N⁶-methyladenosine reader IGF2BP3 as a prognostic Biomarker contribute to malignant progression of glioma

Introduction

Glioma is one of the most common primary adult brain tumors, and accounts for >70% of all brain malignancies, among which glioblastoma (GBM) has the highest malignant potential (1). The prognosis of GBM patients is extremely poor (2). Various treatments are available for GBM; however, the median survival time of affected patients is only about 14.6 months (3). The poor prognosis of GBM patients may be due to the highly heterogeneous nature of GBM and the undefined molecular mechanisms underpinning tumorigenesis and tumor development (4). Our understanding of the biological characteristics of GBM is increasing, and new therapeutic targets have been gradually discovered. However, diverse molecular features of GBM are major obstacles to accurately predicting survival and evaluating the efficacy of chemotherapy or radiotherapy.

Recent research has shown that RNA modifications, especially N⁶-methyladenosine (m⁶A) modifications, are closely associated with malignant progression in cancer (5). RNA m⁶A modification proteins regulate tumorigenesis, tumor development, metastasis, and cancer cell sensitivity to anti-tumor treatments (6,7). Targeting m⁶A modification regulators might be a potential and promising therapeutic strategy for cancer treatment. The m⁶A modification is reversible and dynamic, and methyltransferases (writers), demethylases (erasers), and binding proteins (readers) regulate m6A methylation (8). Moreover, the fate of m⁶A-modified messenger RNAs (mRNAs) depends on m⁶A readers. Currently, little is known about the effect of m⁶A reader proteins on glioma progression.

A previous study found that m⁶A reader insulin growth factor-2 binding protein 3 (IGF2BP3) expression is associated with patient survival (9); however, the associated mechanism remains unclear. IGF2BP3 has also been reported to exhibit oncogenic effects as an RNA-binding protein (RBP) in several tumor types. It plays important role in cancer metabolism, immunity, angiogenesis, stemness, and differentiation. The present study analyzed IGF2BP3 expression in gliomas of diverse grades, determined the effects of IGF2BP3 on the biological functions of the glioma cells, and explored the mechanism regulating the biological functions of gliomas. We present the following article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-449/rc).

Methods

Public data sets and bioinformatics analysis

To analyze gene expression alterations in glioma, RNA-sequencing data were downloaded from The Cancer Genome Atlas (TCGA) (https://portal.gdc.cancer.gov/). The expression differences between low-grade gliomas (LGGs) and high-grade gliomas (HGGs), and among the 19 m⁶A-related genes were then analyzed. Based on the survival analysis cut-off values, the patients were divided into the low- and high-IGF2BP3 groups. Survival package was used to test the proportional risk hypothesis and fitted survival regression. The results were visualized using survminer package and ggplot2 package. The limma R package was used to analyze differential gene expression, with a |log₂fold change (FC)| >1 and an adjusted P<0.05 indicating differential mRNA expression. DAVID was applied to determine the Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, and Cytoscape was used for visualization. The hub genes were assessed by the Matthews correlation coefficient (MCC) method and identified by the Cytoscape plugin cytoHubba.

Patients and tissue samples

In total, 40 patients with glioma who underwent neurosurgery at The Second Affiliated Hospital of Soochow University were selected and divided into the LGG group [World Health Organization (WHO) grade I–II] and the HGG group (WHO grade III–IV). The patients had a mean age of 58 years and had not been treated with radiation therapy or chemotherapy before surgery. Immunohistochemistry (IHC) analyses were performed on the tumor paraffin sections. Each patient signed the informed consent form. The current study was approved by the Ethics Committee of The Second Affiliated Hospital of Soochow University (No. JD-HG-2022-52). The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).

IHC

For the IHC analyses, formalin-fixed paraffin-embedded sections underwent xylene deparaffinization and hydration, followed by subsequent antigen retrieval by microwave-heating in sodium citrate buffer. After incubation overnight with the primary antibodies IGF2BP3 and Ki-67 (Abcam, UK; ab179807), the slides were then incubated with anti-rabbit horseradish peroxidase-linked secondary antibodies (Invitrogen, USA; C31460100). The samples were then incubated with 3,3-diaminobenzidine and counterstained with hematoxylin and then examined under a microscope in a blinded manner by two pathologists.

Cell culture and transfection

The human glioma U87 and U251 cells were provided by the National Collection of Authenticated Cell Cultures (China). The short-hairpin RNAs (shRNAs) for human IGF2BP3 (sh1-sequence, CGGTGAATGAACTTCAGAATT; sh2-sequence, GCAGTTGTAAATGTAACCTAT) were synthesized by Genechem (China) and packaged into pLKO.1 (lentiviral vector) to generate pLKO.1-shIGF2BP3 silencing constructs, with the empty vector serving as the negative control (NC). Puromycin was used to select the cells with stable transduction, and transduction efficiency was reflected by green fluorescent protein expression. The transfection was performed as directed by the manufacturer. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and immunoblot were conducted to confirm the knockdown of IGF2BP3.

QRT-PCR

The total RNA was extracted by TRIzol reagent (Invitrogen) and was then reverse transcribed into complementary DNA using the PrimeScript^TM RT reagent kit (Takara, Japan). The expression of mRNA was detected by the SYBR Premix Ex Taq^TM kit (Takara), using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for normalization. The sequences of the primers were as follows (5' to 3'): IGF2BP3, forward TCACTTCTATGCTTGCCAGGTTGC and reverse CCTTCTGTTGTTGGTGCTGCTTTAC; GAPDH, forward TGACATCAAGAAGGTGGTGAAGCAG and reverse GTGTCGCTGTTGAAGTCAGAGGAG.

Immunoblot

Radioimmunoprecipitation assay buffer (Beyotime, China) was used to extract the total protein from the glioma cells. After protein quantitation, the protein samples were resolved by 10% sodium dodecyl-sulfate polyacrylamide gel electrophoresis, and then electro-transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, USA). Next, the PVDF membranes were blocked with Tris-buffered saline containing 5% non-fat milk powder at room temperature for 1 h and then incubated overnight with anti-IGF2BP3 (ProteinTech Group, China; 14642-1-AP), anti-cyclin-dependent kinase 1 (anti-CDK1) (ProteinTech Group; 10762-1-AP), and anti-actin (ProteinTech Group; 66009-1-Ig), respectively. Next, secondary antibodies were added at ambient temperature for 1 h and, immunoblots were detected on an imaging system (BioRad, USA).

Cell Counting Kit-8 (CCK-8) assays

Cell viability was measured using the CCK-8 (Dojindo, Japan) in accordance with the manufacturer’s instructions. In brief, 2×10³ cells were seeded into 96-well plates and incubated for 0, 24, 48, 72, and 96 h. The optical density values were measured at 450 nm after incubation with CCK-8 solution for 1 h.

Clone formation assays

The cells were incubated at 500 cells per 6-well plate at 37 ℃ for 14 days. After washing with phosphate-buffered saline (PBS), fixation was carried out with 2% paraformaldehyde, followed by crystal violet staining and imaging to record the number of generated cell clones. The clone formation rate was calculated as follows: clone formation rate (%) = the number of clones/500×100.

Transwell assays

A 24-well transwell system (Corning, USA) was used to assess cell invasion and migration. Approximately 2×10⁴ cells were seeded into the superior compartment, with 850 µL of Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) in the lower compartment. After being incubated at 37 ℃ with 5% carbon dioxide for 24 h, the cells was fixed with 2% paraformaldehyde and stained with crystal violet. After wiping the cells in the above chamber with a cotton swab, the cells remaining in the lower chamber were counted.

Wound-healing assays

A total of 10⁶ cells were planted in low-serum medium (DMEM with 1% FBS). At 90–100% confluency, a line was generated with a 200-µL pipet tip, and the cells were then washed with PBS. The cells were then further incubated in serum-free medium for 24 h. The scratch areas were imaged and compared under a microscope.

Subcutaneous nude mouse xenograft model

The 5-week-old female Balb/c-nu mice from Vital River (China) were randomly allocated to the U87-NC and U87-shIGF2BP3 groups (n=5 per group, according to the minimum number of samples required to achieve biological statistical significance; the body weight of mice: 14.70±0.24 g. Next, 10⁶ U87-NC or U87-shIGF2BP3 cells were injected subcutaneously into the right axilla of each nude mouse. After feeding at our facility for 21 days (on a 12-h light/dark cycle, with free access to drink and food), the mice were anesthetized with isoflurane and sacrificed by cervical dislocation. The subcutaneously transplanted tumor was obtained, weighed, and photographed for analysis. The maximum volume of each subcutaneously transplanted tumor volume was not more than 1,000 mm³. Next, the tumors were prepared as paraffin sections. The experiments involving animals were approved by the Animal Ethics Committee of Soochow University (No. 20210708A02), all animal work was conducted in compliance with national guidelines for care and human use of animals. A protocol was prepared without registration before the study.

Cell cycle analysis

After being added to 75% ice-cold ethanol, 2×10⁵ cells were incubated at 4 ℃ overnight. Next, 1 mL of DNA staining solution and 10 µL of permeabilization solution (BD, USA) were added to the samples, which were then analyzed by flow cytometry.

Statistical analysis

The assays were carried out 3 times, and the data analysis was conducted using GraphPad Prism 9.0.0. The data are presented as the mean ± standard deviation and were compared using the t-test. A P value <0.05 indicated statistical significance.

Results

IGF2BP3 was the most significantly altered m⁶A-related gene

An analysis of the differences in gene expression between the LGGs and HGGs in TCGA data identified 6,595 differentially expressed genes (DEGs) with a (|log₂FC| >1 and an adjusted P value <0.05) (Figure 1A). In addition, an analysis of the expression differences in the 19 m⁶A-associated genes in glioma revealed that IGF2BP3 was the most significantly altered m⁶A-related gene (Figure 1B). In a subsequent analysis, we found that patients with high IGF2BP3 expression had a significantly reduced survival probability (P<0.001) compared to those with low IGF2BP3 expression (Figure 1C).

Figure 1 Expression of m6A-related genes in gliomas. (A) By analyzing the gene expression differences of LGGs and HGGs in TCGA, a total of 6,595 DEGs were identified (|log2FC| >1, adjusted P<0.05). (B) The expression differences of the 19 m⁶A-related genes in gliomas were analyzed, and IGF2BP3 was the most significantly altered m⁶A-related gene. (C) Survival probability was analyzed in terms of the high (red) or low (blue) expression of IGF2BP3 in TCGA data set. IGF2BP3, insulin growth factor-2 binding protein 3; FC, fold change; m⁶A, N⁶-methyladenosine; LGGs, low-grade gliomas; HGGs, high-grade gliomas; TCGA, The Cancer Genome Atlas; DEGs, differentially expressed genes.

IGF2BP3 expression level was correlated with glioma grade

The clinicopathological data of 40 patients with glioma (20 low-grade and 20 high-grade cases) were analyzed retrospectively. IHC staining of the paired peritumoral and tumor tissue samples showed that IGF2BP3 expression was very low in the peritumoral tissues (Figure 2A). Compared to the LGG tissues (Figure 2B), IGF2BP3 was significantly upregulated in the GBM specimens (Figure 2C). The IHC statistical analysis results are shown in Figure 2D.

Figure 2 The expression of IGF2BP3 was associated with the histological malignancy of human gliomas. (A) A representative IHC image showing very low IGF2BP3 expression in PT tissues. (B) A representative IHC image showing low IGF2BP3 expression in LGG. (C) A representative IHC image showing very high IGF2BP3 expression in GBM tissues. (D) The expression levels of the IGF2BP3 proteins in each sample. *, P<0.05; **, P<0.01; ***, P<0.001. Magnification ×200; scale bar =20 µm. PT, peritumoral tissues; LGG, low-grade glioma; GBM, glioblastoma; AOD, average optical density; IHC, immunohistochemistry; IGF2BP3, insulin growth factor-2 binding protein 3.

IGF2BP3 silencing inhibited glioma proliferation in vitro

To assess the effect of IGF2BP3 on glioma cell proliferation, the U87 and U251 cells were transfected with IGF2BP3 shRNAs. Both the shRNAs (sh1/2) significantly decreased the IGF2BP3 mRNA and protein levels (Figure 3A). CCK-8 assays were used to examine the effect of IGF2BP3 on glioma cell proliferation. In this study, IGF2BP3 silencing significantly inhibited cell proliferation in comparison to the control cells (Figure 3B). In addition, IGF2BP3 silencing reduced the colony formation ability of the U87 and U251 cells (Figure 3C). Thus, IGF2BP3 knockdown repressed glioma cell proliferation.

Figure 3 Downregulation of IGF2BP3 suppressed the proliferation ability of the glioma cells. (A) Knockdown of IGF2BP3 in the U87 and U251 cells was confirmed by qRT-PCR and western blot analysis. (B) CCK-8 assays were performed to determine cell growth after IGF2BP3 was knocked down in the U87 and U251 cells. (C) IGF2BP3 knockdown inhibited the clone formation ability of the U87 and U251 cells (clone formation assay was measured by crystal violet staining assay). *, P<0.05; **, P<0.01; ***, P<0.001. IGF2BP3, insulin growth factor-2 binding protein 3; qPCR, quantitative polymerase chain reaction; NC, negative control; sh, short-hairpin; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction; CCK-8, Cell Counting Kit-8.

IGF2BP3 knockdown significantly repressed glioma cell invasion and migration in vitro

Wound-healing assays were performed to determine the effect of IGF2BP3 on glioma cell migration. As Figure 4A shows, IGF2BP3 silencing significantly reduced the gap closure rate in the GBM cells. In addition, the transwell migration assays showed IGF2BP3 silencing significantly decreased the migratory (Figure 4B) and invasive (Figure 4C) abilities of the glioma cells. These findings suggested that IGF2BP3 was associated with glioma migration and invasion.

Figure 4 IGF2BP3 knockdown decreased the migration and invasion abilities of the glioma cells. (A) The cells were scraped and imaged immediately (0 h), and after 24 h; images of the wound gap were taken for analysis (×10). (B) Cell migration assays were carried out in the U87 and U251 cells (×100; cell migration assays were measured by crystal violet staining assay); IGF2BP3 knockdown by two different shRNAs significantly suppressed cell migration in the U87 and U251 cells. (C) Cell invasion assays were carried out in the U87 and U251 cells, which showed that the knockdown of IGF2BP3 suppresses the invasion ability of the glioma cells (×100; cell invasion assays were measured by crystal violet staining assay). *, P<0.05; **, P<0.01; ***, P<0.001, vs. their respective control. NC, negative control; sh, short-hairpin; IGF2BP3, insulin growth factor-2 binding protein 3; shRNAs, short-hairpin RNAs.

IGF2BP3 silencing inhibited the tumorigenic properties of the glioma cells

To evaluate the tumorigenic property of IGF2BP3 in vivo, the U87-NC and U87-shIGF2BP3 cells were subcutaneously inoculated into the athymic mice (5 mice per cell type). After 21 days, the mice were euthanatized, and the xenograft tumors were extracted, imaged, and measured. The U87-NC group had a higher average tumor volume and weight than the U87-shIGF2BP3 group (Figure 5A). The IHC staining revealed that IGF2BP3 and Ki-67 were downregulated in the IGF2BP3-deficient tumors (Figure 5B,5C). These data suggested that IGF2BP3 knockdown significantly decreased the tumorigenic properties of the glioma cells in vivo.

Figure 5 IGF2BP3 knockdown in U87 cells suppressed tumor growth in the nude mice. (A) Representative images of the xenograft tumors in the nude mice are shown in the left panel, and tumor volume was calculated as follows: (longest diameter) × (shortest diameter)2 × (ω/6). **, P<0.01; ***, P<0.001. (B) Representative images of IHC staining for IGF2BP3 in tumors excised from xenograft model mice (×200). (C) Representative images of IHC staining for Ki-67 (×200). Scale bar =20 µm. NC, negative control; sh, short-hairpin; IGF2BP3, insulin growth factor-2 binding protein 3; IHC, immunohistochemistry.

IGF2BP3-related DEGs in gliomas

To explore the underpinning mechanisms of IGF2BP3 in glioma carcinogenesis, the RNA-seq data of 448 glioma patients were retrieved from TCGA database. The patients were divided into the low- and high-IGF2BP3 groups based on survival. In total, 946 DEGs were found to be significantly associated with IGF2BP3, among which 567 were upregulated and 379 were downregulated (Figure 6A). The results of the GO and KEGG analyses of the DEGs are shown in Figure 6B. The IGF2BP3 silencing in the U87 cells revealed the possible roles of the DEGs. Finally, the top 10 hub genes were retrieved with the cytoHubba plugin in Cytoscape (Figure 6C).

Figure 6 Exploring the target mRNA of IGF2BP3. (A) The identified DEGs are shown in the volcano plot. Red represents significantly different up-regulated genes; blue represents significantly different down-regulated genes; black represents genes with no significant difference. (B) The top 5 significant GO and KEGG enrichment terms of the DEGs. (C) The top 10 hub genes were selected through the cytoHubba App in Cytoscape. BP, biological progress; CC, cellular component; MF, molecular function; FDR, false discovery rate; GO, Gene Ontology; mRNA, messenger RNA; IGF2BP3, insulin growth factor-2 binding protein 3; DEGs, differentially expressed genes; KEGG, Kyoto Encyclopedia of Genes and Genomes.

IGF2BP3 induced glioma cell cycle arrest

According to TCGA data, we found close associations between IGF2BP3 and the cell cycle regulators, including CDK1 and cell-division cycle protein 20 homologue (CDC20). CDK1 belongs to the CDK family and mainly affects the cell cycle. The western blot analysis demonstrated that CDK1 expression was significantly reduced after IGF2BP3 knockdown (Figure 7A). Moreover, the flow cytometry results showed that the glioma cells were arrested in the G0/G1 phase after IGF2BP3 knockdown (Figure 7B,7C).

Figure 7 IGF2BP3 silencing induced cell cycle arrest in the U87 cells. (A) Western blotting revealed that IGF2BP3 knockdown decreased the protein levels of CDK1. (B) FACS analysis results showing the proportion of cells in each phase of the cell cycle. (C) Bar graph showing the results of the number of cells in each phase of the cell cycle. All the experiments were conducted 3 times. The results are presented as the mean ± standard deviation (**, P<0.01). IGF2BP3, insulin growth factor-2 binding protein 3; CDK1, cyclin-dependent kinase 1; NC, negative control; sh, short-hairpin; FACS, fluorescence-activated cell sorting.

Discussion

RNAs are major information carriers in cells. Several types of RNAs with small molecular weights and large content variations are found in cells. Based on their structure and function, RNAs are classified into coding and non-coding types. Recently, non-coding RNAs and post-transcriptional RNA modifications have become popular areas in cancer research (10). RNA methylation accounts for >60% of all RNA modifications, among which m⁶A methylation is the most common and most studied type (11). The m⁶A modification is reversible and dynamic and may affect mRNA splicing, stability, and translation efficiency (12,13). Three types of m⁶A modulators are involved in m⁶A methylation, including writers, erasers, and readers (14). There is mounting evidence that m⁶A methylation significantly affects RNA metabolism and regulates the pathogenetic mechanisms of various pathologies, including cancer (15). Wang et al. (16) found that three different m⁶A modification clusters affect the immune microenvironment of esophageal cancer, and their findings provided major insights into the diagnostic and therapeutic approaches. The overexpression of m⁶A methylation-associated genes plays a critical role in acute myeloid leukemia, breast cancer, nasopharyngeal carcinoma, colorectal cancer, and osteosarcoma (17-21).

GBM is the most common primary intracranial malignancy, and neither surgery nor chemotherapy can improve its prognosis (22). Besides conventional radiotherapy and chemotherapy, novel technologies, such as targeted therapy, immunotherapy, and electric field therapy, are gradually being assessed clinically. However, most cases of malignant glioma show tumor recurrence and progression because existing treatment strategies only target a single key oncogenic pathway or gene mutation in glioma cells. Typically, GBMs are highly heterogeneous, and glioma stem cells (GSCs) switch between different states of molecular subtypes. In recent years, multiple studies in the fields of genomics, epigenetics, and tumor immunology have identified several molecular markers that may be used for precise diagnosis, prognosis assessment, and individualized treatment (23).

Interestingly, the RNA field has emerged as a new frontier in cancer therapy. RNA modifications play a critical role in tumor development. m⁶A, which is the most well-known RNA modification, is closely related to GBM progression and invasiveness. Methyltransferase-like 3 (METTL3), an m⁶A writer, induces GBM growth and progression; specifically, METTL3 silencing inhibits the growth and self-renewal ability of GSCs (24). Visvanathan et al. (25) reported elevated METTL3 levels in GSCs, which play a crucial role in GSC maintenance and resistance to γ-irradiation. A GO analysis demonstrated METTL3 was involved in key carcinogenic pathways, including the vascular endothelial growth factor signaling pathway, angiogenesis, tumor metabolism, G protein coupled receptor signaling, and cadherin signaling (26). However, inconsistent findings have been reported for GBM. Notably, Cui et al. found that METTL3 knockdown promotes the proliferative, self-renewal, and tumorigenic abilities of GSCs (27), which suggests METTL3 serves as a tumor suppressor in GBM. It may be difficult to determine the factors contributing to the controversial role of METTL3 in GBM. A variety of m⁶A readers and different cell types and tumor specimens could account for this variation (28).

Like writers, m⁶A erasers are important in GBM. The fat mass and obesity-associated (FTO) gene, which was the first m⁶A eraser associated with obesity (29), plays an important oncogenic role in GBM. Cui et al. (27) indicated that FTO knockdown inhibits GSC growth and self-renewal. Similarly, Su et al. showed that FTO inhibition decreases the self-renewal and carcinogenic abilities of cultured GSCs in a mouse model of GBM (30). Further, the overexpression of the m⁶A demethylase ALKBH5 in GSCs increases the self-renewal, proliferation, and tumorigenicity of cells (31).

In addition to the methylases and demethylases, an indispensable protein group involved in m⁶A are “readers”. The significance of m⁶A modifications in cells depends on m⁶A readers, as they recognize and interact with methylated modification sites and participate in downstream RNA translation and degradation. Research has shown that even in the case of unchanged m⁶A levels, abnormal m⁶A reader expression promotes GBM tumorigenesis (3). The most well-known m⁶A readers include the YTH domain containing (YTHDC) and YTH N⁶-methyladenosine RNA binding protein (YTHDF) families, which have a YTH domain (32,33). An additional family of m⁶A readers (i.e., IGF2BPs, including IGF2BP1–3) has also been identified (34). IGF2BPs have long been considered oncofetal proteins in numerous cancer tissues and play an oncogenic role (35). Suvasini et al. (36) reported that IGF2BP3 is upregulated in GBM but not significantly in low-grade astrocytoma samples. In addition, IGF2BP3 increases the proliferative abilities of GBM cells by inducing epithelial-mesenchymal transition (EMT) (37). However, it is unclear whether the above phenomenon involves the m⁶A reading process.

In the present study, an analysis of the m⁶A-associated genes in gliomas of TCGA revealed that IGF2BP3 was the most commonly regulated m⁶A-associated gene, and the high IGF2BP3 expression was shown to predict short survival (P<0.001). As stated above, the IGF2BP3 expression levels were high in GBM, low in LGG, and extremely low in the paratumor adjacent tissues. We also observed that IGF2BP3 knockdown significantly reduced the proliferative, migratory, and invasive abilities of the glioma cells and suppressed glioma tumor growth. Thus, we can conclude that IGF2BP3 is important in human glioma progression, but the underpinning mechanisms require further investigation.

Huang et al. (34) found that IGF2BPs enhance the stability of their mRNA targets in an m⁶A-dependent fashion. Zhang et al. (38) showed that IGF2BP3 downregulation inhibits acute myeloid leukaemia (AML) progression by altering the stability of regulator of chromosome condensation 2 (RCC2) mRNA in an m⁶A-dependent fashion. As an m⁶A reader protein, IGF2BP3 exerts major biological effects by recognizing the target genes. Thus, we explored IGF2BP3 targets in glioma by a bioinformatics analysis based on TCGA data, and identified 567 upregulated and 379 downregulated genes with significant associations with IGF2BP3. We also selected the top 10 hub genes that appeared promising for further investigation, many of which were associated with cell cycle progression. A cell cycle analysis by flow cytometry showed that the cell cycle was arrested after IGF2BP3 silencing. Additionally, we found IGF2BP3 knockdown decreased the expression of CDK1, which is essential for cell cycle regulation.

Abnormal m⁶A modification is closely related to cancer occurrence, development progression, and cancer metabolism (39). Recently a study has found that the expression of m⁶ A regulators are related to the infiltration of tumor immune cells (40). In multiple tumor types including LGG, IGF2BP3 expression was positively correlated with the infiltration of various immune cells such as CD4⁺ T cell, CD8⁺ T cell, neutrophils, macrophages and dendritic cells (DCs). The IGF2BP family plays a pivotal role by recognizing m⁶A modifications and suppressing RNA degradation. We analyzed the biological function of IGF2BP3 in glioma and searched for its downstream target genes. The current study highlighted IGF2BP3 as a therapeutic target in glioma; however, further research needs to be conducted to confirm these findings.

Conclusions

IGF2BP3, which is the most significantly altered m⁶A-related gene, is correlated with glioma prognosis. IGF2BP3 expression in glioma is positively correlated with tumor grade and enhances glioma cell proliferation, invasion, and tumorigenicity. IGF2BP3 knockdown decreases the expression of CDK1 and the cell cycle process and thus may serve as a potential therapeutic target for glioma.

Acknowledgments

Funding: This study was supported by the Scientific and Technological Development Plan Project of Suzhou (No. SYS2020142), the Suzhou High-Tech Zone Youth Science and Technology Project (No. 2019Q010), and the Advanced Research Foundation of The Second Affiliated Hospital of Soochow University (No. SDFEYJHJ2101).

Footnote

Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-449/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-449/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-449/prf

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-449/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Each patient signed the informed consent form. The current study was approved by the Ethics Committee of The Second Affiliated Hospital of Soochow University (No. JD-HG-2022-52). The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The experiments involving animals were approved by the Animal Ethics Committee of Soochow University (No. 20210708A02), all animal work was conducted in compliance with national guidelines for care and human use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Gusyatiner O, Hegi ME. Glioma epigenetics: From subclassification to novel treatment options. Semin Cancer Biol 2018;51:50-8. [Crossref] [PubMed]
2. Olmez I, Brenneman B, Xiao A, et al. Combined CDK4/6 and mTOR Inhibition Is Synergistic against Glioblastoma via Multiple Mechanisms. Clin Cancer Res 2017;23:6958-68. [Crossref] [PubMed]
3. Dong Z, Cui H. The Emerging Roles of RNA Modifications in Glioblastoma. Cancers (Basel) 2020;12:736. [Crossref] [PubMed]
4. Jemal A, Siegel R, Xu J, et al. Cancer statistics, 2010. CA Cancer J Clin 2010;60:277-300. [Crossref] [PubMed]
5. Song P, Tayier S, Cai Z, et al. RNA methylation in mammalian development and cancer. Cell Biol Toxicol 2021;37:811-31. [Crossref] [PubMed]
6. Lan Q, Liu PY, Bell JL, et al. The Emerging Roles of RNA m6A Methylation and Demethylation as Critical Regulators of Tumorigenesis, Drug Sensitivity, and Resistance. Cancer Res 2021;81:3431-40. [Crossref] [PubMed]
7. Deng LJ, Deng WQ, Fan SR, et al. m6A modification: recent advances, anticancer targeted drug discovery and beyond. Mol Cancer 2022;21:52. [Crossref] [PubMed]
8. Zaccara S, Ries RJ, Jaffrey SR. Reading, writing and erasing mRNA methylation. Nat Rev Mol Cell Biol 2019;20:608-24. [Crossref] [PubMed]
9. Sun C, Zheng X, Sun Y, et al. Identification of IGF2BP3 as an Adverse Prognostic Biomarker of Gliomas. Front Genet 2021;12:743738. [Crossref] [PubMed]
10. Zhang Y, Geng X, Li Q, et al. m6A modification in RNA: biogenesis, functions and roles in gliomas. J Exp Clin Cancer Res 2020;39:192. [Crossref] [PubMed]
11. Liu J, Eckert MA, Harada BT, et al. m6A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol 2018;20:1074-83. [Crossref] [PubMed]
12. Wang X, Lu Z, Gomez A, et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014;505:117-20. [Crossref] [PubMed]
13. Lin S, Gregory RI. Methyltransferases modulate RNA stability in embryonic stem cells. Nat Cell Biol 2014;16:129-31. [Crossref] [PubMed]
14. Fang Z, Mei W, Qu C, et al. Role of m6A writers, erasers and readers in cancer. Exp Hematol Oncol 2022;11:45. [Crossref] [PubMed]
15. Wang T, Kong S, Tao M, et al. The potential role of RNA N6-methyladenosine in Cancer progression. Mol Cancer 2020;19:88. [Crossref] [PubMed]
16. Wang H, Zhang Y, Chen L, et al. Identification of clinical prognostic features of esophageal cancer based on m6A regulators. Front Immunol 2022;13:950365. [Crossref] [PubMed]
17. Wan W, Ao X, Chen Q, et al. METTL3/IGF2BP3 axis inhibits tumor immune surveillance by upregulating N6-methyladenosine modification of PD-L1 mRNA in breast cancer. Mol Cancer 2022;21:60. [Crossref] [PubMed]
18. Du M, Peng Y, Li Y, et al. MYC-activated RNA N6-methyladenosine reader IGF2BP3 promotes cell proliferation and metastasis in nasopharyngeal carcinoma. Cell Death Discov 2022;8:53. [Crossref] [PubMed]
19. Paris J, Morgan M, Campos J, et al. Targeting the RNA m6A Reader YTHDF2 Selectively Compromises Cancer Stem Cells in Acute Myeloid Leukemia. Cell Stem Cell 2019;25:137-48.e6. [Crossref] [PubMed]
20. Liu X, He H, Zhang F, et al. m6A methylated EphA2 and VEGFA through IGF2BP2/3 regulation promotes vasculogenic mimicry in colorectal cancer via PI3K/AKT and ERK1/2 signaling. Cell Death Dis 2022;13:483. [Crossref] [PubMed]
21. Yadav P, Subbarayalu P, Medina D, et al. M6A RNA Methylation Regulates Histone Ubiquitination to Support Cancer Growth and Progression. Cancer Res 2022;82:1872-89. [Crossref] [PubMed]
22. Wick W, Gorlia T, Bady P, et al. Phase II Study of Radiotherapy and Temsirolimus versus Radiochemotherapy with Temozolomide in Patients with Newly Diagnosed Glioblastoma without MGMT Promoter Hypermethylation (EORTC 26082). Clin Cancer Res 2016;22:4797-806. [Crossref] [PubMed]
23. Gao W-Z, Guo L-M, Xu T-Q, Yin Y-H, Jia F. Identification of a multidimensional transcriptome signature for survival prediction of postoperative glioblastoma multiforme patients. J Transl Med 2018;16:368. [Crossref] [PubMed]
24. Li F, Yi Y, Miao Y, et al. N6-Methyladenosine Modulates Nonsense-Mediated mRNA Decay in Human Glioblastoma. Cancer Res 2019;79:5785-98. [Crossref] [PubMed]
25. Visvanathan A, Patil V, Arora A, et al. Essential role of METTL3-mediated m6A modification in glioma stem-like cells maintenance and radioresistance. Oncogene 2018;37:522-33. [Crossref] [PubMed]
26. Visvanathan A, Patil V, Abdulla S, et al. N6-Methyladenosine Landscape of Glioma Stem-Like Cells: METTL3 Is Essential for the Expression of Actively Transcribed Genes and Sustenance of the Oncogenic Signaling. Genes (Basel) 2019;10:141. [Crossref] [PubMed]
27. Cui Q, Shi H, Ye P, et al. m6A RNA Methylation Regulates the Self-Renewal and Tumorigenesis of Glioblastoma Stem Cells. Cell Rep 2017;18:2622-34. [Crossref] [PubMed]
28. Lan Q, Liu PY, Haase J, et al. The Critical Role of RNA m6A Methylation in Cancer. Cancer Res 2019;79:1285-92. [Crossref] [PubMed]
29. Jia G, Fu Y, Zhao X, et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol 2011;7:885-7. [Crossref] [PubMed]
30. Su R, Dong L, Li C, et al. R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m6A/MYC/CEBPA Signaling. Cell 2018;172:90-105.e23. [Crossref] [PubMed]
31. Zhang S, Zhao BS, Zhou A, et al. m6A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell 2017;31:591-606.e6. [Crossref] [PubMed]
32. Chang G, Shi L, Ye Y, et al. YTHDF3 Induces the Translation of m6A-Enriched Gene Transcripts to Promote Breast Cancer Brain Metastasis. Cancer Cell 2020;38:857-71.e7. [Crossref] [PubMed]
33. Xiao W, Adhikari S, Dahal U, et al. Nuclear m6A Reader YTHDC1 Regulates mRNA Splicing. Mol Cell 2016;61:507-19. [Crossref] [PubMed]
34. Huang H, Weng H, Sun W, et al. Recognition of RNA N6-methyladenosine by IGF2BP proteins enhances mRNA stability and translation. Nat Cell Biol 2018;20:285-95. [Crossref] [PubMed]
35. Müller S, Bley N, Glaß M, et al. IGF2BP1 enhances an aggressive tumor cell phenotype by impairing miRNA-directed downregulation of oncogenic factors. Nucleic Acids Res 2018;46:6285-303. [Crossref] [PubMed]
36. Suvasini R, Shruti B, Thota B, et al. Insulin growth factor-2 binding protein 3 (IGF2BP3) is a glioblastoma-specific marker that activates phosphatidylinositol 3-kinase/mitogen-activated protein kinase (PI3K/MAPK) pathways by modulating IGF-2. J Biol Chem 2011;286:25882-90. [Crossref] [PubMed]
37. Wu C, Ma H, Qi G, et al. Insulin-like growth factor II mRNA-binding protein 3 promotes cell proliferation, migration and invasion in human glioblastoma. Onco Targets Ther 2019;12:3661-70. [Crossref] [PubMed]
38. Zhang N, Shen Y, Li H, et al. The m6A reader IGF2BP3 promotes acute myeloid leukemia progression by enhancing RCC2 stability. Exp Mol Med 2022;54:194-205. [Crossref] [PubMed]
39. An Y, Duan H. The role of m6A RNA methylation in cancer metabolism. Mol Cancer 2022;21:14. [Crossref] [PubMed]
40. Yao Y, Luo L, Xiang G, et al. The expression of m6A regulators correlated with the immune microenvironment plays an important role in the prognosis of pancreatic ductal adenocarcinoma. Gland Surg 2022;11:147-65. [Crossref] [PubMed]

(English Language Editor: L. Huleatt)