Suppression of hepatocellular carcinoma progression by long noncoding RNA apolipoprotein C1 pseudogene via the regulation of the microRNA-106b-PTEN axis
Highlight box
Key findings
• lncRNA APOC1P1 inhibits hepatocellular carcinoma (HCC) progression by competitively binding to miR-106b, leading to elevated phosphatase and TENsin homolog deleted on chromosome 10 (PTEN) expression, inhibiting cell proliferation and invasion in HCC cells.
What is known and what is new?
• APOC1P1 was reported to regulate the pathogenesis of cholangiocarcinoma and breast cancer.
• Upregulated APOC1P1 inhibited HCC progression. APOC1P1 was shown to regulate PTEN expression by targeting miR-106b to suppress HCC progression.
What is the implication, and what should change now?
• These results provide new insights into the diagnosis and therapy of HCC.
Introduction
Hepatocellular carcinoma (HCC) is the most common type of liver cancer and has a high incidence and mortality worldwide (1). According to the reports, 782,000 cases of HCC were diagnosed and 746,000 HCC-related deaths occurred in 2012, and it is expected that the incidence rate will increase in the future. Among all countries, China has the highest incidence of HCC and accounts for half of the global number of patients with HCC (2). Every year, 300,000 to 400,000 Chinese people die from HCC (3). HCC typically emerges due to cirrhosis induced by viral infection or alcohol consumption. The common treatment methods for HCC, drug administration and surgery, have certain drawbacks (4,5). As curing HCC remains difficult, improving effective treatment for HCC is critical.
Long noncoding RNA (lncRNA) is a transcript including more than 200 nucleotides that does not code for any protein (6). Regardless of whether lncRNAs are in the nucleus or the cytoplasm, they form regulatory networks with other RNAs, such as microRNAs (miRNAs), or proteins to affect the downstream molecules and play key roles in many of the biological processes of diseases (7,8). An abundance of research has shown that lncRNAs participate in some biological processes of HCC, including proliferation, invasion, ferroptosis and metastasis, etc. (9,10). For instance, one study shows that HCC ferroptosis associative lncRNA (HEPFAL) is shown to mediate the ubiquitination of SLC7A11 to promote ferroptosis in HCC (11). Stabilization of β-catenin mRNA is promoted by lncRNA UFC1 via binding with the mRNA stabilizing protein HuR, a protein reported for mRNA stabilization, thus activating Wnt signaling and consequent HCC progression (12). While miRNA sponge lncRNA XIST acts as a tumor suppressor by interaction with miR-92b leading to repression of HCC proliferation and metastasis (13). Although these studies are illuminating, much more dysregulated lncRNAs require further investigation for providing new insights into HCC pathogenesis and novel tools for the early diagnosis and treatment of HCC.
The lncRNA apolipoprotein C-I pseudogene 1 (APOC1P1) is located in 19q13.2 between apolipoprotein C-I and apolipoprotein C-IV. Han et al. (14) identified that lncRNA APOC1P1 can inhibit the inflammatory response in malignant bile duct cell carcinoma. In another study, lncRNA APOC1P1 was found to be overexpressed in breast cancer (15) and was confirmed to regulate the pathogenesis of cholangiocarcinoma (16). Considering the relationship between cholangiocarcinoma and HCC, we hypothesized whether lncRNA APOC1P1 plays certain mechanism in HCC development and progression. However, the role of lncRNA APOC1P1 in HCC remains underexamined.
In this study, we aimed to determine whether lncRNA APOC1P1 participates in the progression of HCC and to clarify any related mechanisms. Our findings may provide novel biomarkers and therapeutic targets for HCC. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-2189/rc).
Methods
Clinical samples and cell lines
Matched pairs of cancerous and normal tissue from 50 patients with HCC were obtained from the Second Affiliated Hospital of Nantong University. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). This study was approved by Ethics Committee of the Second Affiliated Hospital of Nantong University (No. 2020KT014). The study mainly uses biological specimens obtained in previous clinical diagnosis and treatment, and is a secondary use of biological specimens, which is approved by the ethics committee without informed consent. The clinical characteristics of the HCC patients are summarized in Table 1.
Table 1
| Characteristic | Total | APOC1P1 (n) | χ2 value | P value | |
|---|---|---|---|---|---|
| Low (n=32) | High (n=18) | ||||
| Gender | 0.006 | 0.921 | |||
| Male | 38 | 27 | 11 | ||
| Female | 12 | 5 | 7 | ||
| Age (years) | 0.014 | 0.781 | |||
| ≤60 | 21 | 17 | 4 | ||
| >60 | 29 | 15 | 14 | ||
| Size (cm) | |||||
| <5 | 31 | 26 | 5 | ||
| ≥5 | 19 | 6 | 13 | ||
| Lymphatic metastasis (yes/no) | 4.126 | 0.035* | |||
| Yes | 16 | 9 | 7 | ||
| No | 34 | 23 | 11 | ||
| TNM stage | 3.823 | 0.048* | |||
| I and II | 29 | 20 | 9 | ||
| III and IV | 21 | 12 | 9 | ||
* P<0.05 was considered significant. APOC1P1, apolipoprotein C-I pseudogene 1; TNM, tumor, node, metastasis.
The human HCC cell lines (Bel-7404, HCCLM3, MHCC-97H, Hep G2, and Huh-7) and normal human hepatocytes LO2 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cell lines were cultured in Dulbecco’s Modified Eagle Medium (DMEM) medium (product code: 11960044; Corning, Corning, NY, USA) supplemented with 10% fetal bovine serum (FBS) (product code: 10099141C; Corning, Corning, NY, USA) and 1% penicillin and streptomycin (product code: 15140122; Gibco, Thermo Fisher Scientific, Grand Island, NY, USA) in a humidified incubator at 37 ℃ with a 5% CO2 atmosphere.
RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted from tissues and cell lines using TRIzol Reagent (product code: 15596026; Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) according to the manufacturer’s instructions. The primer sequences of these genes in this study are summarized in Table 2. The complement DNA (cDNA) was synthesized from RNA with the Revert Aid First-Strand cDNA Synthesis Kit (K1621; Thermo Fisher Scientific, Waltham, MA, USA). qRT-PCR was then performed on a LightCycler 480 using SYBR Green Master Mix (product code: 4913914001; Roche Diagnostics, Basel, Switzerland). The relative gene expression level was determined using the 2−∆∆Ct approach with 18S ribosomal RNA and U6 as the normalization references.
Table 2
| Gene | Primer sequence |
|---|---|
| lncRNA APOC1P1 | F GGTCCTGGTGGTGGTTCTGTC |
| R CTCCTTCACTTTCCGAAATGTCTC | |
| miRNA-106b | F TTTTCGCCCTTAGCGTGAAGA |
| R GAGGCAGTCGAAGCTCTCG | |
| PTEN | F GTTTACCGGCATCAAAT |
| R CCCCCACTTTAGTGCAGT | |
| 18S | F GTAACCCGTTGAACCCCATT |
| R CCATCCAATCGGTAGTAGCG | |
| U6 | F TCCCTTCGGGGACATCCG |
| R AATTTTGGACCATTTCTCGATTTGT |
qRT-PCR, quantitative real-time polymerase chain reaction.
Plasmid construction and cell transfection
PCR products of lincRNA APOC1P1 were cloned into pcDNA3.1 vector. Small interfering RNA (siRNA), short hairpin RNA (shRNA), and miRNA mimics and inhibitors were purchased from RiboBio (RiboBio, Guangzhou, China). All of the transfection experiments were conducted with Lipofectamine 3000 (product code: L3000008; Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA). qRT-PCR was used to measure the transfection efficiency.
Cell Counting Kit 8 assay and cell invasion assay
Cell Counting Kit-8 (CCK-8) (product code: CA1210; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) assay was used to measure cell viability. Cells (1×103) were planted into the 96-well plant and cultured at 37 ℃ in a humidified incubator. After incubation for 4 h, 10 µL of CCK-8 was added into the each well. The absorbance was measured at 450 nm with a microplate reader.
Cell invasive ability was measured with a Transwell assay. Cells (5×104) were cultured in serum-free DMEM and seeded into the upper chambers (product code: CLS3450; Corning, Tewksbury, MA, USA). In the bottom chamber, medium with 10% FBS and 90% DMEM was added. Cells were left invade for 24 h at 37 ℃. The upper cavity was wiped with a cotton swab from the culture dish for nonmigrated cells. The cells were then fixed with 4% paraformaldehyde for 10 min at room temperature and stained with 0.1% crystal violet for 20 min at room temperature. Counts of invaded cells were used to estimate the cell invasion ability.
APOC1P1 subcellular location analysis
Cells were fixed in 4% paraformaldehyde for 30 min and then washed with phosphate-buffered saline (PBS). Triton X-100 (product code: 9002-93-1, Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) was used to treat the fixed cells. The cells were incubated with a fluorescent in situ hybridization (FISH) kit (RiboBio, Guangzhou, China). The PARIS Kit (Invitroge, Thermo Fisher Scientific, Vilnius, Lithuania) was used to separate cytoplasmic and nuclear RNA.
Bioinformatics analysis
The differential expression of APOC1P1 in HCC tissues was analyzed via The Cancer Genome Atlas (TCGA) database (https://cancergenome.nih.gov/). Kaplan-Meier curve analysis of TCGA and Gene Expression Omnibus (GEO) was used to define the association of APOC1P1 with time to progression. Differentially expressed messenger RNA (mRNA) datasets were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/).
Luciferase reporter assay
Luciferase reporter assay was carried out to examine the interactions between APOC1P1 and miR-106b. pSI-Check2 vector (Riobio, Guangzhou, China) was participated in the cloning of full length APOC1P1 as pSI-Check2-APOC1P1 wild vector or pSI-Check2-APOC1P1 mutant vector was constructed. Mutant or wild type for APOC1P1 was contransfected with miR-106b mimics or control. Meanwhile, mutant or wild type for phosphatase and TENsin homolog deleted on chromosome 10 (PTEN) was also constructed with pSI-Check2. Both pSI-Check2-PTEN wild vector or pSI-Check2-PTEN mutant vector was contransfected with miR-106b mimics. A Dual Luciferase Assay kit (Promega Corp., Fitchburg, WI, USA) was used to detect the Firefly and Renilla luciferase activities 2 days post-transfection following the manufacturer’s instructions.
Western blotting
Total proteins were collected with cell lysis buffer (product code: P70100; NCM Biotech, Newport, RI, USA). Proteins were separated with sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene fluoride (PVDF) membranes (product code: IPFL00010; MilliporeSigma, Burlington, MA, USA). Membranes were sealed with 5% nonfat milk and then treated with primary antibodies at 4 ℃ overnight. After a wash with PBS, secondary antibody (product code: SA00001-2; Proteintech, Rosemont, IL, USA) was incubated with membranes for 1 h in the dark. The antibodies of PTEN (product code: ab170941; Abcam, Cambridge, UK) and GAPDH (product code: ab181602; Abcam, Cambridge, UK) were purchased from Abcam. The antibodies were diluted by buffer. The dilution radio of primary antibodies was 1:1,000, while that of the secondary antibodies was 1:10,000. GAPDH served as the internal control. The data were detected using an enhanced chemiluminescence (ECL) detection system.
Statistical analysis
All data are presented as the mean and standard deviation (SD) and were analyzed with GraphPad Prism 8.0 (GraphPad Software, Inc., San Diego, CA, USA). The analysis of the relative expression of HCC tissues and multiple groups was completed with the independent-samples t-test and one-way analysis of variance (ANOVA), respectively. A P value <0.05 was considered to indicate a statistically significant difference.
Results
APOC1P1 was downregulated in HCC and was associated with overall survival
The first results showed that APOC1P1 was downregulated in 50 HCC tissues in comparison with the adjacent tissues (P=0.002; Figure 1A). To determine the molecular role of APOC1P1 in HCC, we used qRT-PCR to determine the expression of APOC1P1 in 6 different cell lines including 1 normal cell line (LO2) and 5 HCC cell lines (Bel-7404, HCCLM3, MHCC-97H, Hep G2, and Huh-7). We found that the expression of APOC1P1 was considerably decreased in HCC cell lines compared with normal cells (P<0.05; Figure 1B). Significantly, APOC1P1 expression in HCCLM3 cells and Hep G2 cells were lower than that in other cell lines. HCCLM3 cells and Hep G2 cells were used in the subsequent experiments. Our results were confirmed by the TCGA database (Figure 1C). In addition, the Kaplan-Meier curve revealed the relationship between APOC1P1 expression and overall survival (Figure 1D). The above results indicated that APOC1P1 was downregulated in HCC and associated with good prognosis.
APOC1P1 overexpression inhibited the tumor cell proliferation and invasion
To investigate the biological role of APOC1P1 in HCC cells, we conducted APOC1P1 overexpression in HCCLM3 cells and Hep G2 cells through shRNA transfection. The qRT-PCR results indicated that the APOC1P1 expression of APOC1P1 was markedly upregulated in HCCLM3 cells and Hep G2 cells which were transfected by plasmid compared with control cells (P<0.05; Figure 2A). CCK-8 assay showed that APOC1P1 overexpression markedly reduced cellular viability of HCCLM3 cells and Hep G2 cells compared to control cells (P<0.05; Figure 2B). Moreover, we found that APOC1P1 overexpression also affected cell invasion. The results of Transwell invasion assay confirmed that upregulated APOC1P1 obviously decreased invasion ability (Figure 2C). These findings indicated that APOC1P1 inhibited the progression of HCC cells.
APOC1P1 regulated PTEN by targeting miRNA-106b as a competing endogenous RNA
We conducted subcellular location analysis to characterize the distribution of APOC1P1 in cells. FISH and subcellular fractionation analysis results showed that APOC1P1 was abundant in the cytoplasm (Figure 3A,3B). We then used two GEO datasets, GSE108724 and GSE10694, with 2687 mRNAs and 6 miRNAs being aberrantly expressed in GSE108724 and 69 miRNAs being differentially expressed in GSE10694 (Figure 4A,4B). A volcano plot revealed the upregulated and downregulated miRNAs of GSE108724 and GSE10694 (Figure 4C,4D). We identified three upregulated miRNAs (miR-106b, miR-222 and miR-221) by identifying the intersection of miRNAs of the two datasets. PCR results showed that miR-106b expression was significantly lower than other miRNAs in the control group. Thus, we chose miR-106b as the target gene in subsequent experiments.
To determine the relationship of APOC1P1 and miR-106b, we detected the expression of miR-106b in cell lines and tumor tissues. The qRT-PCR results indicated that miR-106b was upregulated in HCC cell lines and HCC tissues compared with normal control groups (Figure 5A,5B). Luciferase reporter assay confirmed the binding site between APOC1P1 and miR-106b, suggesting the presence of an lncRNA-miRNA network (Figure 5C and Figure S1). In the study by Zhang et al. (16), miR-106b had a putative biding site in the 3'-untranslated region (UTR) of PTEN. As expected, our luciferase reporter assay also revealed this relationship between miR-106b and PTEN (Figure 5D). Moreover, there was a negative correlation between APOC1P1 expression and miR-106b expression in HCC tissues (r2=0.5012; P=0.0062; Figure 5E) and a positive correlation between APOC1P1 and PTEN (r2=0.5128; P=0.0041; Figure 5F). All data suggested that APOC1P1 regulated PTEN by targeting miRNA-106b as a competing endogenous RNA (ceRNA).
The APOC1P1-miR-106b-PTEN axis modulated HCC cell proliferation and invasion in vitro
PTEN was downregulated in the HCC cell lines, while miR-106b was upregulated in HCC cell lines (Figure 6A). miR-inhibitor transfection and APOC1P1 plasmid construction + miR-inhibitor cotransfection were performed to determine whether miR-106b and PTEN participate in the biological function of APOC1P1 in HCC (Figure 6B). CCK-8 assay indicated that APOC1P1 overexpression or miR-106b inhibition decreased HCC cell proliferation ability (Figure 6C). Moreover, HCC cell proliferation ability was markedly suppressed when APOC1P1 overexpression and miR-106b inhibition occurred simultaneously. The Western blot results showed that PTEN protein expression of the pc-APOC1P1 + miR-inhibitor group was significantly higher than that in other groups (Figure 6D). Overall, upregulation of APOC1P1 or downregulation of miR-106b enhanced PTEN expression, which modulated HCC cell proliferation and invasion.
Discussion
Due to its high incidence, frequent recurrence, and poor survival rate, HCC has attracted considerable attention in global research (17). Molecular mechanism studies have been used to identify a vast number of genetic factors that are involved in tumor genesis and development. lncRNA is the most notable of these and has been proven to regulate many diseases. Noticeably, in 2018, lncRNA APOC1P1 was confirmed to be involved in the inflammation of cholangiocarcinoma (16). Considering the relationship between inflammation and HCC, we hypothesized that APOC1P1 has a role in HCC.
In our study, we found that APOC1P1 expression was downregulated in HCC tissues and HCC cell lines. Furthermore, based on TCGA data, it was found that the high expression of APOC1P1 was associated with good prognosis in patients with HCC. After the overexpression of APOC1P1 was established, the influence on proliferation and invasion of HCC was observed. The results confirmed that APOC1P1 was vital in the progression of HCC and may thus serve as a therapeutic target in clinical treatment.
We conducted subsequent experiments to clarify the molecular mechanism of APOC1P1 in HCC. The data indicated that APOC1P1 was mainly located in the cytoplasm, which has been shown to be the site of ceRNA by numerous studies (18). ceRNA cross-talk as a type of network interaction has also been widely explored, and it has been found that lncRNAs act as molecular sponges in moderating miRNA expression. Evidence also suggests that the ceRNA molecular network is involved in tumor growth (19), with lncRNAs being particularly intriguing within ceRNA cross-talk due to their potential as therapeutic targets. Thus, we speculate that APOC1P1 acts as ceRNA mechanism in regulating the progression of HCC.
The bioinformatic analysis of GEO data yielded three candidate miRNA targets: miR-106b, miR-222, and miR-221. According to the PCR results, miR-106b was selected to conduct subsequent experiments due to it having the lowest expression in the APOC1P1-overexpressed cells. miR-106b has been demonstrated to be a tumor biomarker that promotes HCC cell proliferation and invasion (20,21). Shen et al. (22) reported miR-106b expression to be markedly upregulated in HCC tissues and cell lines, which was consistent with our results. Additionally, our data revealed that the expressions of miR-106b and APOC1P1 were negatively correlated. Within the mechanism of lncRNA acting as a ceRNA of miRNA in further regulating the target protein of miRNA, PTEN acts as the target of miR-106b, as indicated by Shi et al.’s findings (23) and those of our luciferase reporter assays. PTEN was first discovered to be a tumor suppressor in 1997 and has been studied in depth since then (24,25). In esophageal squamous cell carcinoma, miR-106b contributes to invasion and metastasis by regulating PTEN-mediated epithelial-to-mesenchymal transition (16). Furthermore, miR-106b overexpression directly targets PTEN in medulloblastoma progression (26). In our study, we found that miR-106b was upregulated while PTEN was downregulated in HCC, and the expression of miR-106b and PTEN showed a negative correlation. In addition, APOC1P1 overexpression and miR-106b inhibition appeared to exert equal effects on cell proliferation and invasion, and APOC1 regulated PTEN expression by targeting miR-106b. Its clinical application still needs to overcome some difficulties in translational medicine research.
Conclusions
In conclusion, APOC1P1 was overexpressed in HCC, which was associated with good prognosis. Moreover, APOC1P1 was shown to regulate PTEN expression by targeting miR-106b to suppress HCC progression. Our findings point to the potential role of APOC1P1 in HCC diagnosis and therapy and offer new directions in HCC research.
APOC1P1 can be used as a potential biomarker for patient risk stratification and local regional metastasis in HCC.
Acknowledgments
Funding: This study was supported by
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-2189/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-2189/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-2189/prf
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-23-2189/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by ethics committee of the Second Affiliated Hospital of Nantong University (No. 2020KT014). The study mainly uses biological specimens obtained in previous clinical diagnosis and treatment, and is a secondary use of biological specimens, which is approved by the ethics committee without informed consent.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Forner A, Reig M, Bruix J. Hepatocellular carcinoma. Lancet 2018;391:1301-14. [Crossref] [PubMed]
- Chen W, Zheng R, Baade PD, et al. Cancer statistics in China, 2015. CA Cancer J Clin 2016;66:115-32. [Crossref] [PubMed]
- Sperber AD, Bangdiwala SI, Drossman DA, et al. Worldwide Prevalence and Burden of Functional Gastrointestinal Disorders, Results of Rome Foundation Global Study. Gastroenterology 2021;160:99-114.e3. [Crossref] [PubMed]
- Liu D, Song T. Changes in and challenges regarding the surgical treatment of hepatocellular carcinoma in China. Biosci Trends 2021;15:142-7. [Crossref] [PubMed]
- Daher S, Massarwa M, Benson AA, et al. Current and Future Treatment of Hepatocellular Carcinoma: An Updated Comprehensive Review. J Clin Transl Hepatol 2018;6:69-78. [Crossref] [PubMed]
- Kopp F, Mendell JT. Functional Classification and Experimental Dissection of Long Noncoding RNAs. Cell 2018;172:393-407. [Crossref] [PubMed]
- Chan JJ, Tay Y. Noncoding RNA:RNA Regulatory Networks in Cancer. Int J Mol Sci 2018;19:1310. [Crossref] [PubMed]
- Peng J, Zhu Y, Dong X, et al. Construction and analysis of lncRNA-associated ceRNA network identified potential prognostic biomarker in gastric cancer. Transl Cancer Res 2019;8:1116-28. [Crossref] [PubMed]
- Huang Z, Zhou JK, Peng Y, et al. The role of long noncoding RNAs in hepatocellular carcinoma. Mol Cancer 2020;19:77. [Crossref] [PubMed]
- Moldogazieva NT, Zavadskiy SP, Astakhov DV, et al. Differentially expressed non-coding RNAs and their regulatory networks in liver cancer. Heliyon 2023;9:e19223. [Crossref] [PubMed]
- Zhang B, Bao W, Zhang S, et al. LncRNA HEPFAL accelerates ferroptosis in hepatocellular carcinoma by regulating SLC7A11 ubiquitination. Cell Death Dis 2022;13:734. [Crossref] [PubMed]
- Zhang X, Liang W, Liu J, et al. Long non-coding RNA UFC1 promotes gastric cancer progression by regulating miR-498/Lin28b. J Exp Clin Cancer Res 2018;37:134. [Crossref] [PubMed]
- Zhuang LK, Yang YT, Ma X, et al. MicroRNA-92b promotes hepatocellular carcinoma progression by targeting Smad7 and is mediated by long non-coding RNA XIST. Cell Death Dis 2016;7:e2203. [Crossref] [PubMed]
- Han BW, Ye H, Wei PP, et al. Global identification and characterization of lncRNAs that control inflammation in malignant cholangiocytes. BMC Genomics 2018;19:735. [Crossref] [PubMed]
- Rajabi A, Saber A, Abdolahi S, et al. Expression of lncRNAs AK058003 and APOC1P1 in breast cancer patients. Nucleosides Nucleotides Nucleic Acids 2022;41:755-64. [Crossref] [PubMed]
- Zhang J, Chen D, Liang S, et al. miR-106b promotes cell invasion and metastasis via PTEN mediated EMT in ESCC. Oncol Lett 2018;15:4619-26. [Crossref] [PubMed]
- Wang W, Wei C. Advances in the early diagnosis of hepatocellular carcinoma. Genes Dis 2020;7:308-19. [Crossref] [PubMed]
- Wu J, Huang H, Huang W, et al. Analysis of exosomal lncRNA, miRNA and mRNA expression profiles and ceRNA network construction in endometriosis. Epigenomics 2020;12:1193-213. [Crossref] [PubMed]
- Zhu J, Wang L, Zhou Y, et al. Comprehensive analysis of the relationship between competitive endogenous RNA (ceRNA) networks and tumor infiltrating-cells in hepatocellular carcinoma. J Gastrointest Oncol 2020;11:1381-98. [Crossref] [PubMed]
- Shi BM, Lu W, Ji K, et al. Study on the value of serum miR-106b for the early diagnosis of hepatocellular carcinoma. World J Gastroenterol 2017;23:3713-20. [Crossref] [PubMed]
- Sun C, Yao X, Jiang Q, et al. miR-106b targets DAB2 to promote hepatocellular carcinoma cell proliferation and metastasis. Oncol Lett 2018;16:3063-9. [Crossref] [PubMed]
- Shen G, Jia H, Tai Q, et al. miR-106b downregulates adenomatous polyposis coli and promotes cell proliferation in human hepatocellular carcinoma. Carcinogenesis 2013;34:211-9. [Crossref] [PubMed]
- Shi K, Yang S, Chen C, et al. RNA methylation-mediated LINC01559 suppresses colorectal cancer progression by regulating the miR-106b-5p/PTEN axis. Int J Biol Sci 2022;18:3048-65. [Crossref] [PubMed]
- Álvarez-Garcia V, Tawil Y, Wise HM, et al. Mechanisms of PTEN loss in cancer: It's all about diversity. Semin Cancer Biol 2019;59:66-79. [Crossref] [PubMed]
- Zhang J, Zhang Y, Lin X, et al. The effects of the tumor suppressor gene PTEN on the proliferation and apoptosis of breast cancer cells via AKT phosphorylation. Transl Cancer Res 2023;12:1863-72. [Crossref] [PubMed]
- Li KK, Xia T, Ma FM, et al. miR-106b is overexpressed in medulloblastomas and interacts directly with PTEN. Neuropathol Appl Neurobiol 2015;41:145-64. [Crossref] [PubMed]

