This article has an erratum available at: http://dx.doi.org/10.21037/tcr-2024-2 the article has been update on 2024-07-12 at here.
miR-3614-3p suppresses cell aggressiveness of human breast cancer by targeting AKT3 and HDAC1 expression
Introduction
Breast cancer (BC) is one of the most common types of cancer and is the most prevalent aggressive malignancy in women. BC is treated with a combination of surgery, chemotherapy, radiation therapy, and hormone therapy (1-3). Despite technological advances in treatment, most patients with BC have a poor prognosis due to the high frequency of distant metastasis or tumor recurrence. Thus, it is necessary to further elucidate the molecular mechanisms involved in the process and development of BC, as many unanswered questions remain regarding effective targets of BC and the necessary development of effective BC therapies.
MicroRNAs (miRNAs) are endogenous non-coding RNAs, typically about 19–24 nucleotides (nt) in length, that regulate gene expression by binding to the 3'-UTR of many target mRNAs. In doing so, miRNAs induce the degradation of RNA and subsequently affect the transcription and translation of mRNA. Many studies have identified that miRNAs play an essential role in many biological processes, including cell invasion, proliferation, migration, and apoptosis. Due to their multifactorial processes, many miRNAs have also been identified in pathology development resulting from aberrant expressions, such as with several forms of cancer, including gastric cancer, hepatocellular carcinoma, leukemia, lung, and liver cancer, suggesting that they may function as either tumor oncogenes or suppressors (4-7).
miR-3614 is an intragenic miRNA located on chromosome 17, and its host gene is tripartite motif-containing 25 (TRIM25). Our previous investigation found that miR-3614-3p suppresses TRIM25 expression by binding to its 3'-UTR and that induced overexpression of miR-3614-3p inhibits the proliferation of BC cells via downregulation of TRIM25 (8). Notably, another study reported that miR-3614 suppresses inflammatory responses by knocking down the expression of tumor necrosis factor receptor-associated factor 6 (TRAF6) and targeting the TRAF6/MAPK/NF-κB pathways in coronary artery disease (CAD) epicardial adipose tissue (EAT) (9). Although no other studies have reported the role of miR-3614-3p in the pathology of BC, the -5p of this miR gene has been reported to be associated with colon cancer. From this reporting, miR-3614-5p was identified to suppress the proliferation of colon cancer cells through inhibition of the P53 pathway and p38MAPK pathway (10). However, other functional roles of miR-3614 in cancer development and pathology remain to be elucidated. Therefore, we investigated whether miR-3614 overexpression affects the motility of BC cells and whether this effect is achieved by regulating the expression of TRIM25. We present the following article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-21-2419/rc).
Methods
Cell culture
Three cell lines were utilized for this study and purchased from the Institute of Biochemistry and Cell Biology (Shanghai, China): MDA-MB-231, MCF-7, and 293T (HEK) cells. MDA-MB-231 and MCF-7 cells were grown in Falcon culture dishes with Dulbecco Modified Eagle medium (DMEM), which was supplemented with 1% antibiotics and 10% fetal bovine serum (FBS; all from Sigma-Aldrich; St. Louis, MO, USA) in a CO2-regulated incubator at 95% humidity and 5% CO2. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).
Plasmid construction
The miR-3614 expression vector (miR-3614) and the control vector were synthesized and cloned into pcDNATM6.2-GW/EmGFPmiR plasmids (Invitrogen; Carlsbad, CA, USA). The binding site of miR-3614 in the 3'-UTR of human AKT3 and HDAC1 mRNA was constructed and cloned between the XhoI and SacI sites of the pmirGLO dual-luciferase miRNA target expression vector (Promega; Madison WI, USA). We constructed pmirGLO-AKT3/HDAC1 wild-type (WT) and pmirGLO-AKT3/HDAC1 mutant-type (MUT), as described previously (8). Silent interfering RNAs (siRNAs), anti-miR-3614, and their respective negative control RNAs were purchased from Gima (Shanghai, China). The plasmid and miRNA sequences were as follows: miR-3614, GGUUCUGUCUUGGGCCACUUGGAUCUGAAGGCUGCCCCUUUGCUCUCUGGGGUAGCCUUCAGAUCUUGGUGUUUUGAAUUCUUACU, and inhibitor miR-3614-3p: AAAACACCAAGATCTGAAGGCTA. All plasmid and mRNA products were confirmed by sequencing.
Quantitative real-time PCR (qRT-PCR)
According to the manufacturer’s instructions, total cellular RNA was extracted using TRIzol reagent (Invitrogen). Real-time PCR was performed using the PrimeScript RT Reagent Kit and SYBR Premix Ex Taq II Kit (Takara, Tokyo, Japan) to detect the expression of mature miR-3614 and AKT3/HDAC1 mRNA, respectively. The relative amount of each miRNA was normalized to U6 small nuclear RNA (snRNA), whereas mRNA expression was normalized to β-actin. Relative expression levels were calculated using the 2−ΔΔCt method. Samples were run using an IQ5 Multicolor qRT-PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Forward and reverse primers were used as follows: AKT3, GCAGAGGCAAGAAGAGGAGA and ACTTGCCTTCTCTCGAACCA; HDAC1, CATCTCCTCAGCATTGGCTT and TATTATGGACAAGGCCACCC.
Western blot analysis
BC cells were harvested using RIPA lysis buffer (CST, Boston, MA, USA) 48 h after transfection. Equal amounts of protein lysates were separated by 10% SDS-PAGE and transferred onto a methanol-activated PVDF membrane (MilliporeSigma; Burlington, MA, USA). The membranes were incubated with the following primary antibodies: AKT3 (1:2,000; Abcam; Cambridge, UK) and HDAC1 (1:1,000, Abcam) overnight at 4 ℃. The membranes were incubated with a secondary antibody for 2 h at room temperature, followed by ECL reagent (Millipore, Boston, MA, USA) for chemiluminescence detection, as described previously (8).
Dual-luciferase reporter assay
The AKT3/HDAC1-WT or AKT3/HDAC1-MUT vector was cotransfected with pre‑miR-3614 plasmid or the corresponding control pcDNA6.2-GW into HEK293T cells using 96-well plates. Following a 24 h transfection period, cell lysates were collected and assayed using the luciferase activity assay. According to the manufacturer’s protocol, firefly and Renilla luciferase were measured using the Dual-Glo Luciferase Assay System (Promega).
Wound healing assay
To examine the effects of miR-3614 on the migration of BC cells, MCF-7 and MDA-MB-231 cells were plated in 6-well culture plates (1.0×106 cells). The cell monolayer was scraped using a P-10 micropipette tip (a line was scratched into the cell monolayer), and the suspension cells were removed following a PBS wash. Subsequently, the cells were transfected with 20 pmol of negative controls, miR-3614 or anti-miR-3614, and further incubated for 48 h. Cells were further incubated following the transfection process to allow cell migration in the reduced serum DMEM media. At 0, 24, and 48 h, three fields of the wound area were imaged with a phase-contrast microscope.
Transwell migration assay
The migration assay was performed using a transwell chamber (MilliporeSigma). After the cells were transfected with 20 pmol of negative controls, miR-3614 or anti-miR-3614, the BC cells were seeded into the upper chambers with serum-free medium (1.0×104 cells), and the lower chambers contained DMEM with 10% FBS. After incubation for 24 h, the cells were fixed and stained with crystal violet. Migrated MCF-7 and MDA-MB-231 cells were manually counted under an inverted light microscope.
Statistical analysis
The results are presented as the mean ± SEM of at least three independent experiments. Significance was established using SPSS software (version 22.0; IBM, San Francisco, CA, USA). Student’s t-test and ANOVA were used if the quantitative data between groups showed a normal distribution. If not consistent with normal distribution, the Wilcoxon-Mann-Whitney test was used. Differences were considered statistically significant at P<0.05.
Results
Overexpression of miR-3614-3p inhibits migration and invasion of BC cells
To explore the biological significance of miR-3614-3p in BC, MCF-7 and MDA-MB-231 cells were transfected with miR-3614 plasmid to overexpress miR-3614-3p. Additionally, miR-3614-3p was significantly downregulated by the miR-3614-3p inhibitor. The transfection efficacy was tested by qRT-PCR (P<0.01, Figure 1A). As shown in Figure 1B, wound healing assays revealed that overexpression of miR-3614-3p required a longer time to heal than that of control cells. In addition, the transwell migration assay showed that overexpression of miR-3614-3p dramatically inhibited MCF-7 and MDA-MB-231 cell migration compared to control cells (Figure 1C). In contrast, BC cells derived from the miR-3614-3p inhibitor displayed a higher migration ability than the control cells. Collectively, these results demonstrate that miR-3614-3p can manipulate the aggressiveness of BC cells.
Effects of TRIM25 siRNA on BC cell metastasis
Our previous study demonstrated that miR-3614-3p could inhibit BC cell proliferation by targeting TRIM25 (8). Here, we expand on these studies and use MCF-7 and MDA-MB-231 cells to investigate whether TRIM25 siRNA can influence tumor cell metastasis, cell migration, and invasive capability. Importantly, siTRIM25-transfected cells had similar wound healing rates as the control scrambled-transfected cells (Figure 2A, P>0.05); however, compared with control groups, BC cell migration was reduced following transfection with TRIM25 siRNA (Figure 2B, P<0.05). These data suggest that TRIM25 has no significant effect on the metastasis of BC cells, and there might be other target genes that influence BC cell metastasis.
The mechanism of miRNA-3614-3p self-silence
In addition, we hypothesized that mature miR-3614-3p is cleaved by the Dicer complex and binds to pri-miR-3614, thereby silencing itself through this mechanism. To test this hypothesis, we cloned pri-miR-3614 fragments into the pmiRGLO vector and generated the respective mutants (Figure 3A). As expected, the relative luciferase activity was significantly decreased when miR-3614 and pri-miR-3614-pmiRGLO vectors were co-transfected into HEK293T cells, compared with cells transfected with the control pmiRGLO vector. However, we found that the mutation in pri-miR-3614 did not affect the relative luciferase activity. In contrast, transfection with the miR-3614-3p inhibitor enhanced the luciferase activity (Figure 3B). Collectively, these results suggest that miR-3614-3p can silence itself.
AKT3 and HDAC1 are direct targets of miR-3614-3p
To elucidate the molecular mechanism by which miR-3614-3p exerts its inhibitory effect on BC cells, we searched for miR-3614-3p target genes using the prediction program TargetScan and found miR-3614-3p binding sites in the UTR of AKT3 and HDAC1 3 (Figure 4A). To validate the hypothesis that miR-3614-3p targets AKT3 and HDAC1, a dual-luciferase reporter system containing AKT3 and HDAC1 3 UTR-WT/MUT was used, alongside miR-3614-3p and reporter plasmid or pmirGLO control vectors that were co-transfected into HEK293T cells. As illustrated in Figure 4B, miR-3614-3p reduced the firefly luciferase activity of AKT3 and HDAC1-WT at 24 h compared to the MUT-type and control cells. To confirm whether the loss of miR-3614-3p is a contributing factor in BC malignancy by upregulating AKT3 and HDAC1 expression, we performed qRT-PCR and western blot analysis. We found that overexpression of miR-3614-3p dramatically decreased the mRNA and protein levels of AKT3 and HDAC1 (Figure 4C). Moreover, we found that AKT3 and HDAC1 levels were higher in BC tissues than in normal tissue controls from the The Cancer Genome Atlas (TCGA) database (P<0.001). Similar results were observed for AKT3 and HDAC1 mRNA and protein overexpression in MCF-7 and MDA-MB-231 cell lines, in which miR-3614-3p was downregulated (Figure 4D). Taken together, the above data indicate that miR-3614-3p directly regulates AKT3 and HDAC1 expression in MCF-7 and MDA-MB-231 cells.
Silencing of AKT3 and HDAC1 reduced BC cells invasiveness
To further validate that miR-3614-3p suppressed BC cell migration by regulating AKT3 and HDAC1, we inhibited AKT3 and HDAC1 mRNA and protein expression by siRNA knockdown (Figure 5A). Moreover, silencing AKT3 and HDAC1 resulted in the suppression of cell wound healing and migration ability (Figure 5B,5C), which followed the same trend as miR-3614-3p in MCF-7 and MDA-MB-231 cells. Based on these findings, AKT3 and HDAC1 are essential and appear to serve as functional downstream mediators of miR-3614-3p in BC.
Discussion
Cancer is still predominantly determined by identified alterations in tumor suppressor genes and oncogenes. From our growing knowledge on cancer development and regulation, we understand that these gene expressions can be regulated by miRNAs (11-13). Therefore, researchers focus on addressing two main questions: “How do miRNAs regulate oncogenes and/or tumor suppressor genes?” and “Which miRNAs regulate other mechanisms in cancer cells?” (14). Li et al. (15) proposed that phosphoglycerate Mutase 1 (PGAM1), regulated by miR-3614-5p, functions as an oncogene by activating transforming growth factor-β (TGF-β) signaling in the progression of non-small cell lung carcinoma. In addition, Huang et al. (9) showed that miRNA-3614 regulates inflammatory response via targeting TRAF6-mediated MAPKs and NF-κB signaling in the EAT with CAD. Our previous study showed that miR-3614-3p was downregulated in BC tumors compared to normal tissues. Moreover, miR-3614-3p expression was reduced in MCF-7 and MDA-MB-231 cell lines compared to HBL-100 epithelial cell lines. In the current study, miR‐3614‐3p reduced cancer cell invasion and migration abilities. However, the inhibition of invasion and migration was more significant in invasive BC cells (MDA‐MB‐231) than in non-invasive BC cells (MCF‐7) when assessing via transwell matrigel and wound healing assays.
In contrast, anti-miR-3614-3p oligonucleotides were used for our loss-of-function studies to silence the expression of miR-3614-3p. Utilizing this inhibitory effect revealed a significant contribution to the tumorigenicity of MCF-7 and MDA-MB-231 cells. Therefore, these data suggest that miR-3614-3p functions as a tumor suppressor for cell aggressiveness in BC. To this end, added validation using in vivo assays is needed for further research.
Additionally, the identification of downstream functional targets is necessary to elucidate the respective biological effects and better comprehend their physiological activity. In our previous study, we found that the overexpression of miR-3614-3p dramatically inhibited BC cell growth through the downregulation of TRIM25. However, in this study, we report that TRIM25 downregulation had no significant effect on the metastasis of BC cells, likely suggesting the possibility of other target genes that are responsible for BC cell metastasis. Using TargetScan, an online prediction software, AKT3 and HDAC1 were identified as potential target genes of miR-3614-3p, in which AKT, also known as PKB, is vital for maintaining normal cellular function. Concerning its potential role in cancer, previous studies have identified a correlation between tumor development and AKT3 expression (16-20). Wang et al. (21) verified that miR-384 could significantly suppress the proliferation of colorectal cancer by targeting AKT3, and that miRNA-433 targets AKT3, thereby inducing the inhibition of cell proliferation and viability in BC (22). In support of these findings, Rui Li and Ying Ma also found that miR-29a and miR-144 can suppress growth and metastasis in papillary thyroid carcinoma and hepatocellular carcinoma by targeting AKT3 (23).
Histone deacetylases (HDACs) are posttranslational modifiers that deacetylate proteins. Although necessary for vital DNA transcription processes and other metabolic responses, numerous investigations have demonstrated that HDAC1 can also be involved in tumor progression (24-29). For example, miR-34a regulates HDAC1 expression and affects the proliferation and apoptosis of hepatocellular carcinoma cells. Likewise, miR-761 has been found to inhibit colorectal cancer cell proliferation and invasion by targeting HDAC1 (30). He and colleagues also revealed that HDAC1 promotes migration and invasion by binding with TCF12 and promoting epithelial-to-mesenchymal transition (EMT) progression in gallbladder cancer. Moreover, Liu et al. found that the upregulation of HDAC1 is a crucial event in developing drug resistance to current treatments in ovarian cancer. Thus, targeting HDAC1 by enhancing c-Myc-dependent miR-34a expression may be an effective strategy for increasing the efficacy of cisplatin treatment (31,32).
To our knowledge, our study is the first to describe that miR-3614-3p directly represses AKT3 and HDAC1 expression in BC. From our study, we identified that AKT3 and HDAC1 were overexpressed in BC tissues and cell lines. Furthermore, AKT3 and HDAC1 are direct downstream targets of miR-3614-3p, and upregulation of miR-3614-3p significantly reduced the expression of AKT3/HDAC1, thereby decreasing the luciferase reporter activity of AKT3/HDAC1 WT 3-UTR but not MUT 3-UTR. In addition, we showed that silencing AKT3 and HDAC1 resulted in the suppression of cell wound healing and migration. Importantly, our previous study showed that TRIM25 is not only a host gene but also a target gene of miR-3614-3p in BC. This study found that miR-3614-3p significantly binds to pri-miR-3614 at the 3'-UTR of TRIM25, suggesting that miR-3614-3p could silence itself. Collectively, these data provide sufficient evidence to support that miR-3614-3p exerts a suppressive effect on BC cells, at least in part, by inhibiting AKT3 and HDAC1 expression.
Conclusions
In summary, our results revealed that miR‐3614‐3p inhibited the migration and invasion capabilities of MCF-7 and MDA-MB-231 cells by targeting AKT3 and HDAC1 expression. Thus, we suggest that miR‐3614‐3p might be an effective biomarker for targeted BC therapies, especially when targeting the invasive form of this disease.
Acknowledgments
The authors thank AiMi Academic Services (https://www.aimieditor.com) for the English language editing and review services.
Funding: This work was supported by the National Natural Science Foundation of China (No. 82002875 to ZW), Projects of International Cooperation and Exchanges Natural Science Foundation of Shaanxi Province of China (No. 2017KW-059 to YC), Scientific Research and Sharing Platform Construction Project of Shaanxi Province (No. 2018PT-09 to YC), and the Open Project of Key Laboratory of Shaanxi Province for Craniofacial Precision Medicine Research, College of Stomatology, Xi’an Jiaotong University (No. 2019LHM-KFKT001).
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-21-2419/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-21-2419/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-21-2419/prf
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-21-2419/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Castaneda SA, Strasser J. Updates in the Treatment of Breast Cancer with Radiotherapy. Surg Oncol Clin N Am 2017;26:371-82. [Crossref] [PubMed]
- Lee SJ, Jeong JH, Lee J, et al. MicroRNA-496 inhibits triple negative breast cancer cell proliferation by targeting Del-1. Medicine (Baltimore) 2021;100:e25270. [Crossref] [PubMed]
- Gooding AJ, Schiemann WP. Epithelial-Mesenchymal Transition Programs and Cancer Stem Cell Phenotypes: Mediators of Breast Cancer Therapy Resistance. Mol Cancer Res 2020;18:1257-70. [Crossref] [PubMed]
- Guo B, Zhao Z, Wang Z, et al. MicroRNA-302b-3p Suppresses Cell Proliferation Through AKT Pathway by Targeting IGF-1R in Human Gastric Cancer. Cell Physiol Biochem 2017;42:1701-11. [Crossref] [PubMed]
- Liu Z, Dou C, Yao B, et al. Methylation-mediated repression of microRNA-129-2 suppresses cell aggressiveness by inhibiting high mobility group box 1 in human hepatocellular carcinoma. Oncotarget 2016;7:36909-23. [Crossref] [PubMed]
- Li J, Yu J, Zhang H, et al. Exosomes-Derived MiR-302b Suppresses Lung Cancer Cell Proliferation and Migration via TGFβRII Inhibition. Cell Physiol Biochem 2016;38:1715-26. [Crossref] [PubMed]
- Lee SJ, Jeong JH, Kang SH, et al. MicroRNA-137 Inhibits Cancer Progression by Targeting Del-1 in Triple-Negative Breast Cancer Cells. Int J Mol Sci 2019;20:6162. [Crossref] [PubMed]
- Wang Z, Tong D, Han C, et al. Blockade of miR-3614 maturation by IGF2BP3 increases TRIM25 expression and promotes breast cancer cell proliferation. EBioMedicine 2019;41:357-69. [Crossref] [PubMed]
- Huang W, Wu X, Xue Y, et al. MicroRNA-3614 regulates inflammatory response via targeting TRAF6-mediated MAPKs and NF-κB signaling in the epicardial adipose tissue with coronary artery disease. Int J Cardiol 2021;324:152-64. [Crossref] [PubMed]
- Han L, Sun Y, Lu C, et al. MiR-3614-5p Is a Potential Novel Biomarker for Colorectal Cancer. Front Genet 2021;12:666833. [Crossref] [PubMed]
- Sun Z, Shi K, Yang S, et al. Effect of exosomal miRNA on cancer biology and clinical applications. Mol Cancer 2018;17:147. [Crossref] [PubMed]
- Martinez-Gutierrez AD, Cantú de León D, Millan-Catalan O, et al. Identification of miRNA Master Regulators in Breast Cancer. Cells 2020;9:1610. [Crossref] [PubMed]
- Ferragut Cardoso AP, Udoh KT, States JC. Arsenic-induced changes in miRNA expression in cancer and other diseases. Toxicol Appl Pharmacol 2020;409:115306. [Crossref] [PubMed]
- Uzuner E, Ulu GT, Gürler SB, et al. The Role of MiRNA in Cancer: Pathogenesis, Diagnosis, and Treatment. Methods Mol Biol 2022;2257:375-422. [Crossref] [PubMed]
- Li F, Yang H, Kong T, et al. PGAM1, regulated by miR-3614-5p, functions as an oncogene by activating transforming growth factor-β (TGF-β) signaling in the progression of non-small cell lung carcinoma. Cell Death Dis 2020;11:710. [Crossref] [PubMed]
- Liu W, Zhou Z, Zhang Q, et al. Overexpression of miR-1258 inhibits cell proliferation by targeting AKT3 in osteosarcoma. Biochem Biophys Res Commun 2019;510:479-86. [Crossref] [PubMed]
- Ruan L, Qian X. MiR-16-5p inhibits breast cancer by reducing AKT3 to restrain NF-κB pathway. Biosci Rep 2019;39:BSR20191611. [Crossref] [PubMed]
- Xue D, Wang H, Chen Y, et al. Circ-AKT3 inhibits clear cell renal cell carcinoma metastasis via altering miR-296-3p/E-cadherin signals. Mol Cancer 2019;18:151. [Crossref] [PubMed]
- Buikhuisen JY, Gomez Barila PM, Torang A, et al. AKT3 Expression in Mesenchymal Colorectal Cancer Cells Drives Growth and Is Associated with Epithelial-Mesenchymal Transition. Cancers (Basel) 2021;13:801. [Crossref] [PubMed]
- Zang HL, Ji FJ, Ju HY, et al. Circular RNA AKT3 governs malignant behaviors of esophageal cancer cells by sponging miR-17-5p. World J Gastroenterol 2021;27:240-54. [Crossref] [PubMed]
- Wang YX, Zhu HF, Zhang ZY, et al. MiR-384 inhibits the proliferation of colorectal cancer by targeting AKT3. Cancer Cell Int 2018;18:124. [Crossref] [PubMed]
- Hu X, Wang J, He W, et al. MicroRNA-433 targets AKT3 and inhibits cell proliferation and viability in breast cancer. Oncol Lett 2018;15:3998-4004. [Crossref] [PubMed]
- Li R, Liu J, Li Q, et al. miR-29a suppresses growth and metastasis in papillary thyroid carcinoma by targeting AKT3. Tumour Biol 2016;37:3987-96. [Crossref] [PubMed]
- Zhao Q, Li S, Li N, et al. miR-34a Targets HDAC1-Regulated H3K9 Acetylation on Lipid Accumulation Induced by Homocysteine in Foam Cells. J Cell Biochem 2017;118:4617-27. [Crossref] [PubMed]
- Lv T, Song K, Zhang L, et al. miRNA-34a decreases ovarian cancer cell proliferation and chemoresistance by targeting HDAC1. Biochem Cell Biol 2018;96:663-71. [Crossref] [PubMed]
- Xiong W, Yang S, Zhang W, et al. MiR-761 inhibits colorectal cancer cell proliferation and invasion through targeting HDAC1. Pharmazie 2019;74:111-4. [PubMed]
- Yu Z, Zeng J, Liu H, et al. Role of HDAC1 in the progression of gastric cancer and the correlation with lncRNAs. Oncol Lett 2019;17:3296-304. [Crossref] [PubMed]
- Shin MW, Kim SL, Yang HC, et al. The HDAC1 Inhibitor CBUD-1001 Enhances TRAIL-induced Apoptosis in Colorectal Cancer Cells. Anticancer Res 2021;41:4353-64. [Crossref] [PubMed]
- Zhang Y, Nalawansha DA, Herath KE, et al. Differential profiles of HDAC1 substrates and associated proteins in breast cancer cells revealed by trapping. Mol Omics 2021;17:544-53. [Crossref] [PubMed]
- Sun TY, Xie HJ, Li Z, et al. miR-34a regulates HDAC1 expression to affect the proliferation and apoptosis of hepatocellular carcinoma. Am J Transl Res 2017;9:103-14. [PubMed]
- He J, Shen S, Lu W, et al. HDAC1 promoted migration and invasion binding with TCF12 by promoting EMT progress in gallbladder cancer. Oncotarget 2016;7:32754-64. [Crossref] [PubMed]
- Liu X, Yu Y, Zhang J, et al. HDAC1 Silencing in Ovarian Cancer Enhances the Chemotherapy Response. Cell Physiol Biochem 2018;48:1505-18. [Crossref] [PubMed]

