Molecular profiling of gene fusions in soft tissue sarcomas by Ion AmpliSeqTM: a study of 35 cases
Introduction
Soft tissue sarcoma (STS) represents a heterogeneous group of rare tumors derived from mesenchymal tissue that occur in fat, fascia, muscle, fiber, lymph, blood vessels, and joints (1). Over 70 different histological subtypes of STS have been identified, which brings great difficulties to diagnosis because of the similar pathological manifestations and disordered imaging distributions (2). In addition, some STSs are easily misdiagnosed as benign tumors because of their small size, superficial location, clear borders, and slow growth (1). These diagnostic errors may lead to mistakes in treatment and a poor prognosis. For example, if a diagnosis is made based on simple clinical palpation and B-ultrasound examination, the STS may be mistakenly regarded as a benign tumor leading to hasty operation, and the lesion may not be identified as an STS until recurrence.
STS has an incidence rate of 5 cases per 100,000 people per year as reported by the World Health Organization (WHO) (3) and are the second most prevalent form of solid tumors and an important group of secondary malignancies, despite accounting for only 1% of all human malignancies (4). Early detection of STS improves the ability to effectively treat these tumors, and the best time for treatment is the first operation. Therefore, the first diagnosis is directly related to the patient’s ability to retain function of the involved limb (1). While traditionally, STS is classified according to the morphological appearance and type of the tumor tissue. with the development of molecular pathology, genetic profiling of STS has not only helped to understand its pathogenesis but has improved the accuracy of pathological subtyping (5). Genetic profiling can also be used for prognosis, staging, and monitoring the effect of treatment (6-11).
Gene fusions, a chromosomal rearrangement that causes the juxtaposition of two previously independent coding or regulatory sequences, are present in approximately one-third of all STS cases (1). The strong association between the type of gene fusions and the morphological subtype of STS makes gene fusions an incredibly useful diagnostic marker. The National Comprehensive Cancer Network (NCCN) and the WHO have recommended gene fusions as an auxiliary diagnostic indicator for STS (12,13). Most gene fusions are currently identified by fluorescence in situ hybridization (FISH), immunohistochemistry (IHC), or reverse transcription-polymerase chain reaction (RT-PCR)-based Sanger sequencing. However, these methods have low sensitivity and throughput, can detect only one fusion subtype at a time and, can only examine previously identified gene fusions. Currently, the gold standard method for gene fusion detection is FISH and while highly sensitive and specific, it is also labour intensive, subjective in analysis, and unable to screen a large number of gene fusions. In contrast, next-generation sequencing (NGS) not only enables parallel high-throughput sequencing of multiple genes and multiple samples, but also achieves ultra-high detection sensitivity through deep sequencing (14).
In this study, we investigated the applicability of Ion AmpliSeqTM Custom panel NGS on the Ion AmpliSeq Designer (https://www.ampliseq.com/login/login.action) for profiling gene fusions in 35 STS samples. Moreover, we compared the results of NGS with those of FISH, RT-PCR Sanger sequencing, and IHC. We present the following article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-22-70/rc).
Methods
Sample collection
The retrospective cohort consisted of 35 patients with a confirmed STS diagnosis during the period of 2013 until 2019 in the Second Hospital of Shanxi Medical University, whose formalin-fixed paraffin-embedded (FFPE) tumor tissue samples were retrieved from pathology archives. We retrieved clinical information of patients including age, sex, tumor site, tumor size, and histologic diagnoses. The study protocol was approved by the ethics committees of the Second Hospital of Shanxi Medical University [(2021)YX No. 019], and written informed consent was obtained from all patients prior to the study. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).
Nucleic acid isolation
Nucleic acid was isolated from samples using the Magen Hipure FFPE DNA/RNA Kit (Magen, China) and after treatment with DNase, RNA samples were quantified using a Qubit 3.0 Fluorometer (Thermo Fisher Scientific, Carlsbad, CA, USA).
IHC and FISH analysis
Immunohistochemical staining was performed by standard protocols. The FISH was performed on the deparaffinized and ethanol dehydrated 5-µm FFPE slides according to the manufacturer’s instruction. The commercially obtained break-apart probes DNA damage inducible transcript 3 (DDIT3) Break Apart, synaptotagmin (SYT) Break Apart, and collagen 1A1 (COL1A1)-platelets-derived growth factor β (PDGFB) (Zytovision, Germany) were used to detect translocations. Slides were counterstained with DAPI before visualization by fluorescence microscopy.
RT-PCR and Sanger sequencing
RNA was reverse transcribed by a SuperScript VILO cDNA synthesis kit (Invitrogen, MA, USA), and the synthesized cDNA was subjected to PCR using the Multiplex PCR MasterMix (UNG) according to the manufacturer’s protocol. Primers for the detection of the most common fusion transcripts in STS are described in Table 1 (1). Thermocycling conditions were modified based on previously published methods (14), and the bidirectional Sanger sequencing of the PCR products was conducted on an ABI 3730XL (Thermo Fisher Scientific).
Table 1
| Target | Primer (5' to 3') |
|---|---|
| COL1A1-E19F1 | GGTGCTGTTGGTGCTAAG |
| COL1A1-E19F2 | CAATGGTGCTCCTGGTATT |
| COL1A1-E32F1 | GTGTTCCTGGAGACCTTG |
| COL1A1-E32F2 | AAGAGGCGAGAGAGGTTT |
| COL1A1-E40F1 | GTCCTGGTGAAGTTGGTC |
| COL1A1-E40F2 | TCAAGGTATTGCTGGACAG |
| PDGFB-E2R2 | TGGTCACTCAGCATCTCA |
| PDGFB-E2R1 | AGGCGTTGGAGATCATCA |
| ASPSCR1-E7F | AAGCCAAAGAAGTCCAAGT |
| TFE3-E6R | CACGCCTTGACTACTGTA |
| SS18-E10F | GGTCCAGGTCCTCAGTAT |
| SSX1-E7R | CAGTTGTTTCCCATCGTTT |
| SSX2-E6R | CTTCTCAGAGGTAGTTGGTT |
| SSX4-E6R | CTCTGGCACTTCCTTCAA |
| FUS-E5F | TATGGTGGACAGCAGCAA |
| DDIT3-E2R | AGGTGTGGTGATGTATGAAG |
| FUS-E6F | GCAGTGGTGGCTATGAAC |
| EWSR1-E7F | GCCAAGCTCCAAGTCAAT |
| FLI1-E7R | CGTTGCTCTGTATTCTTACTG |
| ERG-E10R | ATCCGTCATCTTGAACTCC |
| TFE3-E5R | CTGAGCATTTCATCATTGT |
| FUS-E7F | GGTTACAACCGCAGCAGT |
| FLI1-E6R | ATGTTATTGCCCCAAGCTC |
| SSX1-E6R | CTTCTGACACTCCCTTCGA |
ASPSCR1, alveolar soft part sarcoma critical region-1; COL1A1, collagen 1A1; DDIT3, DNA damage inducible transcript 3; ERG, ETS transcription factor; EWSR1, Ewing sarcoma breakpoint region 1 gene; FLI1, Fli-1 proto-oncogene; FUS, FUS RNA binding protein; PDGFB, platelets-derived growth factor β; SS18, synovial sarcoma translocation chromosome 18; SSX, Synovial Sarcoma/X breakpoint; STS, soft tissue sarcoma; TFE3, transcription factor binding to IGHM enhancer 3.
Ion torrent library preparation and sequencing
Approximately 100 ng of RNA was reverse transcribed into cDNA using SuperScript IV VILO Master Mix (Life Technologies, CA, USA). Library preparation was processed with AmpliSeq Assay (Ion AmpliSeqTM Custom panels, IAD187473, and WG_IAD 186692 were designed by Tongshu Biotechnology Co., Changzhou, Jiangsu, China) according to the manufacturer’s protocol. The library concentrations were determined by a Qubit 2.0 Fluorometer (Thermo Fisher Scientific) and the normalized RNA libraries were pooled together for loading on Ion P1 chips, followed by sequencing on an Ion Torrent Proton using HiQ chemistry (Life Technologies).
Data analysis
The Torrent SuiteTM Browser was used to perform initial quality control on chip loading density and mapped reads number, and qualified sequencing data was further used to identify gene fusions by Ion ReporterTM version 5.0 with standard settings. Manual evaluation was conducted on the sequence accumulation of variants to ensure there was no misreading.
Statistical analysis
SPSS software (version 25.0) was used for all statistical analyses. All statistical tests were two-sided at the 5% level of significance.
Results
General characterization of samples
The 35 STS samples were obtained from 23 male patients, 11 female patients, and 1 patient of unknown sex (the clinical information from this patient was missing). The mean age of patients was 36 years old (range, 14–82 years old, Table 2). Histologic differential diagnosis of all cases was confirmed by an experienced pathologist, with the 35 STSs diagnosed as follows: alveolar soft-part sarcoma (ASPS) (n=9), Ewing’s sarcoma (ES) (n=4), synovial sarcoma (SS) (n=8), dermatofibrosarcoma protuberans (DFSP) (n=9), and myxoid liposarcoma (MLPS) (n=5). IHC using highly specific antibodies was performed on all samples. NGS was successfully performed on 34 of the 35 samples and Sanger sequencing was performed for all 34 samples. Only 12 (35.29%) samples were examined by conventional FISH analysis due to the lack of availability.
Table 2
| Case | Age (years) | Sex | Diagnosis | Left partner gene | Break point 1 | Right partner gene | Break point 2 | Sanger/FISH |
|---|---|---|---|---|---|---|---|---|
| 1 | 25 | M | ASPS | ASPSCR1 | E7 | TFE3 | E5 | C |
| 2 | 25 | M | ASPS | ASPSCR1 | E7 | TFE3 | E5 | C |
| 3 | 34 | M | ASPS | ASPSCR1 | E7 | TFE3 | E5 | C |
| 4 | 49 | M | MLPS | COL1A1 | E40 | PDGFB | E2 | C |
| 5 | 47 | F | MLPS | FUS | E7 | DDIT3 | E2 | C |
| 6 | 42 | M | MLPS | FUS | E5 | DDIT3 | E2 | C |
| 7 | 82 | M | MLPS | COL1A1 | E19 | PDGFB | E2 | C |
| 8 | NP | NP | MLPS | FUS | E8 | DDIT3 | E2 | C |
| COL1A1 | E19 | PDGFB | E2 | |||||
| 9 | 16 | F | ASPS | ASPSCR1 | E7 | TFE3 | E6 | C |
| 10 | 26 | F | ASPS | ASPSCR1 | E7 | TFE3 | E6 | C |
| 11 | 33 | M | ASPS | ASPSCR1 | E7 | TFE3 | E5 | C |
| 12 | 33 | M | ASPS | ASPSCR1 | E7 | TFE3 | E5 | C |
| 13 | 23 | F | ASPS | COL1A1 | E32 | PDGFB | E2 | C |
| ASPSCR1 | E7 | TFE3 | E6 | |||||
| 14 | 60 | M | DFSP | COL1A1 | E38/40/41/42/43 | PDGFB | E2 | C |
| 15 | 23 | M | DFSP | COL1A1 | E32 | PDGFB | E2 | C |
| 16 | 28 | F | DFSP | COL1A1 | E39/40/43 | PDGFB | E2 | C |
| 17 | 28 | F | DFSP | COL1A1 | E34/38/39/40/43 | PDGFB | E2 | C |
| 18 | 20 | M | DFSP | NA | NA | NA | NA | NA |
| 19 | 48 | F | DFSP | COL1A1 | E16/19/20 | PDGFB | E2 | C |
| 20 | 27 | M | DFSP | COL1A1 | E8/37/38/42/43/47 | PDGFB | E2 | C |
| 21 | 26 | M | ES | EWSR1 | E7 | FLI1 | E6 | C |
| COL1A1 | E32 | PDGFB | E2 | D | ||||
| 22 | 22 | F | ES | COL1A1 | E40 | PDGFB | E2 | C |
| EWSR1 | E7 | FLI1 | E6 | |||||
| 23 | 14 | F | ES | EWSR1 | E7 | ERG | E10 | C |
| 24 | 17 | M | ES | EWSR1 | E7 | FLI1 | E6 | C |
| 25 | 39 | M | SS | SS18 | E10 | SSX1 | E6 | C |
| 26 | 36 | M | SS | SS18 | E10 | SSX1 | E6 | C |
| SS18 | E10 | SSX4 | E6/7 | |||||
| 27 | 29 | M | SS | SS18 | E10 | SSX1 | E6 | C |
| COL1A1 | E32 | PDGFB | E2 | D | ||||
| 28 | 60 | M | SS | SS18 | E10 | SSX1 | E6 | C |
| 29 | 60 | M | SS | SS18 | E10 | SSX1 | E6 | C |
| 30 | 39 | M | SS | SS18 | E10 | SSX1 | E6 | C |
| 31 | 32 | F | DFSP | COL1A1 | E32/39/44/46/47 | PDGFB | E2 | C |
| 32 | 42 | F | DFSP | COL1A1 | E32 | PDGFB | E2 | C |
| 33 | 55 | M | DFSP | COL1A1 | E8/27/30/31/32 | PDGFB | E2 | C |
| 34 | 46 | M | SS | SS18 | E10 | SSX1 | E6 | C |
| 35 | 38 | M | SS | SS18 | E10 | SSX1 | E6 | C |
ASPS, alveolar soft-part sarcoma; ASPSCR1, alveolar soft part sarcoma critical region-1; C, concordant; COL1A1, collagen 1A1; D, discordant; DDIT3, DNA damage inducible transcript 3; DFSP, dermatofibrosarcoma protuberans; ERG, ETS transcription factor; ES, Ewing’s sarcoma; EWSR1, Ewing sarcoma breakpoint region 1 gene; F, female; FISH, fluorescence in situ hybridization; FLI1, Fli-1 proto-oncogene; FUS, FUS RNA binding protein; M, male; MLPS, myxoid liposarcoma; NA, not available; NGS, next-generation sequencing; NP, not provided; PDGFB, platelets-derived growth factor β; SS, synovial sarcoma; SS18, synovial sarcoma translocation chromosome 18; SSX, synovial sarcoma/X breakpoint; TFE3, transcription factor binding to IGHM enhancer 3.
Gene fusions identified by NGS
A high sequencing passing rate (100%) was observed with the Ion AmpliSeqTM Custom panels and each qualified run produced an average of 200,000 unique reads. As shown in Table 2, the most identified gene fusion was COL1A1-PDGFB (n=16) followed by synovial sarcoma translocation chromosome 18 (SS18)-synovial sarcoma/X breakpoint family member 1 (SSX1) (n=8), and ASPS chromosome region candidate 1 (ASPSCR1)-transcription factor for immunoglobulin heavy-chain enhancer 3 (TFE3) (n=8). All SS18-SSX1 fusions occurred between SS18 exon 10 and SSX1 exon 6 in the SS samples, while among the ASPSCR1-TFE3 fusions in eight ASPS specimens, five were exon 7/5 fusions and three were exon 7/6 fusions. Notably, COL1A1-PDGFB was not only identified in different STS types, including ASPS (n=1), ES (n=2), SS (n=1), DFSP (n=9), and MLPS (n=3), but also showed much more variant subtypes. The additional gene fusions identified by NGS in ES included Ewing sarcoma breakpoint region 1 gene (EWSR1)-ETS transcription factor (ERG) exon 7/10 fusion (n=1) and EWSR1-Fli-1 proto-oncogene (FLI1) exon 7/6 fusion (n=3). We also identified one case each of FUS RNA binding protein (FUS)-DDIT3 exon 5/2 fusion, exon 7/2 fusion, and exon 8/2 fusion in MLPS. Taken together, all gene fusions were correctly identified by NGS and subsequently further validated.
Concordance between NGS and pathological diagnosis
All the typical gene fusions in common STSs, including ASPS, ES, SS, DFSP, and MLPS, were identified by NGS in our study. ASPS is a rare, malignant STS with poor prognosis that mostly occurs in the extremities in adolescents and young adults (15,16). Its predominant translocation is the fusion of ASPSCR1 to the TFE3, and this was identified in all eight ASPS specimens by NGS.
ES mainly affects the long bones or vertebral regions of young people and children. Approximately 85–90% of patients carry the EWSR1-FLI1 fusion gene, and 9–14% of patients carry EWR1-ERG, both of which encode chimeric transcription factors (17). In our study, one EWSR1-ERG and three EWSR1-FLI1 fusions were detected in four ES samples by NGS.
SS tumors often arises deep in the soft tissue near a joint in the extremity of a young adult patient (18), and are mostly characterized by a fusion between the SS18 (SYT) gene on chromosome 18 and one of the SSX genes on the X chromosome, producing SS18-SSX1, SS18-SSX2, or SS18-SSX4 chimeric chromatin regulators (15-17,19-22). Our NGS results revealed that all eight SS samples in this research carried the exon 10/6 SS18-SSX1 fusion.
DFSP is a rare but low-grade malignant skin tumor with frequent local recurrence characterized by the fusion of the COL1A1 gene on chromosome 17 with the PDGFB gene on chromosome 22 (23). COL1A1 up-regulates the expression of platelet-derived growth factor receptor (PDGFR), which acts as an auto-growth or paracrine growth factor. Imatinib mesylate (Gleevec®) is an inhibitor of tyrosine kinases in the PDGFR pathway which has shown a dramatic response in treating patients with metastatic DFSP (24). Different COL1A1-PDGFB exon fusion patterns were identified in eight DFSP samples by NGS.
MLPS is composed of univacuolar and multivacuolar lipoblasts embedded in a richly myxoid ground substance, and approximately 30% of MLPS patients develop distant metastases (3). Most MLPS patients show a specific chromosomal translocation that results in the rearrangement of the FUS and DDIT3 genes to encode chimeric transcription factors (25,26). We identified one case each of FUS-DDIT3 exon 5/2 fusion, exon 7/2 fusion, or exon 8/2 fusion in three MLPS cases.
Analysis of method correlations and agreement
As shown in Table 2, all eight of the COL1A1-PDGFB FISH positive samples were also identified as COL1A1-PDGFB positive by NGS, showing a 100% concordance rate. In addition, NGS identified COL1A1-PDGFB fusion in two FISH negative samples, one ES, and one SS sample, suggesting it is more sensitive in detecting this variant. The results of NGS and FISH were also consistent in two SS samples with SS18-SSX1 exon 10/6 fusion (Figure 1) and one MLPS case with FUS-DDIT3 exon 5/2 fusion (Figure 2).
In the other STS samples that were not tested by FISH, Sanger sequencing and NGS were also consistent with detecting gene fusion subtypes. Interestingly, in two ASPS samples with the ASPSCR1-TFE3 exon 7/5 fusion, TFE3 was also positive for IHC detection, indicating an agreement between IHC, Sanger sequencing, and NGS (Figure 3).
Discussion
Based on molecular cytogenetic analysis, STS can be divided into two categories: (I) STS with translocations leading to oncogenic fusion transcripts such as EWSR1-FLI1 in ES, FUS-DDT3 in MLPS, and SS18-SSX in SS; and (II) STS with specific oncogenic mutations, such as KIT and PDGFRA mutations in gastrointestinal stromal tumors (1). For this, traditional methods such as FISH, IHC, or Sanger sequencing may be the preferred method to detect a small number of known fusion genes due to the high cost of NGS. However, traditional methods for multi-target analysis of multiple samples may also be costly and time-consuming. The development of the new Ion AmpliSeqTM Custom Panels provides a potential solution to the current limitations. The massively parallel nature of NGS allows a rapid characterization of point mutations, small insertions and deletions. Additionally, NGS can detect chromosome rearrangements of a large set of genes by targeted sequencing of the fusion junctions or by paired-end mapping methods. To evaluate the genetic changes and fusion transcripts in STS, NGS based on poly-A(+) mRNA molecules can increase the capacity to detect gene fusions dramatically. The splicing of non-coding introns that occurs during RNA processing leads to smaller mRNA molecules of the fusion gene compared with the corresponding DNA, which can increase the coverage of the fusion sequence in NGS. Another advantage of NGS is that analysis at the transcript level not only provides information about potential gene fusion sequences, but also about expression variants. In this study, we used Ion AmpliSeqTM Custom panels (IAD187473 and WG_IAD 186692) for sensitive detection of gene fusions with the Ion PGMTM System. This system is integrated with Ion ReporterTM Software v5.0, which includes easy-to-use multi-sample visualization tools, push-button fusion data analysis and classification, and gene expression details. Although several reports have used NGS for molecular profiling of sarcomas (27,28), research on gene fusions in STS is still extremely limited to date. To the best of our knowledge, the application of Ion AmpliSeqTM Custom panels (IAD187473 and WG_IAD 186692) has never been reported and this is the first investigation using this approach to detect structural variants in clinical STS samples.
FISH and RT-PCR-based Sanger sequencing are currently used to detect gene fusion events. However, both these methods present limitations. For example, most FISH assays use break-apart probes to detect whether a certain donor gene has a translocation or rearrangement, but this strategy cannot determine the acceptor genes. Ideally, fusion probes can help determine the specific type of gene fusions. However, some STSs have multiple variant types, and some have a low frequency of fusion events. Using fusion probes to explore all types of gene fusion events would involve a high cost and is not suitable for routine clinical practice. RT-PCR-based Sanger sequencing can determine the specific fusion site by DNA sequencing. However, this approach shows problems of low throughput and the detection of only one fusion pattern at a time. More importantly, as these methods are only suitable for detecting specific pre-identified genetic variants and inevitably rely on previous diagnostic assumptions, they cannot meet the purpose of relying on genetic profiling to verify or even correct traditional clinical and pathological diagnosis. NGS is an approach that can overcome these limitations. By allowing the simultaneous analysis of multiple targets and increasing the sequencing depth to achieve ultra-sensitivity, it can not only detect common genetic abnormalities without prior assumptions but also identify uncommon or even new variants.
We compared the applicability of NGS for gene fusion detection with results from FISH and RT-PCR-based Sanger sequencing, and NGS showed superior results. In the 35 STS samples with qualified NGS results, all gene fusions (100%) that are highly specific for pathological diagnosis were accurately identified. NGS also detected three cases of COL1A1-PDGFB fusion, which showed negative results in FISH, and several COL1A1-PDGFB, SS-SSX, and FUS-DDIT3 fusions that were negative in Sanger sequencing. Small breaks and insertions that cannot be covered by the FISH probe sequences may also cause false negative results of COL1A1-PDGFB. The sensitivity of FISH can also be hampered by the low percentage of STS cells carrying the COL1A1-PDGFB variants. We also speculate that the low versatility of PCR primers and the low proportion of tumor cells containing target variants are the main reasons for the false positives of RT-PCR-based Sanger sequencing. For example, the SS18-SSX4 chimeric variant detected by NGS is a rare case, which is characterized by high breakpoint variability resulting in abnormal transcripts that cannot be detected by conventional methods (23,24). For the sample that was detected by DDIT3 break-apart probes but negative in Sanger sequencing, NGS successfully identified the FUS-DDIT3 exon 5/2 fusion (29).
In the current era of precision medicine, accurate molecular classification of STS can predict the extent to which patients will benefit from different targeted treatment strategies. Lucchesi et al. investigated the role of targeted NGS testing in 584 STS patients and showed that up to 41% of STSs harbored at least one clinically relevant genomic alteration with the potential to influence personalized therapy (30). In the present study, the effectiveness of NGS for detecting COL1A1-PDGFB has value beyond diagnosis. For patients with metastatic or unresectable DFSP, NGS findings also expand their chances of choosing imatinib as a targeted therapy (31,32). Genetically, DFSP is characterized in the vast majority of cases by fusion of the COL1A1-PDGFB gene, whereas COL1A1-PDGFB fusion was also detected in other subtypes of STSs in our study. The promoter and variable part of COL1A1 gene fused with exon 2 of PDGFB gene, resulting in dysregulation of PDGFB protein expression (33). At the chromosomal level, gene fusion is caused by the exchange of material between bands 17Q21 (COL1A1) and 22Q13 (PDGFB). This exchange may be balanced or unbalanced t(17; 22), and may also occur as one or more redundant circular chromosomes. As previously mentioned, COL1A1-PDGFB fusion is associated with classical translocation or one or more supernumerary ring chromosomes in an age-dependent manner (34). The timing and origin of the repair of translocations and other types of DNA double-strand errors are still not fully understood, but according to cytogenetic data, most tumor-associated translocations leading to pathogenic fusions are due to G0-G1 errors (35). Possibly, the COL1A1-PDGFB fusion is only sufficient to promote tumorigenesis in the pediatric setting, while most children and all adults require not only the gene fusion but also an extra copy of the distal 17q and/or /or a distorted ratio between genes centromeric and telomeric to the PDGFB locus on chromosome 22. Thus, different types of translocations may occur with equal frequency in all age groups, but only unbalanced translocations have a selective advantage in older patients (36). Several breakpoints have been described for EWSR1/FLI1 and EWSR1/ERG in STSs. The most common events are EWSR1 exon 7 and FLI1 exon 6 (defined as type I) or ERG exon 6, 7, and 9 (37). Interestingly, a rare pattern of EWSR1-ERG exon 7/10 fusion was identified by NGS. Lin et al. found that type 1 EWS-FLI1 fusion, which encodes a less active chimeric transcription factor, was associated with a significantly better prognosis than the other fusion types (38). However, more evidence is required to clarify how the EWSR1-ERG exon 7/10 fusion is correlated with patient prognosis. Another rare case that carried SS18-SSX1 and SS18-SSX4 fusion was detected by NGS but not by Sanger sequencing. Kawai et al. first described relationship between the SYT-SSX fusion transcript and the histologic subtype and clinical behaviors of SS (39). In addition, Saito et al. proposed that almost all biphasic SS harbors the SYT-SSX1 fusion gene (40). This gene is a potent oncogene that plays a key role in the pathogenesis of SS. Patients with SS have a poor prognosis (10-year survival rate: 10–30%) (41). Moreover, Ladanyi et al. found STS patients with SS18-SSX2 tumors had a better prognosis than those with SS18-SSX1 tumors (42). However, our sample size was too limited to draw the conclusion that patient carrying both SS18-SSX1 and SS18-SSX4 had a significantly different outcome. A recent report from the European Paediatric Soft Tissue Sarcoma Group (EpSSG) examined the results of fusion status in 103 patients with alveolar rhabdomyosarcoma (RMS) with N1 disease. Results showed that patients with a positive FOXO1 fusion gene had a poorer prognosis than patients with a negative fusion gene and affected 5-year event-free survival (EFS) in these patients (43%) (43). In addition, some molecular genetic markers for STSs have been reported. Greither et al. found low expression of piwi like RNA-mediated gene silencing 2 (PIWIL2) mRNA was significantly associated with poor prognosis (44). High MDM4S mRNA expression was associated with short treatment-free survival, and its overexpression was significantly associated with poor prognosis (45,46).
In conclusion, this study provides evidence for the diagnostic use of Ion AmpliSeqTM Custom panels (IAD187473 and WG_IAD 186692) to detect gene fusion in STS. We demonstrated the superior results of these panels in accuracy and sensitivity compared with traditional methods. NGS represents a promising clinical tool for STS diagnosis with additional advantages, including the acquisition of prognostic and therapeutic predictive information in a single assay.
Acknowledgments
We thank Shanghai Tongshu Biotechnology Co., Ltd. for technical support.
Funding: The work was supported by a grant from the Natural Science Foundation of Shanxi Province (No. 201901D211498) and the Youth Science foundation of Second Hospital of Shanxi Medical University (No. 201902-1).
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-22-70/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-22-70/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-22-70/coif). All authors report that the study received technical support from Shanghai Tongshu Biotechnology Co., Ltd. The authors have no other conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the ethics committees of the Second Hospital of Shanxi Medical University [(2021)YX No.019] and informed consent was taken from all the patients.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Bridge JA. The role of cytogenetics and molecular diagnostics in the diagnosis of soft-tissue tumors. Mod Pathol 2014;27:S80-97. [Crossref] [PubMed]
- Fletcher CDM, Bridge JA, Hogendoorn PCW, et al. editors. WHO Classification of tumours of soft tissue and bone. 4th edition. WHO, 2013.
- Pillozzi S, Bernini A, Palchetti I, et al. Soft Tissue Sarcoma: An Insight on Biomarkers at Molecular, Metabolic and Cellular Level. Cancers (Basel) 2021;13:3044. [Crossref] [PubMed]
- Peinado H, Zhang H, Matei IR, et al. Pre-metastatic niches: organ-specific homes for metastases. Nat Rev Cancer 2017;17:302-17. [Crossref] [PubMed]
- Helman LJ, Meltzer P. Mechanisms of sarcoma development. Nat Rev Cancer 2003;3:685-94. [Crossref] [PubMed]
- Taylor BS, Barretina J, Maki RG, et al. Advances in sarcoma genomics and new therapeutic targets. Nat Rev Cancer 2011;11:541-57. [Crossref] [PubMed]
- Drilon A, Laetsch TW, Kummar S, et al. Efficacy of Larotrectinib in TRK Fusion-Positive Cancers in Adults and Children. N Engl J Med 2018;378:731-9. [Crossref] [PubMed]
- Sorensen PH, Lynch JC, Qualman SJ, et al. PAX3-FKHR and PAX7-FKHR gene fusions are prognostic indicators in alveolar rhabdomyosarcoma: a report from the children's oncology group. J Clin Oncol 2002;20:2672-9. [Crossref] [PubMed]
- Debiec-Rychter M, Marynen P, Hagemeijer A, et al. ALK-ATIC fusion in urinary bladder inflammatory myofibroblastic tumor. Genes Chromosomes Cancer 2003;38:187-90. [Crossref] [PubMed]
- Chen ST, Lee JC. An inflammatory myofibroblastic tumor in liver with ALK and RANBP2 gene rearrangement: combination of distinct morphologic, immunohistochemical, and genetic features. Hum Pathol 2008;39:1854-8. [Crossref] [PubMed]
- Barthelmeß S, Geddert H, Boltze C, et al. Solitary fibrous tumors/hemangiopericytomas with different variants of the NAB2-STAT6 gene fusion are characterized by specific histomorphology and distinct clinicopathological features. Am J Pathol 2014;184:1209-18. [Crossref] [PubMed]
- Overman MJ, McDermott R, Leach JL, et al. Nivolumab in patients with metastatic DNA mismatch repair-deficient or microsatellite instability-high colorectal cancer (CheckMate 142): an open-label, multicentre, phase 2 study. Lancet Oncol 2017;18:1182-91. [Crossref] [PubMed]
- van Gestel YR, de Hingh IH, van Herk-Sukel MP, et al. Patterns of metachronous metastases after curative treatment of colorectal cancer. Cancer Epidemiol 2014;38:448-54. [Crossref] [PubMed]
- Willeke F, Mechtersheimer G, Schwarzbach M, et al. Detection of SYT-SSX1/2 fusion transcripts by reverse transcriptase-polymerase chain reaction (RT-PCR) is a valuable diagnostic tool in synovial sarcoma. Eur J Cancer 1998;34:2087-93. [Crossref] [PubMed]
- Barr FG, Qualman SJ, Macris MH, et al. Genetic heterogeneity in the alveolar rhabdomyosarcoma subset without typical gene fusions. Cancer Res 2002;62:4704-10. [PubMed]
- Liu J, Guzman MA, Pezanowski D, et al. FOXO1-FGFR1 fusion and amplification in a solid variant of alveolar rhabdomyosarcoma. Mod Pathol 2011;24:1327-35. [Crossref] [PubMed]
- Baldauf MC, Gerke JS, Orth MF, et al. Are EWSR1-NFATc2-positive sarcomas really Ewing sarcomas? Mod Pathol 2018;31:997-9. [Crossref] [PubMed]
- Panagopoulos I, Mertens F, Isaksson M, et al. Clinical impact of molecular and cytogenetic findings in synovial sarcoma. Genes Chromosomes Cancer 2001;31:362-72. [Crossref] [PubMed]
- Mosquera JM, Sboner A, Zhang L, et al. Recurrent NCOA2 gene rearrangements in congenital/infantile spindle cell rhabdomyosarcoma. Genes Chromosomes Cancer 2013;52:538-50. [Crossref] [PubMed]
- Dahlén A, Fletcher CD, Mertens F, et al. Activation of the GLI oncogene through fusion with the beta-actin gene (ACTB) in a group of distinctive pericytic neoplasms: pericytoma with t(7;12). Am J Pathol 2004;164:1645-53. [Crossref] [PubMed]
- Butrynski JE, D'Adamo DR, Hornick JL, et al. Crizotinib in ALK-rearranged inflammatory myofibroblastic tumor. N Engl J Med 2010;363:1727-33. [Crossref] [PubMed]
- Heinrich MC, Corless CL, Demetri GD, et al. Kinase mutations and imatinib response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol 2003;21:4342-9. [Crossref] [PubMed]
- Skytting B, Nilsson G, Brodin B, et al. A novel fusion gene, SYT-SSX4, in synovial sarcoma. J Natl Cancer Inst 1999;91:974-5. [Crossref] [PubMed]
- Brodin B, Haslam K, Yang K, et al. Cloning and characterization of spliced fusion transcript variants of synovial sarcoma: SYT/SSX4, SYT/SSX4v, and SYT/SSX2v. Possible regulatory role of the fusion gene product in wild type SYT expression. Gene 2001;268:173-82. [Crossref] [PubMed]
- Urbini M, Astolfi A, Pantaleo MA, et al. HSPA8 as a novel fusion partner of NR4A3 in extraskeletal myxoid chondrosarcoma. Genes Chromosomes Cancer 2017;56:582-6. [Crossref] [PubMed]
- Sunitsch S, Gilg MM, Kashofer K, et al. Detection of GNAS mutations in intramuscular / cellular myxomas as diagnostic tool in the classification of myxoid soft tissue tumors. Diagn Pathol 2018;13:52. [Crossref] [PubMed]
- Jour G, Scarborough JD, Jones RL, et al. Molecular profiling of soft tissue sarcomas using next-generation sequencing: a pilot study toward precision therapeutics. Hum Pathol 2014;45:1563-71. [Crossref] [PubMed]
- Groisberg R, Roszik J, Conley A, et al. The Role of Next-Generation Sequencing in Sarcomas: Evolution From Light Microscope to Molecular Microscope. Curr Oncol Rep 2017;19:78. [Crossref] [PubMed]
- Powers MP, Wang WL, Hernandez VS, et al. Detection of myxoid liposarcoma-associated FUS-DDIT3 rearrangement variants including a newly identified breakpoint using an optimized RT-PCR assay. Mod Pathol 2010;23:1307-15. [Crossref] [PubMed]
- Lucchesi C, Khalifa E, Laizet Y, et al. Targetable Alterations in Adult Patients With Soft-Tissue Sarcomas: Insights for Personalized Therapy. JAMA Oncol 2018;4:1398-404. [Crossref] [PubMed]
- Noujaim J, Thway K, Fisher C, et al. Dermatofibrosarcoma protuberans: from translocation to targeted therapy. Cancer Biol Med 2015;12:375-84. [PubMed]
- Labropoulos SV, Razis ED. Imatinib in the treatment of dermatofibrosarcoma protuberans. Biologics 2007;1:347-53. [PubMed]
- Simon MP, Pedeutour F, Sirvent N, et al. Deregulation of the platelet-derived growth factor B-chain gene via fusion with collagen gene COL1A1 in dermatofibrosarcoma protuberans and giant-cell fibroblastoma. Nat Genet 1997;15:95-8. [Crossref] [PubMed]
- Sirvent N, Maire G, Pedeutour F. Genetics of dermatofibrosarcoma protuberans family of tumors: from ring chromosomes to tyrosine kinase inhibitor treatment. Genes Chromosomes Cancer 2003;37:1-19. [Crossref] [PubMed]
- Biehs R, Steinlage M, Barton O, et al. DNA Double-Strand Break Resection Occurs during Non-homologous End Joining in G1 but Is Distinct from Resection during Homologous Recombination. Mol Cell 2017;65:671-684.e5. [Crossref] [PubMed]
- Köster J, Arbajian E, Viklund B, et al. Genomic and transcriptomic features of dermatofibrosarcoma protuberans: Unusual chromosomal origin of the COL1A1-PDGFB fusion gene and synergistic effects of amplified regions in tumor development. Cancer Genet 2020;241:34-41. [Crossref] [PubMed]
- Cantile M, Marra L, Franco R, et al. Molecular detection and targeting of EWSR1 fusion transcripts in soft tissue tumors. Med Oncol 2013;30:412. [Crossref] [PubMed]
- Lin PP, Brody RI, Hamelin AC, et al. Differential transactivation by alternative EWS-FLI1 fusion proteins correlates with clinical heterogeneity in Ewing's sarcoma. Cancer Res 1999;59:1428-32. [PubMed]
- Kawai A, Woodruff J, Healey JH, et al. SYT-SSX gene fusion as a determinant of morphology and prognosis in synovial sarcoma. N Engl J Med 1998;338:153-60. [Crossref] [PubMed]
- Saito T. The SYT-SSX fusion protein and histological epithelial differentiation in synovial sarcoma: relationship with extracellular matrix remodeling. Int J Clin Exp Pathol 2013;6:2272-9. [PubMed]
- Barham W, Frump AL, Sherrill TP, et al. Targeting the Wnt pathway in synovial sarcoma models. Cancer Discov 2013;3:1286-301. [Crossref] [PubMed]
- Ladanyi M, Antonescu CR, Leung DH, et al. Impact of SYT-SSX fusion type on the clinical behavior of synovial sarcoma: a multi-institutional retrospective study of 243 patients. Cancer Res 2002;62:135-40. [PubMed]
- Brennan B, Zanetti I, Orbach D, et al. Alveolar soft part sarcoma in children and adolescents: The European Paediatric Soft Tissue Sarcoma study group prospective trial (EpSSG NRSTS 2005). Pediatr Blood Cancer 2018; [Crossref] [PubMed]
- Greither T, Koser F, Kappler M, et al. Expression of human Piwi-like genes is associated with prognosis for soft tissue sarcoma patients. BMC Cancer 2012;12:272. [Crossref] [PubMed]
- Liu L, Fan L, Fang C, et al. S-MDM4 mRNA overexpression indicates a poor prognosis and marks a potential therapeutic target in chronic lymphocytic leukemia. Cancer Sci 2012;103:2056-63. [Crossref] [PubMed]
- Lenos K, Grawenda AM, Lodder K, et al. Alternate splicing of the p53 inhibitor HDMX offers a superior prognostic biomarker than p53 mutation in human cancer. Cancer Res 2012;72:4074-84. [Crossref] [PubMed]
(English Language Editor: B. Draper)

