used in triplicate reactions with SYBR Green master mix (Takara Bio, Kusatsu, Japan), with β-actin serving as the endogenous control. Quantification cycles (Cq values) were determined through CFX Manage software v. 3.1 (Bio-Rad Laboratories), with relative expression levels calculated via the 2−ΔΔCt algorithm and triplicate technical replicates and duplicate biological replicates being implemented.

Table 1

Primers used in the study

å Prime sequences (5’-3’) Products bp
hTNF-F GAAAGCATGATCCGGGACG 147
hTNF-R GTGCAGCAGGCAGAAGAGC
iNOS-F CCCTGGCAATGGAGAGAAACT 284
iNOS-R GAATGTGCTGTTTGCCTCGG
ARG1-F GACCCTGGGGAACACTACAT 166
ARG1-R GGTCCAGTCCGTCAACATCA
β-actin-F CACTCTTCCAGCCTTCCTTC 186
β-actin-R GTACAGGTCTTTGCGGATGT

Western blotting

Cellular lysates were prepared under cryogenic conditions (4 ℃) with radioimmunoprecipitation (RIPA) lysis buffer supplemented with protease/phosphatase inhibitor cocktail (Roche, Basel, Switzerland), as previously established in the literature (19). Electrophoretic separation was carried out on 10% sodium dodecyl sulfate-polyacrylamide gels under constant voltage (80 V stacking 20 min, 150 V resolving 90 min), which was followed by semidry transfer to polyvinylidene fluoride membranes. Membranes were blocked with 5% nonfat dried milk in Tris-buffered saline with 0.1% Tween-20 (TBST) for 1.5 hours at 25 ℃ prior to incubation at 4 ℃ for 16 hours with the following primary antibodies: VEGF-C, MMP2, MMP9, ERK/p-ERK, and AKT/p-AKT. After three TBST washes (10 min/wash), membranes were incubated with HRP-conjugated goat anti-rabbit IgG for 120 minutes at 25 ℃. Chemiluminescent detection was performed with SuperSignal West Pico PLUS substrate (Thermo Fisher Scientific) with image acquisition completed on an Amersham Imager 680 (GE HealthCare, Chicago, IL, USA). Densitometric analysis was conducted with ImageJ v.1.53a software (US National Institutes of Health, Bethesda, MD, USA) with background subtraction and β-actin serving as the internal control for normalization.

Statistical analysis

Quantitative data are expressed as the arithmetic mean ± standard deviation (n=3) from triplicate independent experiments. Parametric assumptions were verified through the Shapiro-Wilk normality test (α=0.05) and the Levene homogeneity of variance test, after which one-way analysis of variance with post hoc Tukey-Kramer multiple comparisons was conducted via SPSS 23.0 (IBM Corp., Armonk, NY, USA). A P value <0.05 was considered statistically significant.


Results

THP-1 cells were induced to differentiate directly into M1 and M2 cells

To establish the experimental model, THP-1 monocytes were first differentiated into non-polarized M0 macrophages by treatment with PMA, followed by polarization into M1 and M2 phenotypes using IFN-γ/LPS and IL-4, respectively. As illustrated in Figure 1, the induced cells exhibited the typical adherent morphology of macrophages, characterized by increased cell size and pseudopodia formation, in contrast to the suspension growth pattern of undifferentiated THP-1 monocytes. M1 macrophages (Figure 1A) generally showed an elongated, spindle-like, or irregular shape, while M2 macrophages (Figure 1B) adopted a more spread-out, fibroblast-like morphology. These distinct morphological features provided initial confirmation of successful phenotypic polarization.

Figure 1 THP-1 cells were induced to differentiate directly into M1 and M2 cells. 10× magnification. (A) M1 cell image; (B) M2 cell image.

mRNA expression levels of TNF-α, ARG-1, and iNOS in macrophages M0, M1, and M2

As shown in Figure 2, M1 and M2 macrophages significantly upregulated the expression of TNF-α, ARG-1, and iNOS as compared with M0 macrophages (P<0.05).

Figure 2 M0, M1, and M2 mRNA expression levels of TNF-α, ARG-1, and iNOS. Values are expressed as the mean ± standard deviation (n=3). Different lowercase letters above bars indicate significant differences (P<0.05) by one-way ANOVA with Tukey’s post hoc test. Groups sharing the same letter are not significantly different. Following 24 hours of drug treatment, M0 macrophages were harvested. These M0 cells were then induced to differentiate into M1 and M2 macrophages with specific stimulants for 48 hours prior to harvest. ANOVA, analysis of variance.

CCK-8 assay of cell proliferation

As shown in Figure 3, after treatment with different concentrations of recombinant CXCL9 protein in the coculture system, examination of M2 macrophages and A549 cells showed that CXCL9 significantly inhibited the promotional effect of M2 macrophages on the proliferation, migration, and invasion of A549 cells.

Figure 3 Results of the CCK-8 cell proliferation experiment after the coculture of A549 and M2 macrophages (n=3). CCK-8, Cell Counting Kit-8.

Effects of M2 macrophages on A549 cell migration and invasion after coculture with A549 cells

As shown in Figures 4,5, observation of the coculture system of M2 macrophages and A549 cells treated with different concentrations of recombinant CXCL9 protein revealed that as the concentration of recombinant CXCL9 protein increased, the promotional effect of M2 macrophages on the proliferation, migration, and invasion of A549 cells gradually weakened. Importantly, the inhibitory effect of CXCL9 was clearly dose-dependent. At the highest concentration tested (100 ng/mL), CXCL9 almost completely abrogated the M2 macrophage-induced promotion of A549 proliferation and migration, reducing the levels back to those observed in the control group.

Figure 4 Scratch wounds and migration cells in the scratch photographed at 18, 24, and 48 hours after the scratch-wound test. 10× magnification.
Figure 5 Cell scratch migration rate. Values were expressed as mean ± standard deviation (n=3). Different lowercase letters above bars indicate significant differences (P<0.05) by one-way ANOVA with Tukey’s post hoc test. Groups sharing the same letter are not significantly different. ANOVA, analysis of variance.

VEGF expression levels in the supernatant of each group after coculture of A549 and M2 macrophages

Given that M2 macrophages promote tumor progression partly through secretory factors like VEGF, we measured VEGF levels in co-culture supernatants. Figure 6 shows that the VEGF concentration was significantly elevated in A549 cells co-cultured with M2 macrophages compared to the control (P<0.05). CXCL9 treatment significantly suppressed VEGF levels at all tested concentrations (10-100 ng/mL) (P<0.05). However, the maximal inhibition did not strictly follow a dose-dependent relationship, as the effect observed at 100 ng/mL was significant but did not exceed that of lower concentrations.

Figure 6 VEGF expression levels in the supernatants of the A549 and M2 macrophage cocultured groups. Values are expressed as the mean ± standard deviation (n=3). Different lowercase letters above bars indicate significant differences (P<0.05) by one-way ANOVA with Tukey’s post hoc test. Groups sharing the same letter are not significantly different. ANOVA, analysis of variance.

Expression levels of macrophage-specific markers CD16, CD32, and CD206

As shown in Figure 7, CXCL9 played a key role in inhibiting M2 macrophage polarization and significantly reduced the expression of surface marker contents CD16, CD32, and CD206 (P<0.05). As shown in Figure 8, after the coculture of A549 cells with M2 macrophages, the mRNA expression levels of VEGF-C, MMP2, and MMP9 in the cells significantly increased as with the control cells (P<0.05). In the groups treated with 80 and 100 ng/mL of CXCL9, the mRNA expression levels of VEGF-C and MMP2 significantly decreased (P<0.05), while no significant changes were observed in the other groups. In the groups treated with 40, 60, 80, and 100 ng/mL of CXCL9, the mRNA expression level of MMP9 significantly decreased (P<0.05), but the level did not significantly change in the other groups.

Figure 7 Expression levels of macrophage-specific markers CD16, CD32, and CD206.
Figure 8 RNA expression levels of VEGF-C, MMP9, and MMP2 in the cells of each group after the coculture of A549 and M2 macrophages. Values are expressed as the mean ± standard deviation (n=3). Different lowercase letters above bars indicate significant differences (P<0.05) by one-way ANOVA with Tukey’s post hoc test. Groups sharing the same letter are not significantly different. ANOVA, analysis of variance.

Protein expression levels of VEGF-C, MMP9, MMP2, ERK, p-ERK, AKT, and p-AKT after coculture of A549 with M2 macrophages

We further confirmed these findings and investigated the underlying signaling pathways by Western blot analysis. As shown in Figure 9, co-culture with M2 macrophages significantly upregulated the protein expression of VEGF-C, MMP2, and MMP9 in A549 cells and enhanced the phosphorylation levels of ERK and AKT (P<0.05), indicating the activation of pro-survival and pro-invasion pathways. Treatment with CXCL9 effectively counteracted these effects. It significantly reduced the protein abundance of VEGF-C, MMP2, and MMP9. Crucially, CXCL9 treatment markedly inhibited the phosphorylation of both ERK and AKT (as indicated by decreased p-ERK/ERK and p-AKT/AKT ratios; P<0.05). This provides compelling evidence that the mechanism by which CXCL9 inhibits the tumor-promoting functions of M2 macrophages involves the suppression of the ERK and AKT signaling pathways.

Figure 9 CXCL9 inhibits M2 macrophage-induced pro-tumor signaling in co-cultured A549 cells. (A) Representative Western blot bands showing the protein expression levels of VEGF-C, MMP2, MMP9, ERK, p-ERK, AKT, and p-AKT in A549 cells and M2 macrophages under different treatment conditions. β-actin was used as the loading control. (B-H) Quantitative analysis of relative protein expression levels normalized to β-actin. Data are presented as the mean ± standard deviation (n=3). (B) Relative expression of VEGF-C. (C) Relative expression of MMP2. (D) Relative expression of MMP9. (E) Relative expression of total ERK. (F) Relative expression of p-ERK. (G) Relative expression of total AKT. (H) Relative expression of p-AKT. *, indicates a significant difference (P<0.05).

Discussion

Our study provides compelling evidence that CXCL9 acts as a potent negative regulator of the pro-tumorigenic crosstalk between M2-polarized macrophages and lung adenocarcinoma cells. The key findings demonstrate that CXCL9, in a dose-dependent manner, inhibits M2 macrophage-induced proliferation, migration, and invasion of A549 cells by suppressing M2 polarization, downregulating pro-metastatic factors (VEGF-C, MMP2, MMP9), and inhibiting the ERK/AKT signaling pathways. Our findings corroborate and substantially extend the established antitumor role of CXCL9. While previous studies in melanoma and breast cancer have linked CXCL9 to a favorable immune microenvironment and the inhibition of M2 polarization (16-18), our study provides direct, causal evidence of its concentration-dependent effect in lung adenocarcinoma. We quantitatively demonstrated that CXCL9 downregulates key M2 markers (CD206, CD16, CD32), providing a mechanistic explanation for earlier observations. Notably, we identified the inhibition of VEGF-C secretion as a significant outcome. Although CXCL9 is known for its anti-angiogenic properties, our co-culture model specifically reveals that this effect is mediated by the reprogramming of M2 macrophages, uncovering an indirect mechanism that operates alongside its potential direct actions on endothelial cells. This insight adds a novel dimension to our understanding of how chemokines sculpt the tumor microenvironment. The experimental results revealed that M1 macrophages significantly upregulated the expression of TNF-α and iNOS upon stimulation with phorbol ester, consistent with their proinflammatory characteristics. Meanwhile, M2 macrophages exhibited a marked increase in ARG-1 expression, aligning with their known anti-inflammatory and tumor-promoting properties (20,21). Importantly, M2 macrophages significantly enhanced the proliferation, migration, and invasion abilities of A549 lung cancer cells. However, the addition of different concentrations of CXCL9 recombinant protein to the coculture system significantly inhibited this promotional effect. This finding is consistent with previous research and further highlights the crucial role of CXCL9 in regulating tumor cell behavior (22).

At the validation level, the findings of this study clearly indicate that as a key chemokine, CXCL9 can significantly influence the activity of immune cells and the status of the TME (21). The experiment revealed that as the concentration of CXCL9 recombinant protein increased, the promotional effect of M2 macrophages on the proliferation, migration, and invasion of A549 cells gradually weakened. This observation aligns with the findings of Zhang et al. (22), whose work suggests that CXCL9 can inhibit the promotional effects of TAMs on tumor cells. At the analytical level, the inhibition of M2 macrophage function by CXCL9 may be closely related to the mechanisms regulating immune cell activity and the state of the TME.

In the TME, M2 macrophages primarily promote the proliferation, migration, and invasion of tumor cells by secreting growth factors, cytokines, and chemokines (23). As an antitumor chemokine, CXCL9 may exert its effects through several pathways: first, by regulating interactions between cells in the TME, such as by affecting the expression of adhesion molecules between M2 macrophages and A549 cells (24), which reduces cell-cell interactions and thereby inhibits tumor cell migration and invasion (25); second, by inhibiting the secretion of VEGF by M2 macrophages, thereby decreasing the proliferative potential of tumor cells; and third, by regulating cell signaling pathways (26). This study further demonstrated that in the coculture system of A549 lung adenocarcinoma cells and M2 macrophages, the addition of the chemokine CXCL9 significantly reduced the expression level of VEGF in the cell supernatant. As an angiogenesis-inhibiting chemokine, CXCL9 may potentially interfere with the VEGF signaling pathway. One plausible hypothesis, supported by previous research in other models (27), is that CXCL9 could act by competitively binding to its receptor VEGF-2 (KDR). Our observed reduction in VEGF-related signaling is consistent with such a mechanism. This proposed competitive inhibition mechanism has been suggested in previous studies, such as in a liver fibrosis model (28-30), where CXCL9 was shown to attenuate VEGF-driven responses. Our results, showing suppressed phosphorylation of ERK and AKT following CXCL9 treatment, align with the downstream consequences of disrupting VEGFR2 signaling, thus providing indirect support for this hypothesis in our lung cancer model.

M2 macrophages typically play a role in promoting tumor progression in the TME (31,32). One study found that M2 macrophages can upregulate the expression of VEGFR3, thereby promoting the migration and invasion of A549 cells (33). In the coculture system in this study, the addition of CXCL9 was found to indirectly affect VEGF expression and tumor cell invasiveness by regulating the function of M2 macrophages. Scratch-wound and Transwell chamber invasion assays showed that the migration and invasion abilities of treated A549 cells were inhibited, providing further validation of this function. In summary, the addition of CXCL9 to the A549 and M2 macrophage coculture system reduced VEGF expression levels through multiple mechanisms, including direct competitive binding to VEGF receptors, regulation of M2 macrophage function, and modification of the TME. This reduction in VEGF expression is closely related to the decreased metastatic and invasive capabilities of tumor cells and may offer novel insights and potential targets for cancer treatment.

Furthermore, research has shown that CXCL9 plays a key role in inhibiting the polarization of M2 macrophages, significantly reducing the expression of surface markers CD16, CD32, and CD206. This finding is consistent with several reports emphasizing the importance of these markers in tumor progression and macrophage polarization (34,35).

These findings fundamentally alter our understanding of CXCL9’s therapeutic potential by revealing its dual role as both a macrophage polarization modulator and direct signaling pathway inhibitor. The demonstrated suppression of ERK/AKT phosphorylation suggests that CXCL9 may be able to overcome the resistance mechanisms associated with single-pathway targeted therapies. Particularly significant is the observed nonlinear dose-response relationship, in which concentrations >60 ng/mL induced disproportionate effects, suggesting the presence of critical therapeutic thresholds.

To translate these preclinical proofs of concept into clinical reality, future diagnostic paradigms should prioritize clinical validation of the CD206:VEGF-C ratio as a predictive biomarker for CXCL9 responsiveness in liquid biopsy analyses. To refine stratification strategies, prospective studies should evaluate the inclusion of M2 macrophage infiltration levels as inclusion criteria for CXCL9-based clinical trials. To address pharmacokinetic limitations, therapeutic development should involve achieving sustained intratumoral CXCL9 concentrations ≥60 ng/mL, and nanoparticle-based delivery systems should be investigated as a primary strategy given the compound’s short plasma half-life (t1/2 ≈2.1 h).


Conclusions

This study investigated the mechanism by which M2 macrophages contribute to the invasion and metastasis of lung cancer and revealed the potential mechanism of regulation of CXCL9. The results indicate that M2 macrophages significantly enhance the proliferation, migration, and invasion capabilities of A549 lung cancer cells. This enhancement is closely associated with the high expression of tumor growth- and metastasis-related factors, such as VEGF, MMP2, and MMP9, by M2 macrophages. As a chemokine, CXCL9 can inhibit the role of M2 macrophages in promoting the invasion and metastasis of lung cancer by inhibiting the polarization of M2 macrophages, reducing the expression of the surface marker CD206, and suppressing the expression of VEGF-C, MMP9, and MMP2.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2336/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2336/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2336/prf

Funding: This research was supported by grants from the Zhejiang Medical and Health Science and Technology Project (No. 2022KY1365), and the Zhoushan Municipal Science and Technology Bureau, Zhejiang Province (No. 2020C31045 and No. 2023C31001).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2336/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Filho AM, Laversanne M, Ferlay J, et al. The GLOBOCAN 2022 cancer estimates: Data sources, methods, and a snapshot of the cancer burden worldwide. Int J Cancer 2025;156:1336-46. [Crossref] [PubMed]
  2. Luo G, Zhang Y, Rumgay H, et al. Estimated worldwide variation and trends in incidence of lung cancer by histological subtype in 2022 and over time: a population-based study. Lancet Respir Med 2025;13:348-63. [Crossref] [PubMed]
  3. Ye Q, Lei L, Aili AX. Identification of potential targets for ovarian cancer treatment by systematic bioinformatics analysis. Eur J Gynaecol Oncol 2015;36:283-9.
  4. Patch AM, Christie EL, Etemadmoghadam D, et al. Whole-genome characterization of chemoresistant ovarian cancer. Nature 2015;521:489-94. [Crossref] [PubMed]
  5. Mantovani A, Sica A, Sozzani S, et al. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 2004;25:677-86. [Crossref] [PubMed]
  6. Lu XJ, Chen Q, Rong YJ, et al. CXCR3.1 and CXCR3.2 Differentially Contribute to Macrophage Polarization in Teleost Fish. J Immunol 2017;198:4692-706. [Crossref] [PubMed]
  7. Tlsty TD, Coussens LM. Tumor stroma and regulation of cancer development. Annu Rev Pathol 2006;1:119-50. [Crossref] [PubMed]
  8. Semenza GL. HIF-1 and tumor progression: pathophysiology and therapeutics. Trends Mol Med 2002;8:S62-7. [Crossref] [PubMed]
  9. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med 1995;1:27-31. [Crossref] [PubMed]
  10. Ostrand-Rosenberg S. Tolerance and immune suppression in the tumor microenvironment. Cell Immunol 2016;299:23-9. [Crossref] [PubMed]
  11. Mukhtar RA, Nseyo O, Campbell MJ, et al. Tumor-associated macrophages in breast cancer as potential biomarkers for new treatments and diagnostics. Expert Rev Mol Diagn 2011;11:91-100. [Crossref] [PubMed]
  12. Haldar M, Murphy KM. Origin, development, and homeostasis of tissue-resident macrophages. Immunol Rev 2014;262:25-35. [Crossref] [PubMed]
  13. Yan W, Wu X, Zhou W, et al. Cancer-cell-secreted exosomal miR-105 promotes tumour growth through the MYC-dependent metabolic reprogramming of stromal cells. Nat Cell Biol 2018;20:597-609. [Crossref] [PubMed]
  14. Davies LC, Taylor PR. Tissue-resident macrophages: then and now. Immunology 2015;144:541-8. [Crossref] [PubMed]
  15. Aiello S, Benigni A, Remuzzi G. Tissue-Resident Macrophages in Solid Organ Transplantation: Harmful or Protective? J Immunol 2024;212:1051-61. [Crossref] [PubMed]
  16. Wynn TA, Chawla A, Pollard JW. Macrophage biology in development, homeostasis and disease. Nature 2013;496:445-55. [Crossref] [PubMed]
  17. Papayannakos CJ, Israr M, DeVoti JA, et al. Oropharyngeal carcinomas induce circulating monocytes to express a TAM-like pro-tumor expression profile that suppresses T-cell proliferation. Front Immunol. 2025;16:1539780. [Crossref] [PubMed]
  18. Li H, Miao YQ, Suo LP, et al. CD206 modulates the role of M2 macrophages in the origin of metastatic tumors. J Cancer 2024;15:1462-86. [Crossref] [PubMed]
  19. Le Y, Zhou X, Zheng J, et al. Anti-Hyperuricemic Effects of Astaxanthin by Regulating Xanthine Oxidase, Adenosine Deaminase and Urate Transporters in Rats. Mar Drugs 2020;18:610. [Crossref] [PubMed]
  20. Gautier EL, Shay T, Miller J, et al. Gene-expression profiles and transcriptional regulatory pathways that underlie the identity and diversity of mouse tissue macrophages. Nat Immunol 2012;13:1118-28. [Crossref] [PubMed]
  21. Alvarez MM, Liu JC, Trujillo-de Santiago G, et al. Delivery strategies to control inflammatory response: Modulating M1-M2 polarization in tissue engineering applications. J Control Release 2016;240:349-63. [Crossref] [PubMed]
  22. Zhang L, Shi P, Jin P, et al. Ganodermanontriol regulates tumor-associated M2 macrophage polarization in gastric cancer. Aging (Albany NY) 2024;16:1390-8. [Crossref] [PubMed]
  23. Van der Jeught K, Xu HC, Li YJ, et al. Drug resistance and new therapies in colorectal cancer. World J Gastroenterol 2018;24:3834-48. [Crossref] [PubMed]
  24. Cronin KA, Lake AJ, Scott S, et al. Annual Report to the Nation on the Status of Cancer, part I: National cancer statistics. Cancer 2018;124:2785-800. [Crossref] [PubMed]
  25. Lin X, Kang K, Chen P, et al. Regulatory mechanisms of PD-1/PD-L1 in cancers. Mol Cancer 2024;23:108. [Crossref] [PubMed]
  26. Kloor M, von Knebel Doeberitz M. The Immune Biology of Microsatellite-Unstable Cancer. Trends Cancer 2016;2:121-33. [Crossref] [PubMed]
  27. Negrini S, Gorgoulis VG, Halazonetis TD. Genomic instability--an evolving hallmark of cancer. Nat Rev Mol Cell Biol 2010;11:220-8. [Crossref] [PubMed]
  28. Becht E, de Reyniès A, Giraldo NA, et al. Immune and Stromal Classification of Colorectal Cancer Is Associated with Molecular Subtypes and Relevant for Precision Immunotherapy. Clin Cancer Res 2016;22:4057-66. [Crossref] [PubMed]
  29. Guinney J, Dienstmann R, Wang X, et al. The consensus molecular subtypes of colorectal cancer. Nat Med 2015;21:1350-6. [Crossref] [PubMed]
  30. Arai H, Elliott A, Xiu J, et al. The Landscape of Alterations in DNA Damage Response Pathways in Colorectal Cancer. Clin Cancer Res 2021;27:3234-42. [Crossref] [PubMed]
  31. Grimmett E, Al-Share B, Alkassab MB, et al. Cancer vaccines: past, present and future; a review article. Discov Oncol 2022;13:31. [Crossref] [PubMed]
  32. Moretto R, Elliott A, Zhang J, et al. Homologous Recombination Deficiency Alterations in Colorectal Cancer: Clinical, Molecular, and Prognostic Implications. J Natl Cancer Inst 2022;114:271-9. [Crossref] [PubMed]
  33. Lu C, Guan J, Lu S, et al. DNA Sensing in Mismatch Repair-Deficient Tumor Cells Is Essential for Anti-tumor Immunity. Cancer Cell 2021;39:96-108. [Crossref] [PubMed]
  34. Mitsogianni M, Trontzas IP, Gomatou G, et al. The changing treatment of metastatic her2-positive breast cancer. Oncol Lett 2021;21:287. [Crossref] [PubMed]
  35. Mantovani A, Marchesi F, Malesci A, et al. Tumour-associated macrophages as treatment targets in oncology. Nat Rev Clin Oncol 2017;14:399-416. [Crossref] [PubMed]
Cite this article as: Mi L, Xu L, Chen Z, Zheng Y. The influence of CXCL9 on M2 macrophages in lung cancer development. Transl Cancer Res 2025;14(12):8965-8978. doi: 10.21037/tcr-2025-aw-2336

Download Citation