Pre-clinical anti-tumor activity and preliminary safety of METTL3 inhibitors STM2457 and UZH1a in neuroblastoma
Original Article

Pre-clinical anti-tumor activity and preliminary safety of METTL3 inhibitors STM2457 and UZH1a in neuroblastoma

Tian Lin1,2 ORCID logo, Xinghe Chen1,2, He Huang1,2, Jianxing Zhang1,2, Yali Xu1,2, Junshan Lin1,2

1Department of Pediatric Surgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou, China; 2Department of Pediatric Surgery, National Regional Medical Center, Binhai Campus of The First Affiliated Hospital, Fujian Medical University, Fuzhou, China

Contributions: (I) Conception and design: T Lin, J Lin; (II) Administrative support: T Lin; (III) Provision of study materials or patients: T Lin, X Chen, H Huang, J Zhang, Y Xu; (IV) Collection and assembly of data: X Chen, H Huang, J Zhang, Y Xu; (V) Data analysis and interpretation: T Lin, X Chen; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Junshan Lin, MM. Associate Professor, Department of Pediatric Surgery, The First Affiliated Hospital of Fujian Medical University, No. 20 Chazhong Road, Fuzhou 350005, China; Department of Pediatric Surgery, National Regional Medical Center, Binhai Campus of The First Affiliated Hospital, Fujian Medical University, Fuzhou 350212, China. Email: 13144591@qq.com.

Background: Neuroblastoma (NB) is one of the most common malignant tumors in children, characterized by high heterogeneity and poor prognosis, posing notable therapeutic challenges. The objective of the present study was to investigate the therapeutic potential and safety profile of two N6-adenosine-methyltransferase 70 kDa subunit (METTL3) inhibitors, STM2457 and UZH1a, in NB.

Methods: In this study, we utilized the SK-N-SH cells and wild-type AB strain zebrafish to investigate the anti-tumor efficacy of STM2457 and UZH1a in NB. Cell counting kit-8 (CCK-8), Transwell assays, apoptosis detection, and global N6-methyladenosine (m6A) quantification were performed following 24 h exposure of STM2457 or UZH1a in SK-N-SH cells. For zebrafish, acute-toxicity screening, hepatic enzyme measurement, and xenograft establishment were conducted. Total RNA from larvae was subjected to reverse transcription quantitative polymerase chain reaction for immune-regulatory genes and transcriptome sequencing to identify key pathways.

Results: In vitro, both compounds showed their half-maximal inhibitory concentration (IC50) values (8.27 and 10.01 µM, respectively) and reduced global m6A levels. Functionally, STM2457 and UZH1a markedly inhibited SK-N-SH cells viability, migration, and invasion, while increasing apoptosis. In vivo, 15 µg/mL STM2457 and UZH1a effectively inhibiting the growth and migration of zebrafish xenograft tumors, and no mortality or hepatic toxicity [alanine aminotransferase (ALT) and aspartate aminotransferase (AST)] was observed. The maximum tolerated concentration was 20 µg/mL. Mechanistically, molecular analysis revealed that STM2457 and UZH1a downregulated the gene expression levels of pro-tumorigenic factors and upregulated the expression of anti-tumor cytokines. Transcriptomic sequencing results further indicated that the neuroactive ligand-receptor interaction is a key pathway through which STM2457 affected NB development.

Conclusions: STM2457 and UZH1a exhibited potent anti-NB activity both in vitro and in vivo by inhibiting viability, migration, invasion, and promoting apoptosis. These findings provide a notable theoretical basis for the potential use of METTL3 inhibitors as therapeutic agents against NB.

Keywords: N6-adenosine-methyltransferase 70 kDa subunit (METTL3); STM2457; UZH1a; neuroblastoma (NB); RNA sequencing


Submitted Oct 31, 2025. Accepted for publication Jan 14, 2026. Published online Mar 24, 2026.

doi: 10.21037/tcr-2025-aw-2392


Highlight box

Key findings

• N6-adenosine-methyltransferase 70 kDa subunit (METTL3) inhibitors STM2457 and UZH1a suppress neuroblastoma (NB) growth, migration, and invasion, promote apoptosis in vitro, and safely inhibit xenograft progression in zebrafish by downregulating the neuroactive ligand-receptor interaction, providing a target for the treatment of high-risk NB.

What is known and what is new?

• METTL3 inhibitors have inhibitory effects on the survival and metastasis of various cancer cells. However, the safety of METTL3 inhibitors in vivo and their therapeutic effects on NB have not been studied yet.

• Our study demonstrates that STM2457 and UZH1a potently inhibit NB cell viability, migration, and invasion, induce apoptosis, and suppress xenograft growth and migration in zebrafish. The transcriptomic and reverse transcription quantitative polymerase chain reaction analysis further reveal that STM2457 down-regulates the neuroactive ligand-receptor interaction pathway.

What is the implication, and what should change now?

• These results provide the first pre-clinical evidence that the METTL3 inhibitor is a safe strategy against NB in a validated zebrafish xenograft model, offering an immediately translatable therapy for high-risk NB patients.

• Future research should focus on the validation of gene-amplified and non-amplified NB lines, quantify pathway proteins by Western blot, and perform STM2457 rescue with clustered regularly interspaced short palindromic repeats-activated receptors, thereby strengthening the mechanistic rigor and translational impact of our findings.


Introduction

Neuroblastoma (NB) is one of the most common malignant solid tumors in pediatric oncology, originating from aberrant primitive neuroectodermal progenitors (1-3). With a high incidence rate of 7–10% of childhood malignancies, NB typically arises in the adrenal glands or sympathetic ganglia but can also occur in other locations such as the chest, abdomen, and pelvis (4-8). Despite intensive multimodal therapy (including surgery, chemotherapy, radiotherapy, and immunotherapy) and targeted agents, high-risk NB remains refractory, with 5-year survival rates <50% and frequent relapse driven by tumor heterogeneity and acquired resistance (9,10). Previous research has identified MYCN proto-oncogene (a bHLH transcription factor amplification), epigenetic dysregulation, and aberrant signaling pathways as well-established drivers of NB progression, yet effective targeted therapies remain scarce (11). Consequently, identifying novel molecular targets and corresponding inhibitors is an urgent clinical priority.

N6-adenosine-methyltransferase 70 kDa subunit (METTL3) is an RNA methyltransferase that installs N6-methyladenosine (m6A) on messenger RNA (mRNA) and thereby controlling RNA stability, translation efficiency, and splicing, exerting significant functions in various biological processes including transcriptional regulation, cell viability, and differentiation (12). Moreover, METTL3 is frequently overexpressed or hyper-activated in multiple cancers, where it promotes oncogenic transcriptional programs, immune evasion, and metastasis (13,14). Mechanistically, METTL3-mediated m6A modification stabilizes oncogenic transcripts and reprograms the tumor microenvironment, rendering METTL3 inhibition an attractive anticancer strategy and widely studied in inflammatory diseases and cancers (15-17). The development of METTL3 inhibitors has become a target in cancer therapy.

Previous preclinical studies have validated the METTL3 inhibitors, STM2457 (a pyridinopyrimidine derivative) and UZH1a (a pyrimidine-based scaffold), as potent suppressors of tumor viability, invasion, and chemoresistance (18,19). Yanagi et al. (20) demonstrated that UZH1a can inhibit methylation and reduce the expression of viral lysate proteins. The research by Yankova et al. (19) revealed for the first time that STM2457, by binding to the S-adenosine methionine site of METTL3, downregulates the m6A methylation level of the target gene and markedly inhibits the viability of acute myeloid leukemia (AML) cells. Notably, compared with UZH1a, STM2457 exhibits higher catalytic site affinity and in vivo stability, thereby converting into stronger anti-tumor activity (21). Nevertheless, the clinical application of METTL3 inhibitors still faces challenges, requiring further investigation to address biological mechanisms and clinical application issues.

In view of the reported inhibitory effects of METTL3 inhibitors on the viability and metastasis of numerous cancer cells, we hypothesized that METTL3 inhibitors would suppress NB by inhibiting the viability, migration, and invasion of tumor cells, and promoting cell apoptosis. To verify this hypothesis, the present study first evaluated the effects of two METTL3 inhibitors, STM2457 and UZH1a, on viability inhibition, migration, invasion, and induction of apoptosis of NB cells using in vitro experiments. Subsequently, the zebrafish xenotransplantation model and transcriptomic analysis were used to study the inhibitory effect of METTL3 inhibitors on tumor viability and migration. Evaluation of anti-NB activity and the clarification of associated pathways are needed to establish METTL3 inhibition as a promising therapeutic avenue for NB. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2392/rc).


Methods

Materials and reagents

METTL3 inhibitors STM2457 and UZH1a were purchased from MedChemExpress (Shanghai, China; cat. Nos. HY-134673A and HY-134836, respectively). Dulbecco’s modified Eagle’s medium (DMEM) was purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China; cat. No. PM150210). Cell counting kit-8 (CCK-8), Matrigel, and Annexin V-fluorescein isothiocyanate (FITC) Cell Apoptosis Detection Kit were obtained from Beyotime Institute of Biotechnology (Shanghai, China; cat. Nos. C0037, C0371, and C1062S, respectively). Dimethyl sulfoxide (DMSO) was purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany; cat. No. 67-68-5; Merck KGaA). RNAiso Plus reagent was purchased from Takara Bio, Inc. (Kusatsu, Japan; cat. No. 9109), and reverse transcription and reverse transcription quantitative polymerase chain reaction (RT-qPCR) kits were from Novoprotein Scientific Inc. (Suzhou, China; cat. Nos. abs60077 and E096, respectively).

Cell lines

The human SK-N-SH cell line was obtained from Xiamen Yimo Biotechnology Co., Ltd. (Xiamen, China). The cells were cultured in 87% minimum essential medium (MEM; cat. No. 11140050; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; cat. No. AUS-02S-02; Cell-Box Biological Products Trading Co., Ltd., Changsha, China), 1% GlutaMAX (cat. No. 35050061; Thermo Fisher Scientific, Inc.), and 1% penicillin-streptomycin (P/S; cat. No. 15140122; Thermo Fisher Scientific, Inc.) at 37 ℃ in a humidified atmosphere containing 5% CO2. The culture medium was changed daily, and the cells were treated with 1, 2.5, 5, 10, 20, and 40 µM STM2457/UZH1a or with an equal volume of 0.1% DMSO (as negative control) during the logarithmic growth phase for 48 h at 37 ℃.

Zebrafish

The wild-type AB strain zebrafish were obtained from the China Zebrafish Resource Center (Institute of Hydrobiology; Chinese Academy of Sciences), and were certified by the International Association for Assessment and Accreditation of Laboratory Animal Care [license No. SYXK (Zhe) 2012-0171]. The zebrafish larvae at 48 h post-fertilization (hpf) were obtained using natural mating and were reared in a breeding facility under controlled light conditions (14:10 light cycle). Following the methods of the guidelines of 2020 AVMA (https://www.avma.org/resources-tools/avma-policies/avma-guidelines-euthanasia-animals), 96 hpf zebrafish euthanasia was performed using immersion in 300 mg/L 3-aminobenzoic acid ethyl ester methanesulfonate from MilliporeSigma (Burlington, MA, USA; cat. No. 886-86-2) until cessation of opercular movement (10 min), followed by 20 min ice bath immersion to ensure irreversible vital sign cessation. Because the 96 hpf zebrafish larvae are non-mammalian, the experiments were administratively exempted by the Animal Ethics Committee of Fuzhou Cold-Spring Biology Co., Ltd. All animal experiments were conducted in compliance with “Quality Control of Experimental Fish in Laboratory Animals” (GB/T 39649-2020), “Experimental Fish” (DB11/T 1053-2013), and 2020 American Veterinary Medical Association (AVMA) guidelines for the care and use of animals. The ethical approval was exempted by the Ethics Committee of the Fuzhou Cold-Spring Biology. Co., Ltd. (No. IACUCBWS-HM-2025041501).

Cell viability assay

Cell viability was evaluated using a CCK-8 assay to assess the inhibitory effects of STM2457 and UZH1a on the SK-N-SH cell lines. The cells were seeded in 96-well plates at 2.0×103 cells per well. After 24 h of culture, different concentrations of STM2457 or UZH1a were added, and the cells were cultured for 24 h. After 4 h treatment with the CCK-8 reagent, the absorbance was measured at 450 nm by using a microplate reader to determine the optical density (OD) value and calculate the half-maximal inhibitory concentration (IC50) value.

Quantification of m6A modification

Total RNA was extracted from zebrafish larvae after 48 h exposure to IC50 STM2457 or UZH1a. Two hundred ng RNA was analyzed using the EpiQuik m6A RNA Methylation Quantification Kit (cat. No. A-P-9005; IVDSHOW) following the manufacturer’s protocol to quantify global m6A methylation levels.

Transwell cell migration and invasion assay

A Transwell assay was used to evaluate the inhibitory effects of STM2457 and UZH1a on migration and invasion of the SK-N-SH cell lines. For migration assays, 8-µm-pore polycarbonate inserts (cat. No. FTW067; Beyotime Institute of Biotechnology) were used. For invasion assays, the inserts were pre-coated with 50 µL of 1:8 diluted Matrigel and cured at 37 ℃ for 1 h. SK-N-SH cells treated with STM2457, UZH1a, or DMSO (2.0×103 cells per chamber, in 200 µL serum-free medium) were seeded into the upper compartment, and the lower chamber contained 600 µL of medium supplemented with 10% FBS. Transwell upper chambers were subsequently placed into the lower chamber wells using forceps and incubated at 37 ℃ for 24 h. After incubation, the Transwell chambers were removed, and non-migrating cells on the upper surface were gently wiped away using a cotton swab. Migratory or invaded cells on the underside were fixed in methanol (600 µL per well) for 20 min at 4 ℃. After fixation, chambers were washed once with PBS and stained with 0.1% crystal violet for 15 min at room temperature, and counted under a 10× microscope (BX41; Olympus, Tokyo, Japan) in five randomly selected fields per insert. Each condition was performed in triplicate.

Flow cytometry analysis of cell apoptosis

Apoptosis was assessed using flow cytometry based on Annexin V/propidium iodide (PI) staining. SK-N-SH cells were seeded at a density of 5×104 cells per well in six-well plates for 24 h, followed by treatment with 1/2 IC50 STM2457 or UZH1a for an additional 24 h. After treatment, cells were washed twice using PBS and incubated with 195 µL of Annexin V-FITC binding solution and 5 µL of Annexin V-FITC for 10 min at room temperature in the dark. After incubation, the cells were placed on ice and protected from light with foil. The cells were gently resuspended three times to improve staining efficiency before being immediately analyzed using a flow cytometer (NovoCyte 2060R; Agilent, Santa Clara, CA, USA). Annexin V-FITC fluorescence was detected as green fluorescence. FlowJo software (v10.10.0, Becton, Dickinson and Company Life Sciences, Franklin Lakes, NJ, USA) was used to analyze the flow cytometry data for apoptosis.

Xenograft animal experiment

To determine the effective doses of STM2457 and UZH1a, 540 zebrafish larvae at 48 hpf were randomly distributed into six-well plates with 20 fish per well in triplicate. Each well was treated with different concentrations (0, 0.1, 1, 5, 15, and 20 µg/mL) of STM2457 or UZH1a dissolved in the medium for 48 h. Zebrafish larvae in each group were observed under a stereomicroscope to record mortality and adverse events. For establishing the xenograft model, SK-N-SH cells labeled with 5 mM CM-Dil (dilution 1:1,000; red fluorescence) were microinjected at a dose of 200 cells/fish into the yolk sac or ventral yolk sac gap of zebrafish larvae (48 hpf). Tumors were observed and imaged using a fluorescence microscope (SMZ800N; Nikon Corporation, Tokyo, Japan) at 2 and 48 h post injection (hpi). Zebrafish injected with SK-N-SH cells at 2 hpi were divided into three groups (30 zebrafish per group) and treated with 0 µg/mL, 15 µg/mL STM2457, or 15 μg/mL UZH1a for 48 h. Fluorescent areas of tumor cells in the yolk sac or tail of each zebrafish were calculated using ImageJ software (v1.51j8, National Institutes of Health, Bethesda, MD, USA).

Determination of ALT and AST activities

Zebrafish larvae were exposed to 0–20 µg/mL STM2457 or UZH1a for 48 h. After exposure, larvae were homogenized on ice and centrifuged. The supernatant used for measurement of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) with ALT/glutamate-pyruvate transaminase (GPT) assay kit (cat. No. C009-2-1; Nanjing Jiancheng Bioengineering Institute, Nanjing, China) and AST/glutamic-oxaloacetic transaminase (GOT) assay kit (cat. No. C010-2-1; Nanjing Jiancheng Bioengineering Institute) according to the manufacturer’s instructions, respectively. Activities are expressed as U/gprot.

RT-qPCR analysis

To elucidate the immunoregulatory effects of METTL3 inhibitors on xenograft animals, the ArchimedTM RT-qPCR system (Roctron Technology Co., Ltd., Wuhan, China) was employed to detect the expression level of basic helix-loop-helix family member e41 (BHLHE41), SREBF chaperone (SCAP), interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α). Following euthanasia, the whole 96 hpf zebrafish larvae were immediately transferred to sterile 1.5 mL centrifuge tubes containing 2.8 mm sterile ceramic beads and flash-frozen in liquid nitrogen for complete tissue preservation. Homogenization was performed using a cryogenic grinder (cat. No. KZ-III; Wuhan Servicebio Technology Co., Ltd., Wuhan, China) at 4 ℃. Total RNA from zebrafish was extracted using TRIzol® reagent and reverse transcribed into complementary DNA (cDNA) using the reverse transcription kit according to the manufacturer’s protocol: 37 ℃ for 15 min, followed by enzyme inactivation at 85 ℃ for 5 s. The RT-qPCR reaction mixture (20 µL total volume) consisted of 10 µL SYBR® Premix Ex Taq, 1 µL RT-qPCR forward primer, 1 µL RT-qPCR reverse primer, 2 µL template cDNA, and 6 µL ddH2O. The RT-qPCR reaction conditions were set as follows: Initial denaturation at 95 ℃ for 30 s, followed by 40 cycles of denaturation at 95 ℃ for 5 s, annealing at 60 ℃ for 34 s, and extension at 72 ℃ for 40 s. A melt curve analysis was performed at the end of each reaction. The reference gene elongation factor 1-α1 (ef1α) was used, and relative gene expression levels were analyzed using the 2−ΔΔCT method (primer sequences are listed in Table 1).

Table 1

Primer sequences for RT-qPCR analysis in this work

Gene Species target Forward primer sequence (5'-3') Reverse primer sequence (5'-3')
BHLHE41 Danio rerio AAAGGCGATGGAAAGAGCGA ATCTGGTCGCGTACTTGTGG
SCAP Danio rerio CACTGAGCTGTGCATCATCC CGTAAAGTGCCCGGTTTAGG
IL-1β Danio rerio TGGACTTCGCAGCACAAAATG CACTTCACGCTCTTGGATGA
IL-6 Danio rerio TCAACTTCTCCAGCGTGATG TCTTTCCCTCTTTTCCTCCTG
TNF-α Danio rerio AAGGAGAGTTGCCTTTACCG ATTGCCCTGGGTCTTATGG
GRIK5 Homo sapiens AGAGCACAGAAGAGGGCATTG CACTTGCGCTTCAGGATCTC
NPY Homo sapiens CCTCATCACCAGGCAGAGAT GGAAAAGGCCAGAGAGCAAG
OPRD1 Homo sapiens CCAGAGTGCCAAGTACCTGA TGTTGATCAGCTTGGCCTTGG
DRD2 Homo sapiens GCTGGAGATGGAGATGCTCT GCATGCCCATTCTTCTCTGG
CHRNA3 Homo sapiens CTCTCCCTGACGGTGTTTCT TGGGGAGCAGGTTCAAGAAT
ef1α Danio rerio AACAGCTGATCGTTGGAGTCAA TTGATGTATGCGCTGACTTCCT
GAPDH Homo sapiens TCAAGAAGGTGGTGAAGCAGG TCAAAGGTGGAGGAGTGGGT

BHLHE41, basic helix-loop-helix family member e41; CHRNA3, neuronal acetylcholine receptor subunit α3; DRD2, dopamine receptor D2; ef1α, elongation factor 1-α1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GRIK5, glutamate ionotropic receptor kainate type subunit 5; IL-1β, interleukin-1β; IL-6, interleukin-6; NPY, neuropeptide Y; OPRD1, opioid receptor δ; RT-qPCR, reverse transcription quantitative polymerase chain reaction; SCAP, SREBF chaperone; TNF-α, tumor necrosis factor-α.

Transcriptome sequencing and analysis

The human SK-N-SH cells in each group were collected for RNA extraction by RNAiso Plus reagent, and transcriptome library construction and transcriptome double-ended sequencing were performed using the Illumina NovaSeq X Plus platform (San Diego, CA, USA; 12 bp unique dual indices were added with the TruSeq RNA Single Indexes Set A). The quality of the original sequencing data was evaluated using tools such as FastQC, and the sequencing read segment was compared with the reference genome of human. DESeq2 software (v1.49.3, Bioconductor) was used for differential expression analysis to screen out the significantly differentially expressed genes (DEGs) between different treatment groups, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed for the DEGs. In addition, RT-qPCR was employed to validate the core pathway genes, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as the endogenous reference.

Statistical analysis

Data are presented as mean ± standard deviation (SD). Every experiment included at least three biological replicates (precise replicate counts are provided in each figure legend). Tumor fluorescence area analysis was measured using ImageJ software in µm2. The results of RT-qPCR were calculated using the relative quantification method, with gene expression represented as 2−ΔΔCq. All data analysis and plotting were performed using GraphPad Prism 8 software (Dotmatics). Differences between groups were assessed using one-way analysis of variance (ANOVA) followed by Tukey’s test, where *, P<0.05, **, P<0.01, ***, P<0.001, and ****, P<0.0001 were considered to indicate a statistically significant difference. A protocol was prepared before the study without registration.


Results

STM2457 and UZH1a inhibit viability, migration, invasion, and promote apoptosis in SK-N-SH cells

The cell viability assay showed that STM2457 and UZH1a reduced SK-N-SH survival in a concentration-dependent manner (Figure 1A), with log IC50 values of 0.92±0.02 and 1.00±0.03 µM, corresponding to IC50 values of 8.27 and 10.01 µM, respectively. Half of the IC50 was selected for follow-up experiments. To verify the validity of STM2457 and UZH1a, we examined the global m6A. As shown in Figure 1B, compared with the control group, global m6A% were significantly reduced by 63.55% in the STM2457 group and 51.96% in the UZH1a group. The decrease confirmed on-target inhibition of METTL3 methyl-transfer activity. The CCK-8 assay results show that STM2457 and UZH1a significantly inhibited the viability of SK-N-SH cells (Figure 1C). In the Transwell migration assay (Figure 1D,1E), cell counts under 10× magnification were 117.22±9.77 in the control group, 17.90±3.19 in the STM2457 group, and 23.86±7.65 in the UZH1a group, which revealed significant inhibition of cell migration compared to the control group for both STM2457 and UZH1a. Figure 1F,1G illustrates the results of the Transwell invasion assay, where cell counts under 10× magnification were 108.33±11.48 in the control group, 22.04±6.69 in the STM2457 group, and 13.59±2.08 in the UZH1a group, which indicated significant inhibition of cell invasion compared with the control group for both STM2457 and UZH1a. The apoptosis assay results showed that STM2457 and UZH1a significantly promoted apoptosis compared with the control group (Figure 1H,1I). The percentage of apoptosis in control, STM2457 and UZH1a groups was 5.48%±0.53%, 14.06%±0.65%, and 13.63%±0.65%, respectively. In summary, STM2457 and UZH1a effectively inhibited viability, migration, invasion, and promoted apoptosis in SK-N-SH cells.

Figure 1 Effects of STM2457 and UZH1a on SK-N-SH cells viability, migration, invasion, and apoptosis. IC50 values (A) of STM2457 and UZH1a in SK-N-SH cells for 24 h and the global m6A% (B), cell viability (C), migration capacity (D), invasion capacity (F), and apoptosis capacity (H) of SK-N-SH cells after treatment with DMSO, 1/2 IC50 STM2457 or UZH1a, including quantification (E,G,I). Data are presented as the mean ± SD of n=5 biologically independent SK-N-SH cell cultures. *, P<0.05; ****, P<0.0001. Scale bar =200 µm; stained with 0.1% crystal violet. DMSO, dimethyl sulfoxide; IC50, half-maximal inhibitory concentration; m6A, N6-methyladenosine; SD, standard deviation.

STM2457 and UZH1a toxicity and gene suppression effects on zebrafish

Adverse reactions of zebrafish treated with STM2457 and UZH1a were shown in Figure 2A,2B. No adverse reactions were observed within the concentration range of 0.1 to 15 µg/mL for STM2457 and UZH1a. At a concentration of 20 µg/mL, delayed yolk sac absorption and tail curling were observed in zebrafish, indicating that the no observed adverse effect level (NOAEL) for STM2457 and UZH1a was lower than 20 µg/mL. After repeated testing, the NOAEL was estimated to be 15 µg/mL. Therefore, subsequent experiments were performed using a concentration of 15 µg/mL.

Figure 2 Effect of increasing STM2457 and UZH1a concentrations in zebrafish larvae. STM2457 (A) and UZH1a (B) induce adverse reactions in zebrafish larvae, and the ALT (C,E) and AST (D,F) activities after treatment with 20 µg/mL STM2457 or UZH1a. Data presented as the mean ± SD of n=3 biologically independent zebrafish larvae. **, P<0.01; ***, P<0.001. ALT, alanine aminotransferase; AST, aspartate aminotransferase; SD, standard deviation.

To corroborate the NOAEL, we quantified ALT and AST activities in pooled larval homogenates after 48 h exposure to 0–20 µg/mL STM2457 or UZH1a (Figure 2C-2F). Neither of the AST and ALT showed any significant increase at concentrations of 0.1–15 µg/mL. However, a slight but significant increase was detected at 20 µg/mL, confirming that the 15 µg/mL NOAEL has a biochemical effect.

In order to deeply explore the potential regulatory mechanisms of STM2457 and UZH1a on the immune response of the body, we further analyzed the effects of these two compounds on the expression of key immune regulation-related genes. Compared with the control group, treatment with STM2457 and UZH1a at a concentration of 15 µg/mL significantly downregulated the expression of BHLHE41, SCAP, IL-1β, and IL-6, while TNF-α expression was significantly upregulated (Figure 3A-3E). This indicates that STM2457 and UZH1a modulate the expression of immune-related mRNAs.

Figure 3 The regulation of immune-related mRNA expression after treatment with 15 µg/mL STM2457 or UZH1a. The expression levels of BHLHE41 (A), SCAP (B), IL-1β (C), IL-6 (D), and TNF-α (E). Data presented as the mean ± SD of n=3 biologically independent zebrafish larvae. **, P<0.01; ***, P<0.001; ns, no significant (P>0.05). BHLHE41, basic helix-loop-helix family member e41; IL-1β, interleukin-1β; IL-6, interleukin-6; mRNA, messenger RNA; SCAP, SREBF chaperone; SD, standard deviation; TNF-α, tumor necrosis factor-α.

STM2457 and UZH1a inhibit in vivo xenograft tumor viability and migration in zebrafish

A xenograft model of SK-N-SH cells was established in zebrafish larvae, and fluorescence areas of the yolk sac and tail were measured. At 2 hpi of SK-N-SH cells, there were no significant differences in fluorescence areas between different groups of zebrafish. However, compared with the control group injected with SK-N-SH cells, treatment with 15 µg/mL STM2457 or UZH1a significantly inhibited the growth and migration of SK-N-SH tumors in zebrafish after 48 h of immersion (Figure 4A-4D).

Figure 4 Effects of STM2457 and UZH1a in viability and migration of xenograft tumors in zebrafish. The fluorescence intensity of viability (A) and migration (B) of SK-N-SH cells, including (C,D) quantification, after treatment with DMSO, STM2457, and UZH1a. Data are presented as the mean ± SD of n=10 biologically independent zebrafish larvae. **, P<0.01; ***, P<0.001; ns, no significant (P>0.05). DMSO, dimethyl sulfoxide; hpi, h post injection; SD, standard deviation.

STM2457 inhibitor mediates the inhibition of NB by suppressing neuroactive ligand-receptor interactions

As the previous results showed, STM2457 had a lower IC50, and its targeting affinity is higher than that of UZH1a, STM2457 was chosen for further study. To identify the pathways through which STM2457 affects NB, transcriptome sequencing was performed. Heatmap analysis of DEGs (Figure 5A) demonstrated significant differences after STM2457 inhibitor treatment. As shown in Figure 5B, there were 332 DEGs in the STM2457 inhibitor group compared with the control group, including 41 upregulated and 291 downregulated genes. Enrichment analysis (Figure 5C) revealed that these DEGs in the STM2457 inhibitor group were significantly enriched in 19 KEGG pathways, primarily involved in “Neuroactive ligand-receptor interaction”, “Dopaminergic synapse”, “Cell adhesion molecules (CAMs)”, “Cholinergic synapse”, and “CAMP signaling pathway”, with the most significant pathway being “Neuroactive ligand-receptor interaction”.

Figure 5 The transcriptome sequencing analysis of SK-N-SH cells treated with STM2457 inhibitor. Heatmap (A), volcano plot (B), KEGG pathway enrichment (C), and RT-qPCR analysis (D) of DEGs of the STM2457 inhibitor and control group. Data are presented as the mean ± SD of n=3 biologically independent SK-N-SH cell cultures. **, P<0.01; ***, P<0.001; ****, P<0.0001. CHRNA3, neuronal acetylcholine receptor subunit α3; DEGs, differentially expressed genes; DRD2, dopamine receptor D2; GRIK5, glutamate ionotropic receptor kainate type subunit 5; KEGG, Kyoto Encyclopedia of Genes and Genomes; NPY, neuropeptide Y; OPRD1, opioid receptor δ; RT-qPCR, reverse transcription quantitative polymerase chain reaction; SD, standard deviation; WT, wild-type.

Therefore, five genes [dopamine receptor D2 (DRD2), neuropeptide Y (NPY), glutamate ionotropic receptor kainate type subunit 5 (GRIK5), opioid receptor δ (OPRD1), and neuronal acetylcholine receptor subunit α3 (CHRNA3)] involved in the neuroactive ligand-receptor interaction pathway were selected for RT-qPCR validation. As depicted in Figure 5D, compared with the control group, RT-qPCR analysis showed significant downregulation of DRD2, NPY, GRIK5, OPRD1, and CHRNA3 gene expression levels. This indicates that the STM2457 inhibitor suppresses NB development by inhibiting the neuroactive ligand-receptor interaction pathway. However, this result remains a computationally predicted module, and functional validation is required.


Discussion

NB is a common malignant tumor in children with complex pathogenesis and notable treatment challenges (1,5-7). In the present study, the inhibitory effects of METTL3 inhibitors STM2457 and UZH1a on NB and their potential mechanisms of action were explored. METTL3, a methyltransferase, serves a crucial role in RNA methylation (12). Previous studies have shown that aberrant expression of METTL3 is closely associated with the development and progression of various cancers (13,14). Therefore, inhibiting METTL3 activity has emerged as a potential anticancer strategy. In previous years, the discovery of METTL3 inhibitors STM2457 and UZH1a had provided a new research direction for anti-tumor therapy targeting RNA epigenetic modifications. In a past preclinical study, UZH1a and STM2457 have demonstrated good pharmacokinetic characteristics and low cytotoxicity, suggesting that they have high translational potential (21). Although the research on UZH1a and STM2457 is still in its early stages, several studies have already explored their applications in cancer. A study has shown that in the mouse hepatocellular carcinoma (HCC) model, oral administration of UZH1a reduced tumor growth by 50%. The mechanism was to reduce the m6A modification level of suppressor of cytokine signaling 2 (SOCS2) mRNA, restore the expression of SOCS2 protein, inhibit the downstream JAK/STAT signaling pathway, and ultimately inhibit the viability of HCC cells and induce apoptosis (22). In a mouse AML transplantation model, intravenous injection of STM2457 markedly prolonged the median survival period of mice, reduced the leukemia burden by 80%, and no obvious toxicity was observed (19). These research results further support the potential therapeutic value of METTL3 inhibitors in various types of cancer.

The present study found that two METTL3 inhibitors, STM2457 and UZH1a, could significantly inhibit the viability, migration, and invasion of SK-N-SH cells. Meanwhile, the present study also confirmed that STM2457 and UZH1a demonstrated significant inhibitory effects on the growth and migration of zebrafish xenograft tumors. Firstly, it was confirmed that the concentrations of UZH1a or STM2457 within 15 µg/mL did not cause adverse effects or hepatotoxicity in zebrafish. However, at 20 µg/mL, ALT and AST levels significantly increased, and tail curling deformities occurred. This confirmed that 15 µg/mL was the safe exposure level. Based on this, the assessment of tumor growth and migration in zebrafish revealed inhibition following treatment with STM2457 or UZH1a, suggesting these compounds may not only act at the cellular level but also through similar mechanisms in vivo. These findings suggest that STM2457 and UZH1a could be effective therapeutic agents for NB. Existing studies have reported that METTL3 regulates lipid metabolism, influencing hepatic uptake of free fatty acids and the development of inflammation (23-25). Further experiments indicated that STM2457 and UZH1a may suppress tumor growth and migration by modulating immune-related mRNA expression. In the zebrafish model, treatment with STM2457 and UZH1a downregulated the expression of immune-related genes BHLHE41, SCAP, IL-6, and IL-1β, while upregulating TNF-α expression. This suggests that STM2457 and UZH1a may affect tumor development by modulating the expression of these immune-related genes. Further research will be needed to elucidate the specific mechanisms involved.

In the present study, the IC50 values of STM2457 and UZH1a against SK-N-SH cells were 8.27 and 10.01 µM, respectively, indicating that STM2457 had slightly higher anti-proliferative activity compared with UZH1a in vitro. This difference may be related to the chemical structure, targeting affinity, or metabolic stability of the two inhibitors. A previous study has shown that the efficacy of METTL3 inhibitors is closely associated with their ability to bind to catalytic domains (21). The pyridinopyrimidine skeleton of STM2457 may enhance binding to METTL3 through stronger hydrophobic interactions or hydrogen bond networks, thereby increasing the inhibition efficiency. In addition, we found that STM2457 decreased m6A% by 63.55%, while UZH1a caused a 51.96% reduction. STM2457 has a better inhibitory effect on m6A, indicating that it has a higher occupancy rate of the catalytic site and a longer residence time, thereby exerting a stronger inhibitory effect on the methylation transfer activity of METTL3.

Furthermore, STM2457 showed a more significant tumor migration inhibition effect in zebrafish models, suggesting that it may have improved pharmacokinetic properties in vivo. Therefore, transcriptome sequencing experiments were performed to explore potential pathways through which the STM2457 inhibitor may act. A Previous study has shown that miR-186, which is downregulated in human HCC, can promote METTL3-mediated tumor progression through the Wnt/β-catenin signaling pathway (26). Yu et al. (27) found that STM2457 regulates the expression of c-Myc by mediating m6A modification, thereby affecting the transcription and expression of downstream genes. Additionally, increased expression of METTL3 has been associated with elevated RNA m6A methylation levels of protein patched homolog 1 (PTCH1) and GLI1 family zinc finger 1 (GLI2) in tumors, leading to excessive activation of the hedgehog signaling pathway and promoting tumor progression (28). And our results indicated numerous DEGs in the STM2457 inhibitor group compared with the control group. Further analysis revealed enrichment in multiple KEGG pathways, such as “Neuroactive ligand-receptor interaction”, “Dopaminergic synapse”, and “Cell adhesion molecules (CAMs)”, suggesting STM2457 may exert its inhibitory effects on NB through various signaling pathways. Pathway enrichment highlighted several genes within the neuroactive ligand-receptor interaction axis, such as DRD2, NPY, GRIK5, OPRD1, and CHRNA3, whose down-regulation paralleled the anti-proliferative effect of STM2457. Whether these genes functionally drive the observed phenotype remains an open question. In our ongoing work, we are performing targeted small interfering RNA (siRNA) knockdown of each gene in SK-N-SH cells to dissect their individual contributions to proliferation, migration, and responsiveness to METTL3 inhibition.


Conclusions

METTL3 inhibitors STM2457 and UZH1a effectively inhibit viability, migration, and invasion of SK-N-SH cells while promoting apoptosis. The mechanisms of action may involve modulation of various pathways, including the “Neuroactive ligand-receptor interaction” signaling pathway. These findings provide important theoretical and experimental foundations for developing novel treatments for NB. However, further research is needed to validate their specific mechanisms of action and evaluate their safety and efficacy in clinical settings. Nevertheless, the present study was restricted to the SK-N-SH cell line, thereby overlooking the pronounced genetic heterogeneity inherent to NB. Additionally, the proposed involvement of the “Neuroactive ligand-receptor interaction” pathway rests solely on transcriptomic enrichment, and its relevance remains to be corroborated at the protein level and through functional rescue assays. Future studies should validate these key findings in a broader panel of NB cell lines representing different genetic backgrounds and risk subtypes to ensure generalizability.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2392/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2392/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2392/prf

Funding: This study was supported by the Fujian Medical University Qihang Fund Project (No. 2020QH1029).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2392/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experiments were conducted in compliance with “Quality Control of Experimental Fish in Laboratory Animals” (GB/T 39649-2020), “Experimental Fish” (DB11/T 1053-2013), and 2020 American Veterinary Medical Association (AVMA) guidelines for the care and use of animals. The ethical approval was exempted by the Ethics Committee of the Fuzhou Cold-Spring Biology. Co., Ltd. (No. IACUCBWS-HM-2025041501).

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. de Las Heras BM, Rubio-Aparicio PM, Rubio-San-Simón A, et al. Management and outcome of children with high-risk neuroblastoma: insights from the Spanish Society of Pediatric Hematology and Oncology (SEHOP) neuroblastoma group on refractory and relapse/progressive disease. Clin Transl Oncol 2025;27:3421-31. [Crossref] [PubMed]
  2. Qiu B, Matthay KK. Advancing therapy for neuroblastoma. Nat Rev Clin Oncol 2022;19:515-33. [Crossref] [PubMed]
  3. Fetahu IS, Taschner-Mandl S. Neuroblastoma and the epigenome. Cancer Metastasis Rev 2021;40:173-89. [Crossref] [PubMed]
  4. van Heerden J, Abraham N, Schoeman J, et al. Reporting Incidences of Neuroblastoma in Various Resource Settings. JCO Glob Oncol 2021;7:947-64. [Crossref] [PubMed]
  5. Nong J, Su C, Li C, et al. Global, regional, and national epidemiology of childhood neuroblastoma (1990-2021): a statistical analysis of incidence, mortality, and DALYs. EClinicalMedicine 2025;79:102964. [Crossref] [PubMed]
  6. Campbell K, Siegel DA, Umaretiya PJ, et al. A comprehensive analysis of neuroblastoma incidence, survival, and racial and ethnic disparities from 2001 to 2019. Pediatr Blood Cancer 2024;71:e30732. [Crossref] [PubMed]
  7. Irwin MS, Naranjo A, Zhang FF, et al. Revised Neuroblastoma Risk Classification System: A Report From the Children's Oncology Group. J Clin Oncol 2021;39:3229-41. [Crossref] [PubMed]
  8. Croteau N, Nuchtern J, LaQuaglia MP. Management of Neuroblastoma in Pediatric Patients. Surg Oncol Clin N Am 2021;30:291-304. [Crossref] [PubMed]
  9. Takita J. Molecular Basis and Clinical Features of Neuroblastoma. JMA J 2021;4:321-31. [Crossref] [PubMed]
  10. Tucker ER, Jiménez I, Chen L, et al. Combination Therapies Targeting ALK-aberrant Neuroblastoma in Preclinical Models. Clin Cancer Res 2023;29:1317-31. [Crossref] [PubMed]
  11. Epp S, Chuah SM, Halasz M. Epigenetic Dysregulation in MYCN-Amplified Neuroblastoma. Int J Mol Sci 2023;24:17085. [Crossref] [PubMed]
  12. Meng W, Xiao H, Mei P, et al. Critical Roles of METTL3 in Translation Regulation of Cancer. Biomolecules 2023;13:243. [Crossref] [PubMed]
  13. Yuan F, Zhang W, Xia Y, et al. The role and mechanism of METTL3 in cancer: emerging insights into m6A methylation and therapeutic potential. Eur J Med Res 2025;30:1017. [Crossref] [PubMed]
  14. Su W, Che L, Liao W, et al. The RNA m(6)A writer METTL3 in tumor microenvironment: emerging roles and therapeutic implications. Front Immunol 2024;15:1335774. [Crossref] [PubMed]
  15. Yin H, Ju Z, Zhang X, et al. Inhibition of METTL3 in macrophages provides protection against intestinal inflammation. Cell Mol Immunol 2024;21:589-603. [Crossref] [PubMed]
  16. Li Z, Feng Y, Han H, et al. A Stapled Peptide Inhibitor Targeting the Binding Interface of N6-Adenosine-Methyltransferase Subunits METTL3 and METTL14 for Cancer Therapy. Angew Chem Int Ed Engl 2024;63:e202402611. [Crossref] [PubMed]
  17. Zhou X, Yang X, Huang S, et al. Inhibition of METTL3 Alleviates NLRP3 Inflammasome Activation via Increasing Ubiquitination of NEK7. Adv Sci (Weinh) 2024;11:e2308786. [Crossref] [PubMed]
  18. Moroz-Omori EV, Huang D, Kumar Bedi R, et al. METTL3 Inhibitors for Epitranscriptomic Modulation of Cellular Processes. ChemMedChem 2021;16:3035-43. [Crossref] [PubMed]
  19. Yankova E, Blackaby W, Albertella M, et al. Small-molecule inhibition of METTL3 as a strategy against myeloid leukaemia. Nature 2021;593:597-601. [Crossref] [PubMed]
  20. Yanagi Y, Watanabe T, Hara Y, et al. EBV Exploits RNA m(6)A Modification to Promote Cell Survival and Progeny Virus Production During Lytic Cycle. Front Microbiol 2022;13:870816. [Crossref] [PubMed]
  21. Fiorentino F, Menna M, Rotili D, et al. METTL3 from Target Validation to the First Small-Molecule Inhibitors: A Medicinal Chemistry Journey. J Med Chem 2023;66:1654-77. [Crossref] [PubMed]
  22. Chen M, Wei L, Law CT, et al. RNA N6-methyladenosine methyltransferase-like 3 promotes liver cancer progression through YTHDF2-dependent posttranscriptional silencing of SOCS2. Hepatology 2018;67:2254-70. [Crossref] [PubMed]
  23. Dai G, Huang S, Li Y, et al. Mettl3-mediated m(6)A modification plays a role in lipid metabolism disorders and progressive liver damage in mice by regulating lipid metabolism-related gene expression. Aging (Albany NY) 2023;15:5550-68. [Crossref] [PubMed]
  24. Li Q, Xiang J. METTL3 promotes the progression of non-alcoholic fatty liver disease by mediating m6A methylation of FAS. Sci Rep 2025;15:6162. [Crossref] [PubMed]
  25. Luo P, Li S, Jing W, et al. N(6)-methyladenosine RNA modification in nonalcoholic fatty liver disease. Trends Endocrinol Metab 2023;34:838-48. [Crossref] [PubMed]
  26. Cui X, Wang Z, Li J, et al. Cross talk between RNA N6-methyladenosine methyltransferase-like 3 and miR-186 regulates hepatoblastoma progression through Wnt/β-catenin signalling pathway. Cell Prolif 2020;53:e12768. [Crossref] [PubMed]
  27. Yu H, Liu J, Bu X, et al. Targeting METTL3 reprograms the tumor microenvironment to improve cancer immunotherapy. Cell Chem Biol 2024;31:776-791.e7. [Crossref] [PubMed]
  28. Zhang ZW, Teng X, Zhao F, et al. METTL3 regulates m(6)A methylation of PTCH1 and GLI2 in Sonic hedgehog signaling to promote tumor progression in SHH-medulloblastoma. Cell Rep 2022;41:111530. [Crossref] [PubMed]
Cite this article as: Lin T, Chen X, Huang H, Zhang J, Xu Y, Lin J. Pre-clinical anti-tumor activity and preliminary safety of METTL3 inhibitors STM2457 and UZH1a in neuroblastoma. Transl Cancer Res 2026;15(3):186. doi: 10.21037/tcr-2025-aw-2392

Download Citation