Study on the expression of lncRNA PRKCA-AS1 in oral squamous cell carcinoma
Highlight box
Key findings
• Long non-coding RNA (lncRNA) PRKCA-AS1 plays a promoting role in the progression of oral squamous cell carcinoma (OSCC).
What is known and what is new?
• LncRNA plays an extremely important role in the occurrence and development of various human tumors.
• This study focuses on exploring the role of lncRNA PRKCA-AS1 in OSCC.
What is the implication, and what should change now?
• LncRNA PRKCA-AS1 is highly expressed in OSCC tissues and can affect the growth and invasion of OSCC cells by altering the expression of lncRNA PRKCA-AS1.
Introduction
Oral squamous cell carcinoma (OSCC) is a common malignant tumor in the head and neck region, predominantly affecting individuals aged 40 to 70 years who have a history of smoking and alcohol consumption (1,2). OSCC is highly invasive, with a high rate of postoperative recurrence and lymph node metastasis, leading to a high mortality rate (3). In recent years, despite some progress in the research and treatment of OSCC, the diagnosis often occurs at an advanced stage, resulting in a 5-year survival rate of only around 50% (4,5). Currently, treatment methods for OSCC mainly include surgical resection, radiotherapy, chemotherapy, epidermal growth factor receptor (EGFR) inhibitors, cyclooxygenase-2 (COX-2) inhibitors, and photodynamic therapy. However, these approaches have shown limited success in improving the 5-year survival rate (6,7). The aggressive and metastatic nature of the tumor is considered the main reason for the poor prognosis of OSCC patients. Studying the occurrence and development of OSCC at the cellular and molecular levels may provide breakthroughs for early diagnosis and clinical treatment.
PRKCA is a subtype of protein kinase C (PKC) family, closely associated with the MAPK signaling pathway. PRKCA participates in various cellular processes including cell proliferation, differentiation, apoptosis, cell migration, cell transformation, tumor formation, and inflammation by activating signal cascades (8). Its regulatory effect on tumor cells is cell-type dependent, exhibiting different roles in different cell types. Research has demonstrated that PRKCA significantly inhibits the proliferation of various types of cancer cells, including those associated with colorectal, pancreatic, and breast cancer. Additionally, research has demonstrated that knocking down PRKCA expression in the liver cancer cell line HA22T slows down cell proliferation rate and significantly reduces cell migration ability. There has been notable progress in the study of PRKCA in recent years, revealing a strong association between abnormal PRKCA expression and the occurrence and progression of various cancers such as lung adenocarcinoma and esophageal squamous cell carcinoma (9,10). However, there is still a lack of research on PRKCA in OSCC.
Long non-coding RNA (lncRNA) is a group of non-coding RNAs with a length exceeding 200 nucleotides, which mediate epigenetic modifications of DNA and participate in various biological activities such as X chromosome inactivation in mammals (11). With the development of sequencing technology, the association between lncRNA and many human diseases is becoming increasingly apparent. Currently, there is growing evidence indicating that lncRNA plays an extremely important role in the occurrence and development of various human tumors. Certain lncRNAs and their related pathways are shown to regulate the functions of tumor cells in controlling the proliferation, apoptosis, invasion, and metastasis of tumor cells (12-15). The expression of lncRNA-CCHE1 is higher in cervical cancer tissues than in adjacent tissues. The high expression of lncRNA-CCHE1 is correlated with tumor quantity, extraglandular infiltration, and tumor staging. In addition, downregulation of lncRNA-CCHE1 reduces the proliferation and invasion ability of cervical cancer cell lines (16). Research by Tong et al. suggests that IGF2BP2-AS1 has higher expression in OSCC compared to normal tissue samples, and its expression is significantly correlated with patient age and T staging of OSCC, showing certain correlation with the survival rate of OSCC patients (17). Inhibition of IGF2BP2-AS1 expression in OSCC cell lines significantly reduces cell proliferation and invasion. Increasing evidence suggests that lncRNA plays an important role in diagnosis, and treatment of oral cancer (18). PRKCA-AS1, as an antisense lncRNA transcribed from the second intron of PRKCA, its expression and biological functions in OSCC are not yet clear (19). Therefore, in-depth study of the molecular mechanism of lncRNA PRKCA-AS1 is important in identifying diagnostic markers for early diagnosis and targeted therapy of OSCC. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-467/rc).
Methods
Data collection and preprocessing
Enrichment analysis of differentially expressed lncRNAs was conducted using the Kyoto Encyclopedia of Genes and Genomes (KEGG). The Database for Annotation, Visualization and Integrated Discovery (DAVID) database was utilized for performing KEGG analysis. RNA sequencing (RNA-seq) data from 370 cases (including 338 OSCC samples and 32 normal controls) were downloaded from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/). Subsequently, differential expression analysis was conducted in the R software.
Human OSCC samples
A total of 33 cases of OSCC cancer and adjacent tissue samples diagnosed and treated from December 2021 to December 2023 at the First Affiliated Hospital of Wannan Medical College (Wuhu, China) were collected. The adjacent tissue samples were collected at the locations at least 5 cm away from the edge of the primary lesion. The inclusion criteria for this study were: (I) pathologically confirmed OSCC; (II) patients who had not undergone radiotherapy or chemotherapy before surgery; (III) no serious systemic diseases; (IV) no history of long-term medication; (V) eligible for surgical treatment; (VI) patients who had signed informed consent forms. All samples were placed in RNA Store solution (Solarbio, Beijing, China) immediately after being removed in the operating room, and total RNA was rapidly extracted. Clinical pathological and medical records of patients with coding were also collected. This study was conducted in accordance with the Helsinki Declaration (revised in 2013). The study was approved by the Research Ethics Committee of Wannan Medical College {No. 2022: [9], March 3, 2022}, and informed consent were obtained from all participants or their legal guardians.
RNA extraction and real-time fluorescent quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from cultured normal human oral keratinocytes (HOK), OSCC cell lines (HN30, SCC4, CAL27), and cancer and adjacent tissue samples using Trizol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. The extracted RNA was reverse transcribed into complementary DNA (cDNA) using the Revert Aid First Strand cDNA Synthesis Kit (Thermo ScientificTM, Massachusetts, USA). The expression of the lncRNA PRKCA-AS1 gene in cells and tissues was detected using the Super Real PreMix Plus SYBR Green PCR Kit (Tiangen Biotech, Beijing, China) via RT-qPCR. The reaction system was 20 µL, and the two-step reaction program was as follows: pre-denaturation: 95 ℃ for 15 minutes; denaturation: 95 ℃ for 10 seconds; annealing: 62 ℃ for 30 seconds, with a total of 45 cycles in the PCR reaction. The RT-qPCR reaction was performed in triplicate. Gene primers were designed and synthesized by OBiO Technology (Shanghai, China) (Table 1).
Table 1
| Target | Sequence |
|---|---|
| GAPDH | F: GAAGGTGAAGGTCGGAGTC |
| R: GAAGATGGTGATGGGATTTC | |
| PRKCA-AS 1 | F: CCAGAAACCAACAGACCCCA |
| R: CGGCCAGATTTCTAAGCGCA | |
| PRKCA-AS 1-OE | F: GTAGACATAATAGCAACAGACATAC |
| R: CGCAAATGGGCGGTAGGCGTG | |
| PRKCA-AS 1-Sh | CTTTCTCTAACATCGATTTAA |
| PRKCA-AS 1-NC | CCTAAGGTTAAGTCGCCCTCG |
RT-qPCR, real-time fluorescent quantitative polymerase chain reaction; F, forward; R, reverse.
GAPDH was used as an internal reference in qPCR reactions, and the ΔCT value (ΔCT = CT value of PRKCA-AS1 − CT value of GAPDH gene); the relative expression level of cancer tissue was determined as 2−ΔΔCT, where the ΔΔCT value (ΔΔCT = ΔCT value of cancer tissue PRKCA-AS1 − ΔCT value of adjacent tissue PRKCA-AS1) (20).
Cell culture
Human normal oral epithelial cell line (HOK) and human OSCC cell lines (HN30, SCC4) were provided by the Key Laboratory of Oral Medicine, Nanjing Medical University (Nanjing, China), and the human OSCC cell line (CAL27) was purchased from Guangzhou Saike Biotechnology Co., Ltd. (Guangzhou, China). All cells are free from mycoplasma contamination. Cells were tested for mycoplasma using Mycoplasma Detection Kit from Solarbio Biotech Co., Ltd. All cells were cultured in DMEM medium (GibcoTM, Beijing, China) supplemented with 10% fetal bovine serum (Lonsera, Shanghai, China), 100 U/mL penicillin, and 100 µg/mL streptomycin, in a 5% CO2, 37 ℃ humidified incubator.
Cell transfection
PRKCA-AS1 knockdown lentivirus, overexpression lentivirus [short hairpin-PRKCA AS1 (Sh-PRKCA-AS1), overexpression-PRKCA AS1 (OE-PRKCA-AS1)], and corresponding control lentivirus [short hairpin-negative control (Sh-NC), overexpression-negative control (OE-NC)] were constructed by Obio (Shanghai, China). Following the manufacturer’s protocol, interference fragments were transfected into cells using lentiviral vector pSLenti with the assistance of polybrene as a transfection enhancer. Lentiviral overexpression vector (OE-lncRNA PRKCA-AS1), lentiviral empty vector (OE-NC), lentiviral knockdown vector (Sh-lncRNA PRKCA-AS1), lentiviral empty vector (Sh-NC), after reaching 60% confluency in the flask, puromycin (Solarbio) was added to select for transduced cells and remove untransfected cells. The cells were then cultured for an additional 5 days, total RNA was extracted, and RT-qPCR was used to detect the expression level of the target RNA, constructing stable PRKCA-AS1 knockdown cell lines.
Cell proliferation assay
Cells were seeded in a 96-well plate with HN30 cell density adjusted to 1×104 cells/well, SCC4 cell density adjusted to 1×104 cells/well, CAL27 cell density adjusted to 1×104 cells/well, with a volume of 100 µL per well. After 24, 48, 72, and 96 hours, cell counting kit-8 (CCK-8) reagent (10 µL/well) was added to the 96-well plate. After incubation in a 5% CO2, 37 ℃ incubator for 40 minutes, absorbance optical density (OD) was measured at a wavelength of 450 nm using a microplate reader (BioTek Instruments, Winooski, USA).
Cell scratch assay
Stably transfected cells were seeded in a 6-well plate at 70% confluence and cultured in a 5% CO2, 37 ℃ incubator until a monolayer of cells covering 100% of the surface area was formed. A sterile 200 µL pipette tip was used to scratch the cell layer, floating cells were carefully removed with phosphate buffer solution (PBS) (GibcoTM), and then replaced with serum-free Dulbecco’s Modified Eagle’s medium (DMEM) medium (GibcoTM) for continued culture. The scratch width was observed and photographed using an inverted microscope (Olympus, Tokyo, Japan) after 0 and 24 hours, and measurements were recorded.
Cell invasion assay
The invasive ability of OSCC cells after transfection was determined using Transwell chambers (Corning, USA) with a pore size of 8.0 µm. Matrigel (diluted 1:8 with DMEM) was added to the upper chamber and incubated in a CO2 incubator for 3 hours. After removing the upper layer, 100 µL of DMEM was added and incubated for 30 minutes. Cells starved for 24 hours in serum-free medium were seeded in the upper chamber (HN30 cell density adjusted to 8×104 cells/well, SCC4 cell density adjusted to 1×105 cells/well, CAL27 cell density adjusted to 5×104 cells/well), with a total volume of 200 µL per well in the upper chamber. Complete culture medium containing serum was added to the lower chamber. After 24 hours of incubation, cells were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and photographed and counted in five random fields of view using an inverted microscope.
Statistical analysis
All statistical analyses were performed using SPSS 25.0 software. Graphpad Prism 9.5 and ImageJ software were used for data analysis and graph plotting. Gene heatmaps were generated using TBtools software. Comparisons between two or more groups were analyzed using t-tests or rank-sum tests. The expression difference of lncRNA PRKCA-AS1 between cancer tissues and adjacent tissues was compared using paired t-tests; comparisons of lncRNA PRKCA-AS1 expression levels among OSCC patients with different clinical features were performed using non-parametric tests (Mann-Whitney U test). All experiments were conducted at least three times, and results were considered statistically significant when P<0.05.
Results
Analysis of lncRNA PRKCA-AS1 expression in gene sequencing
Differential expression of lncRNA genes in 5 pairs of OSCC tissues (T3, T5, T6, T7, T8) and adjacent tissues (N3, N5, N6, N7, N8) was visualized through a gene expression heatmap (Figure 1A). ENST00000284384 (PRKCA-AS1) showed high expression in the 5 groups of cancer tissues and low expression in the 5 groups of adjacent tissues (Figure 1A). Expression data of OSCC and normal tissues downloaded from the TCGA database also showed higher expression of PRKCA-AS1 in cancer tissues compared to normal tissues (Figure 1B). Subsequent KEGG enrichment analysis of differential lncRNAs revealed enrichment in the axon guidance and microRNAs in cancer pathways. Further intersection analysis of these two enriched pathways revealed PRKCA-AS1 as the unique intersection (Figure 1C). These results suggest that the upregulation of PRKCA-AS1 may be a risk factor for OSCC.
Expression of lncRNA PRKCA-AS1 in OSCC tissues and cell lines
Total RNA was extracted from 33 cases of OSCC tissues and their adjacent tissues, reverse transcribed into cDNA, and subjected to RT-qPCR analysis. Compared to the corresponding adjacent tissues, PRKCA-AS1 was upregulated in 28 cases and downregulated in 5 cases of cancer tissues. LncRNA PRKCA-AS1 was significantly overexpressed in cancer tissues (Figure 2A, P<0.001). Using RT-qPCR to detect PRKCA-AS1 expression in four OSCC cell lines (HN30, SCC4, SCC25, CAL27) and normal HOK, the results showed that compared to HOK cells, lncRNA PRKCA-AS1 was highly expressed in OSCC cell lines (Figure 2B, P<0.05).
Relationship between lncRNA PRKCA-AS1 expression in OSCC tissues and clinical features
Statistical analysis was conducted to assess the correlation between PRKCA-AS1 expression and clinical pathological features [age, gender, smoking history, alcohol consumption history, tumor maximum diameter, tumor infiltration depth, lymph node metastasis, pathological grade, tumor node metastasis (TNM) stage] (Table 2). The expression level of PRKCA-AS1 was correlated with tumor infiltration depth, lymph node metastasis, and TNM stage. PRKCA-AS1 expression was higher in the lymph node metastasis group compared to the non-metastasis group (5.457 vs. 2.398, P<0.001), higher in TNM stage III–IV compared to stage I–II (5.734 vs. 2.267, P<0.001), and lower in the group with tumor infiltration depth less than 0.7 cm compared to the group with depth greater than 0.7 cm (2.296 vs. 5.370, P<0.001). High expression of PRKCA-AS1 was detected in 9 cases of TNM stage I–II and 8 cases of stage III–IV (40.9% vs. 72.7%, P<0.05). The presence of high PRKCA-AS1 expression was detected in 2 patients without lymph node metastasis and 10 patients with lymph node metastasis (9.5% vs. 83.3%, P<0.01). Also, high expression of PRKCA-AS1 was detected in 2 patients with cancer tissue infiltration depth less than 0.7 cm and 14 patients with cancer tissue infiltration depth greater than 0.7 cm (14.3% vs. 73.7%, P<0.01). The findings indicate that elevated expression of PRKCA-AS1 is linked to the malignancy of OSCC.
Table 2
| Clinical indicators | Samples | Expression of PRKCA-AS1 [M (Q1, Q4)] | Z value | P value |
|---|---|---|---|---|
| Age (years) | 0.795 | 0.43 | ||
| <60 | 15 | 2.498 (2.178, 4.812) | ||
| ≥60 | 18 | 3.938 (2.080, 6.011) | ||
| Sex | −0.336 | 0.74 | ||
| Male | 25 | 3.188 (2.231, 5.734) | ||
| Female | 8 | 2.483 (1.644, 8.565) | ||
| Smoking history | −0.364 | 0.72 | ||
| No | 14 | 3.938 (2.257, 5.509) | ||
| Yes | 19 | 2.498 (1.470, 6.270) | ||
| Drinking history | −1.722 | 0.09 | ||
| No | 12 | 4.841 (2.777, 6.184) | ||
| Yes | 21 | 2.413 (1.453, 4.786) | ||
| Maximum tumor diameter (cm) | 1.470 | 0.14 | ||
| <2.0 | 8 | 2.231 (0.982, 5.405) | ||
| ≥2.0 | 25 | 3.188 (2.406, 5.907) | ||
| Tumor infiltration depth (cm) | 3.533 | <0.001 | ||
| <0.7 | 14 | 2.296 (0.984, 2.516) | ||
| ≥0.7 | 19 | 5.370 (2.639, 10.136) | ||
| Lymph node metastasis | −3.742 | <0.001 | ||
| No | 12 | 2.398 (1.259, 2.604) | ||
| Yes | 21 | 5.457 (4.225, 10.086) | ||
| Pathological stage | 1.566 | 0.12 | ||
| I–II | 30 | 2.001 (0.982, 2.533) | ||
| III–IV | 3 | 3.188 (3.188, 5.544) | ||
| TNM | 4.899 | <0.001 | ||
| I–II | 17 | 2.267 (1.033, 2.431) | ||
| III–IV | 16 | 5.734 (4.225, 10.635) |
OSCC, oral squamous cell carcinoma; TNM, tumor node metastasis.
Impact of lncRNA PRKCA-AS1 on OSCC cell proliferation
To investigate the effect of lncRNA PRKCA-AS1 on OSCC cell proliferation, we chose OSCC cell lines HN30 and SCC4 for knocking down PRKCA-AS1 and HN30, SCC4, CAL27 for overexpressing PRKCA-AS1 (Sh-PRKCA, OE-PRKCA, Figure 2C-2G). CCK-8 results showed that compared to the negative control group (Sh-NC), the proliferation rate of HN30 and SCC4 cell lines transfected with Sh-PRKCA was inhibited (P<0.05, Figure 3A,3B). However, compared to the negative control group (OE-NC), there was no statistically significant difference in the proliferation rate of the three OSCC cell lines HN30, SCC4, and CAL27 transfected with OE-PRKCA (P>0.05, Figure 3C-3E). The above results indicate that PRKCA-AS1, which is highly expressed within a certain range, can promote the proliferation ability of OSCC cell lines.
Impact of lncRNA PRKCA-AS1 on OSCC cell migration
The effect of lncRNA PRKCA-AS1 on OSCC cell migration was assessed using a scratch assay. Compared to the negative control group (Sh-NC), the migration area of HN30 and SCC4 cell lines transfected with Sh-PRKCA decreased at the same time point (P<0.05, Figure 4A,4B). However, compared to the negative control group (OE-NC), there was no statistically significant difference in the migration area of the three OSCC cell lines (HN30, SCC4, CAL27) transfected with OE-PRKCA (P>0.05, Figure 4). The above results indicate that lncRNA PRKCA-AS1, which is highly expressed within a certain range, can promotes OSCC cell migration.
Impact of lncRNA PRKCA-AS1 on OSCC cell invasion
The results indicate that compared to the negative control group (Sh-NC), the invasion ability of HN30 and SCC4 cells transfected with Sh-PRKCA was weakened (P<0.05, Figure 5A,5B). Compared to the negative control group (OE-NC), the invasion ability of HN30 cells transfected with OE-PRKCA was enhanced (P=0.001, Figure 5C), while there was no significant change in the invasion ability of SCC4 and CAL27 cells after overexpressing PRKCA-AS1 (P>0.05, Figure 5D,5E). The above results indicate that PRKCE-AS1, which is highly expressed within a certain range, can promote the invasive ability of OSCC cell lines.
Discussion
Numerous studies have indicated the significant role of lncRNAs in the occurrence and development of various malignant tumors, including OSCC (12-15). Yang et al. conducted RT-qPCR analysis of CASC9 expression using 35 OSCC tissues and corresponding adjacent tissues (21). The study results demonstrated that compared to adjacent normal tissues, CASC9 was significantly upregulated in OSCC tissues and was significantly associated with tumor size, regional lymph node metastasis, and clinical staging of OSCC. Tan et al. investigated the impact of lncRNA MEG3 on the biological activity of OSCC cell lines and its related mechanisms, demonstrating that MEG3 can inhibit the progression of OSCC (22). MEG3 acts as a sponge for mir-548D-3P, leading to decreased expression levels of mir-548D-3P, subsequently upregulating the target genes SOCS5 and SOCS6 to regulate the JAK-STAT pathway and the biological activity of OSCC cells. Our work demonstrates the partial role of lncRNA PRKCA-AS1 in OSCC. The research indicates that lncRNA PRKCA-AS1 is aberrantly expressed in OSCC tissues. Analysis of histological clinical cases reveals a positive correlation between the expression level of lncRNA PRKCA-AS1 and the depth of tumor tissue infiltration, lymph node metastasis, and TNM stage. The results directly indicating differences in the expression level of lncRNA PRKCA-AS1 among different clinical indicators, suggesting the potential of this gene for early diagnosis of OSCC. Cell genetic alteration experiments indirectly suggest that lncRNA PRKCA-AS1 may promote OSCC progression.
Cell experimental results showed that in HN30 and SCC4 cell lines, compared to cells transfected with empty plasmid, the proliferation, migration, and invasion abilities of cells transfected with PRKCA-AS1 knockdown plasmid were all inhibited. In the HN30 cell line, compared to cells transfected with empty plasmid, the invasion ability of cells transfected with overexpressed lncRNA PRKCA-AS1 plasmid was enhanced. These findings may suggest that overexpressed lncRNA PRKCA-AS1 plays a promoting role in the progression of OSCC. However, the changes in proliferation and migration abilities of cells overexpressing PRKCA-AS1 in HN30 and SCC4 were not statistically significant. To further validate the effect of overexpressed PRKCA-AS1 on OSCC, we selected CAL27 cells with relatively low expression of lncRNA PRKCA-AS1 in OSCC cell lines for overexpression-related experiments, but the results still showed no statistical difference. This may be because compared to normal oral epithelial cells, the expression level of lncRNA PRKCA-AS1 in OSCC cells has already reached a relatively high level, and overexpression of lncRNA PRKCA-AS1 cannot further promote the proliferation and migration abilities of OSCC cell lines.
Despite our investigation into the impact of the lncRNA PRKCA-AS1 on the proliferation, migration, its downstream targets are still unclear. A previous study has shown that PRKCA-AS1, an antisense lncRNA transcribed from the second intron of PRKCA, is positively correlated with DNA methylation at the promoter in rheumatic heart disease (19). However, it is still unclear whether it can exert the same mechanism in cancer. Previous research has demonstrated that the Wnt/β-catenin pathway is closely associated with cell proliferation, invasion, migration, apoptosis, and participates in the occurrence and development of OSCC (9,23). Therefore, assessing whether PRKCA-AS1 can activate the WNT/β-catenin pathway will be a key focus of research after fully verifying the carcinogenic effect of PRKCA-AS1 in OSCC cell lines.
LncRNAs may regulate the expression of various pathways involved in various cancers. Regarding PRKCA, previous studies have shown that for mRNA PRKCA, circRNA PRKCA can participate in cancer regulation through related pathways (10,22). However, there have been fewer studies on lncRNA PRKCA-AS1 in previous pathway research. The limited existing research results suggest that PRKCA-AS1 has an inflammation-induced effect, where the activated p38/MAPK pathway can inhibit the expression of PRKCA-AS1 in rheumatic heart disease, thereby suppressing PRKCA transcription (24,25). Bridging the inflammatory signaling pathway seems to be complex in different diseases, and its potential therapeutic mechanisms in cancer need further exploration. Therefore, we further investigated the gene expression levels in 33 pairs of OSCC tissues and their corresponding adjacent tissues through cancer and adjacent tissue gene sequencing and database data mining. We found that lncRNA PRKCA-AS1 indeed showed a stable differential expression trend. Over all, we demonstrated that lncRNA PRKCA-AS1 is highly expressed in OSCC tissues, thereby promoting the progression of OSCC. The epigenetic modification or selective inhibition of lncRNA PRKCA-AS1 represents a highly promising therapeutic target for targeted therapy of OSCC, providing a research basis for subsequent early diagnosis and identification of new drug. LncRNA PRKCA-AS1 has the potential to serve as a valuable biomarker for OSCC diagnosis, prognosis, and treatment.
Conclusions
In summary, our study revealed the overexpression of lncRNA PRKCA-AS1 in OSCC tissue, correlating with unfavorable outcomes in patients with OSCC. The proliferation, migration, and invasion abilities of the OSCC cell line can be suppressed by reducing the expression of lncRNA PRKCA-AS1. These findings indicate that lncRNA PRKCA-AS1 may act as a potential therapeutic agent for the diagnosis, prognosis, and treatment of OSCC.
Acknowledgments
Funding: This work was supported by
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-467/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-467/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-467/prf
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-467/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Helsinki Declaration (revised in 2013). The study was approved by the Research Ethics Committee of Wannan Medical College {No. 2022: [9], March 3, 2022}, and informed consent were obtained from all participants or their legal guardians.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Danishuddin, Haque MA, Malik MZ, et al. Unveiling the Mechanisms Underlying the Immunotherapeutic Potential of Gene-miRNA and Drugs in Head and Neck Cancer. Pharmaceuticals (Basel) 2024;17:921.
- Huang J, Chan SC, Ko S, et al. Disease burden, risk factors, and trends of lip, oral cavity, pharyngeal cancers: A global analysis. Cancer Med 2023;12:18153-64. [Crossref] [PubMed]
- Liao W, Lu J, Xu Y, et al. The Role of Infiltrated T Lymphocyte in Oral Squamous Cell Carcinoma: Insights into Clinicopathological Characteristics and Prognosis. J Inflamm Res 2024;17:2195-204. [Crossref] [PubMed]
- Chai AWY, Lim KP, Cheong SC. Translational genomics and recent advances in oral squamous cell carcinoma. Semin Cancer Biol 2020;61:71-83. [Crossref] [PubMed]
- Veluthattil AC, Sudha SP, Kandasamy S, et al. Effect of Hypofractionated, Palliative Radiotherapy on Quality of Life in Late-Stage Oral Cavity Cancer: A Prospective Clinical Trial. Indian J Palliat Care 2019;25:383-90. [Crossref] [PubMed]
- Alkhadar H, Macluskey M, White S, et al. Comparison of machine learning algorithms for the prediction of five-year survival in oral squamous cell carcinoma. J Oral Pathol Med 2021;50:378-84. [Crossref] [PubMed]
- Panarese I, Aquino G, Ronchi A, et al. Oral and Oropharyngeal squamous cell carcinoma: prognostic and predictive parameters in the etiopathogenetic route. Expert Rev Anticancer Ther 2019;19:105-19. [Crossref] [PubMed]
- Zhang Y, Zhang C, Li K, et al. Identification of Molecular Subtypes and Prognostic Characteristics of Adrenocortical Carcinoma Based on Unsupervised Clustering. Int J Mol Sci 2023;24:15465. [Crossref] [PubMed]
- Liu Z, Wu C, Xie N, et al. Long non-coding RNA MEG3 inhibits the proliferation and metastasis of oral squamous cell carcinoma by regulating the WNT/β-catenin signaling pathway. Oncol Lett 2017;14:4053-8. [Crossref] [PubMed]
- Jiang H, Fu Q, Song X, et al. HDGF and PRKCA upregulation is associated with a poor prognosis in patients with lung adenocarcinoma. Oncol Lett 2019;18:4936-46. [Crossref] [PubMed]
- Esteller M. Non-coding RNAs in human disease. Nat Rev Genet 2011;12:861-74. [Crossref] [PubMed]
- Fatima R, Akhade VS, Pal D, et al. Long noncoding RNAs in development and cancer: potential biomarkers and therapeutic targets. Mol Cell Ther 2015;3:5. [Crossref] [PubMed]
- Tan YT, Lin JF, Li T, et al. LncRNA-mediated posttranslational modifications and reprogramming of energy metabolism in cancer. Cancer Commun (Lond) 2021;41:109-20. [Crossref] [PubMed]
- McCabe EM, Rasmussen TP. lncRNA involvement in cancer stem cell function and epithelial-mesenchymal transitions. Semin Cancer Biol 2021;75:38-48. [Crossref] [PubMed]
- Li J, Meng H, Bai Y, et al. Regulation of lncRNA and Its Role in Cancer Metastasis. Oncol Res 2016;23:205-17. [Crossref] [PubMed]
- Bhan A, Mandal SS. LncRNA HOTAIR: A master regulator of chromatin dynamics and cancer. Biochim Biophys Acta 2015;1856:151-64. [PubMed]
- Tong S, Wang X, Guo X, et al. Knockdown of lncRNA IGF2BP2-AS1 inhibits proliferation and migration of oral squamous cell carcinoma cells via the Wnt/β-catenin pathway. J Oral Pathol Med 2022;51:272-80. [Crossref] [PubMed]
- Liu H, Wang D, Kan S, et al. The role of lncRNAs and XIST in oral cancer. Front Cell Dev Biol 2022;10:826650. [Crossref] [PubMed]
- Li Y, Luan C. PLCE1 Promotes the Invasion and Migration of Esophageal Cancer Cells by Up-Regulating the PKCα/NF-κB Pathway. Yonsei Med J 2018;59:1159-65. [Crossref] [PubMed]
- Qin X, Yan M, Wang X, et al. Cancer-associated Fibroblast-derived IL-6 Promotes Head and Neck Cancer Progression via the Osteopontin-NF-kappa B Signaling Pathway. Theranostics 2018;8:921-40. Erratum in: Theranostics 2022;12:1730-1. [Crossref] [PubMed]
- Yang Y, Chen D, Liu H, et al. Increased expression of lncRNA CASC9 promotes tumor progression by suppressing autophagy-mediated cell apoptosis via the AKT/mTOR pathway in oral squamous cell carcinoma. Cell Death Dis 2019;10:41. [Crossref] [PubMed]
- Tan J, Xiang L, Xu G. LncRNA MEG3 suppresses migration and promotes apoptosis by sponging miR-548d-3p to modulate JAK-STAT pathway in oral squamous cell carcinoma. IUBMB Life 2019;71:882-90. [Crossref] [PubMed]
- Lv XZ, Zheng MY, Lin ZQ, et al. Granzyme B-truncated VEGF fusion protein represses angiogenesis and tumor growth of OSCC. Oral Dis 2016;22:688-96. [Crossref] [PubMed]
- Xie Z, Wang Q, Hu S. Coordination of PRKCA/PRKCA-AS1 interplay facilitates DNA methyltransferase 1 recruitment on DNA methylation to affect protein kinase C alpha transcription in mitral valve of rheumatic heart disease. Bioengineered 2021;12:5904-15. [Crossref] [PubMed]
- Xian S, Zeng Z. Signalling pathways implicated in the pathogenesis of rheumatic heart disease Exp Ther Med 2021;21:76. (Review). [Crossref] [PubMed]

