ABALON regulates mitophagy and 5-FU sensitivity in colorectal cancer via PINK1-Parkin pathway

Introduction

In recent years, colorectal cancer (CRC) is frequently diagnosed, accounting for about 10% among yearly diagnosed cancers (1). It ranks globally the fourth most common cancer-related death with almost 900,000 deaths annually (2). Accompanied by high-throughput technology and integrated analysis of multi-omics, there has been increasing number of molecular typing systems established to guide clinical treatment of malignant tumors. The consensus molecular subtypes (CMS) developed by the International Colorectal Cancer Classification Consortium divides CRC into four molecular subtypes: CMS1, CMS2, CMS3, and CMS4, and clinical trials have begun to utilize this classification system as a leading light (3). Among these four kinds of subtypes, CMS1 subtype is characterized by deficient mismatch repair and microsatellite instability, of which the data suggest a deficiency of benefit from merely 5-fluorouracil (5-FU) chemotherapy (4,5). 5-FU, the first preferred medicine for CRC chemotherapy, could block thymidylate synthase and disrupt the synthesis of DNA and RNA (6). Despite its impact on patients’ prognosis, the lack of sensitivity of 5-FU is especially concerning for CMS1 subtype, which seriously hampers the antitumor activity. Therefore, it is necessary to strengthen the sensitivity of CRC to chemotherapeutics and explore its molecular mechanism.

Long non-coding RNAs (lncRNAs) refer to a type of RNA with length more than 200 nucleotides that are not translated into proteins (7), which can be derived from intergenic, enhancer elements, intron regions, antisense strands of genes, or other locations in the genome (8). Studies have found that lncRNAs are mainly acting as guides, decoys, tethers, and scaffolds to regulate the growth and metastasis of malignant tumors (9-13). Increasing evidences demonstrate that lncRNAs play critical roles in regulating the sensitivity of tumor cells to chemotherapeutic drugs. LncRNA NEAT1 activated autophagy by targeting miR-34a increasing the sensitivity of CRC cells to 5-FU (14). LncRNA UCA1 and CREB1 acted as competitive endogenous RNA which can sponge miR-204-5p to inhibit apoptosis of CRC cells, aggravating 5-FU resistance (15). The secretion of TGF-β1 by mesenchymal stem cells (MSCs) activated SMAD2/3, inducing upregulation of lncRNA MACC1-AS1 in gastric cancer, which further promoted tumor stemness and chemotherapy resistance (16). These evidences showed that lncRNAs were implicated in regulating the sensitivity of chemotherapy via multiple signaling pathways and interacting with different targets. Autophagy is a highly evolutionary and conservative catabolic activity that participates in the regulation of several signaling pathways in tumors (17). Mitophagy is a special form of autophagy, which selectively removes dysfunctional or surplus mitochondria, thereby maintaining the dynamic balance of mitochondrial quality (18,19). Mitophagy can retain the survival of tumor cells by removing unwanted mitochondria, thus accelerating pathological process of malignancy and influencing chemotherapy resistance. Zhu et al. reported that combined application of 5-FU and PI3K signal inhibitors in gastric cancer can repress LC3II expression and fail to digest damaged mitochondria, thus inducing cell apoptosis and enhancing 5-FU sensitivity (20). STOML2 can amplify PTEN-induced putative kinase1 (PINK1) and E3 ubiquitin ligase (Parkin) regulated mitophagy and downregulation of STOML2 expression remarkably increase the sensitivity to lenvatinib (21). PINK1 and Parkin are critical regulatory in classical mitophagy pathway. Upon mitochondrial membrane damaged, PINK1 recognizes the damaged mitochondria and aggregates on the outer membrane, which activates Parkin to promote mitochondria ubiquitination ultimately initiating mitophagy (22,23).

In this study, we found that lncRNA apoptotic BCL2L1-antisense long non-coding RNA (ABALON) was highly expressed in CRC, especially in CMS1 subtype, wherein it facilitated CRC proliferation, metastasis and repressed apoptosis. The sensitivity to 5-FU was evaluated in CRC based on inhibiting ABALON levels. Blockage of mitophagy sensibly rescued the proliferation and metastasis induced by ABALON overexpression. Inhibiting mitophagy enhanced the anti-tumor ability of 5-FU in vivo. Therefore, we proposed that ABALON serves as a potential target for CRC diagnosis, prognosis and enhances the sensitivity to 5-FU by regulating mitophagy. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-933/rc).

Methods

Clinical CRC tissues

A total of 65 CRC tissues and corresponding adjacent nontumor tissues were obtained from surgical resection at Affiliated Hospital of Nantong University (Nantong, China) between June 2017 and July 2018. All enrolled CRC patients were diagnosed based on histopathological examination and received no previous antitumor treatment, including radiotherapy or chemotherapy. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the Clinical Research Ethics Committee of the Affiliated Hospital of Nantong University (No. 2019-L053) and informed consent was taken from all the patients.

Cells and transfection

Human normal colonic epithelial cells (NCM460, RRID: CVCL_0460), and CRC cell lines DLD1 (SCSP-5241), SW480 (SCSP-5033), SW620 (TCHu101), HCT8 (TCHu 18), CACO2 (SCSP-5027), were purchased from the Chinese Academy of Sciences Committee on Type Culture Collection Cell Bank (Shanghai, China). All these cell lines were cultured in DMEM medium (Corning, Virginia, USA) which contained 10% fetal bovine serum (FBS) (Gibco, New York, USA) and 1% penicillin-streptomycin in a humid condition with 5% CO₂ at 37 ℃. DLD1 and SW480 cells (1×10⁵ cells) were seeded into 6-well plated in DMEM medium without penicillin-streptomycin for 16 hours. Next, cells in 6-well plates were transfected with 5 nmol/L ABALON shRNA, pc-DNA ABALON, siPINK1 (santa, sc44598) via 0.2% Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.

RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA of CRC tissues and cells were extracted using Trizol reagent (Invitrogen). The concentration and purity of RNA was determined with micro-spectrophotometer (Thermo Scientific, MA, USA). Whole RNA (3 µg) was reversed transcribed into cDNA using the Revert Aid First-Strand cDNA Synthesis Kit (Thermo Scientific). The expression level of ABALON was quantified using SYBR Green Master Mix (Roche, Munich, Germany) on Roche LightCycler 480 (Roche, Basel, Switzerland) according to the manufacturer’s protocol. GADPH were used as internal control. Relative amounts were calculated using the 2^−ΔΔCt method. The reaction conditions of qRT-PCR were as follows: 95 ℃ for 10 minutes, then 40 cycles at 95 ℃ for 15 seconds and 60 ℃ for 30 seconds, finally 72 ℃ seconds for 30 seconds. The primer sequences (5'-3') were shown as follows: ABALON, forward primer: GTCTCCATCTCCGATTCAGT, reverse primer: AGTGAGTGAGCAGGTGTT. GAPDH, forward primer: GGACCAATACGACCAAATCCG, reverse primer: AGCCACATCGCTCAGACAC.

Nuclear/cytosol fractionation and fluorescence in situ hybridization (FISH)

Cells were inoculated into 10-cm cell culture dishes until cells fusion rate reached 90%. Cells were treated according to the nuclear/cytosol fractionation kit (Invitrogen) for detecting the expression of lncRNA in the nucleus and cytoplasm, respectively. Cells were cultured in a 24-well plate covered with small circular discs for 24 hours. 4% paraformaldehyde and 0.5% Triton X-100 were used for fixing and permeating, respectively. Subsequently, cells were treated with 200 µL pre-hybridizing solution for 30 minutes, and 20 µM hybridizing solution (RiboBio, Guangzhou, China) overnight. Finally, the staining intensity was observed using confocal microscope.

Cell counting kit-8 (CCK-8)

The CCK-8 method was used to detect the cell viability and the effect of 5-FU on cytotoxicity. DLD1 and SW480 transfected cells (3×10³ cells/well) were seeded into 96-well plated and 10 µL CCK-8 solution (Dojindo, Kyushu, Japan) was added to each well. Subsequently, the absorbance at 450 nm was measured with a microplate reader every 24 hours. All experiments are repeated 3 times.

Colony formation and trans well assay

For the colony formation assay, a total of 1×10³ cells were seeded into six-well plates in DMEM medium and cultured for 14 days. After 2 weeks, cells were washed with phosphate-buffered saline (PBS), and fixed with 4% paraformaldehyde for 20 minutes and stained with crystal violet for 15 minutes. DLD1 and SW480 cells was collecting after transfection 48 hours, adjusting the cell density to 5×10⁵ cells/mL with DMEM medium. The matrix glue for the upper of trans well chamber (Corning) was paved in advance, and 100 µL of cell suspension was added. The lower chamber was covered with 600 µL of DMEM medium containing 20% FBS. After incubation with 48 hours, cells were fixed with 4% paraformaldehyde for 20 minutes and stained with crystal violet for 15 minutes. Wiping off the cells that have not passed through the upper chamber with a cotton swab, and observing the cell metastasis and invasion with microscope.

JC-1 staining and reactive oxygen species (ROS) detection

JC-1 probe (Fcmacs) was applied to examine the mitochondrial membrane potential. 1× JC-1 was adding into six-well plate, following the working concentration of 10 µM and incubating at 37 ℃ for 20 minutes. The red and green fluorescence intensities was observed with a fluorescent microscope. DCFH-DA (2’,7’-dichlorodihydrofluorescein diacetate) (Beyotime, Shanghai, China) was used to detect the effect of ABALON on the production of ROS. DCFH-DA was diluted with 1:1,000 in DMEM medium, with a final concentration of 10 µM; 1 mL of diluted DCFH-DA was added to each well of the six-well plate, incubated at 37 ℃ for 20 minutes, and washed three times with PBS to fully remove DCFH-DA that did not enter the cell. The green fluorescence intensity was also observed with a fluorescent microscope.

5-ethynyl-2’-deoxyuridine (EDU) proliferation

DLD1 and SW480 cells were collected and inoculated with 2×10⁴ cells per well in 96 well plate for 24 hours after transfection 48 hours. Subsequently, EDU labeling was performed with 30 µM of EDU solution (RiboBio) for 2 hours. 4% paraformaldehyde was fixed for 20 minutes and 0.5% Triton X-100 was infiltrated for 10 minutes. 1× Apollo solution was incubated in dark at room temperature for 30 minutes, and 1× Hoechst 33342 solution was used for DNA staining for 30 minutes. Finally, the staining intensity was observed using confocal microscope.

Apoptosis

For cell apoptosis detection, the transfected cells were centrifuged for 5 minutes at 1,500 rpm, and the supernatant was discarded. Binding buffer was added to re-suspend the cells (1×10⁶/mL). Then, 5 µL Annexin V-fluorescein isothiocyanate (FITC) was added and mixed gently. After adding 5 µL propidium iodide (PI) staining solution, cells were incubated at 37 ℃ for 15 minutes. Data analysis was performed using cell quest software using a flow cytometer (FACScan; Becton, Dickinson and Company, New Jersey, USA).

Tumor xenografts in nude mice

Experiments were performed under a project license (No. S20211217-005) granted by the Animal Experimental Ethics Committee of Nantong University, in compliance with the Animal Experimental Ethics Committee of Nantong University guidelines for the care and use of animals. Five-week-old nude mice (sex: female; species: BALB/C; No. of qualification: B231030195; No. of Breeding Application: R231030281) were randomly divided into five groups (n=4 per group). A total of 20 mice were used in our research. Mice were housed four mice per cage in a specific pathogen-free room with a 12 hours light/dark schedules at 25±1 ℃ and were fed an autoclaved chow diet and water ad libitum. DLD1 cells were subcutaneously injected into the mice (1.0×10⁷ cells/mouse) for the formation of the subcutaneous model. For the drugs treatment, 5-FU (10 or 20 mg/kg), chloroquine (CQ) (50 mg/kg), combined with 5-FU (20 mg/kg) and CQ (50 mg/kg) or saline as control were intraperitoneally injected into mice, upon the formation of subcutaneous model. The mice were sacrificed at a time-defined endpoint and tumor weights and volumes were assessed by double-blinded evaluation.

Western blotting analysis

Proteins were isolated from DLD1 and SW480 cell lines using Native lysis buffer (Solarbio, Beijing, China). Protein concentrations were measured by BCA kits. Equal amounts of cell protein lysates (20 µg) were separated by electrophoresis on 15% or 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, MA, USA) and blocked with 5% skimmed milk for 2 hours. Subsequently, the membranes were incubated with primary antibodies at 4 ℃ for 24 hours and incubated with the appropriate horseradish peroxidase-conjugated secondary antibody for 2 hours. Specific bands were detected by Immunoblots visualized by ECL detection system (Quantity One software, BioRad, California, USA). The specific antibody information was presented as followed: TOMM20 (1:1,000, Cell Signaling Technology #42406, Danvers, MA, USA), LC3B (1:1,000, Cell Signaling Technology #2775), Parkin (1:2,000, Proteintech 14060-1-AP, Wuhan, China), PINK1 (1:1,000, Proteintech 23274-1-AP), p62 (1:1,000, Cell Signaling Technology #5114), β-actin (1:1,000, Cell Signaling Technology #4970).

Statistical analysis

The results were presented as the mean ± standard deviation (SD). Student’s t-test was used to analyze the relative expression of CRC tissues between two groups, and one-way analysis of variance (ANOVA) was used to analyze multiple groups. Pearson correlation was employed for clinicopathological feature correlation analysis and Kaplan-Meier method was used for prognostic analysis. All experiments were repeated three times. Significant differences were considered where P<0.05 represented as * and P<0.01 represented as **. The figures were drawn using Graphpad prism 7.0.

Results

ABALON was upregulated in CRC, especially in CMS1 subtype

To explore the clinical implications of ABALON, we evaluated its expression in public The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) database. The result suggested that ABALON was significantly upregulated in various tumors, such as cholangiocarcinoma (CHOL), glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), brain lower grade glioma (LGG), liver hepatocellular carcinoma (LIHC), ovarian serous cystadenocarcinoma (OV), pancreatic adenocarcinoma (PAAD), pheochromocytoma and paraganglioma (PCPG), skin cutaneous melanoma (SKCM) and stomach adenocarcinoma (STAD), among which ABALON was significantly increased in CRC tissues than normal patients (P<0.001) (Figure 1A,1B). Consistent with the statistical results in the database, data from 65 clinical CRC tissues also indicated the expression of ABALON was much higher than matched adjacent non-cancerous tissues (P<0.05) (Figure 1C). Subsequently, we performed CMS classification based on CMS typing algorithm. ABALON was significantly upregulated in CMS1 than others (P<0.05) (Figure 1D), which is usually characterized by MSI and has a failure derived from single-agent 5-FU treatment. Correlations between ABALON expression and clinicopathological characteristics in CRC patients were summarized in Table 1, with only 47 CRC patients presenting with detailed clinical data. Our results demonstrated CRC patients with higher ABALON expression (divided by mean value) was significantly correlated with tumor differentiation, tumor node metastasis (TNM) staging, lymph node metastasis (P<0.05). To assess the role of ABALON in CRC cells, we examined the expression of ABALON in CRC cell lines (DLD1, SW480, SW620, HCT8, CACO2) and normal colon epithelial cells (NCM460) by qRT-PCR, and results showed DLD1 and SW480 cells expressed higher levels of ABALON versus NCM460 cells (P<0.01) (Figure 1E). Based on previous research, we found copy number amplification of ABALON is likely the reason for its high expression in CRC (24) (Figure 1F). Prognostic analysis indicated the expression of ABALON stratified the disease-free interval (DFI) in CRC, namely patients with high expression possessed inferior survival probability [P<0.01, hazard ratio (HR) =6.45] (Figure 1G) (http://vip.sangerbox.com/home.html). In conclusion, these data represented that upregulated ABALON may lead to CRC progression, especially in CMS1 subtype and had a significant connection with the clinicopathological characteristics and DFI in CRC.

Figure 1 ABALON was significantly upregulated in CRC tissues, especially in CMS1 subtypes. (A,B) ABALON expression across pan-cancer in TCGA and GTEx database. (C) Relative expression of ABALON in CRC tissues and adjacent normal tissues (n=65). (D) ABALON expression in different CMS subtypes. (E) The expression level of ABALON in CRC cell lines. (F) The copy number variation of ABALON in CRC. (G) Survival curves illustrating disease-free interval among patients with CRC in the high and low-risk groups using Kaplan-Meier analysis. ns, nonsense; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. GBM, glioblastoma multiforme; GBMLGG, glioblastoma multiforme lower grade glioma; LGG, brain lower grade glioma; UCEC, uterine corpus endometrial carcinoma; BRCA, breast invasive carcinoma; CESC, cervical squamous cell carcinoma and endocervical adenocarcinoma; LUAD, lung adenocarcinoma; ESCA, esophageal carcinoma; STES, stomach and esophageal carcinoma; KIRP, kidney renal papillary cell carcinoma; KIPAN, pan-kidney cohort; COAD, colon adenocarcinoma; COADREAD, colon adenocarcinoma/rectum adenocarcinoma esophageal carcinoma; PRAD, prostate adenocarcinoma; STAD, stomach adenocarcinoma; HNSC, head and neck squamous cell carcinoma; KIRC, kidney papillary cell carcinoma; LUSC, lung squamous cell carcinoma; LIHC, liver hepatocellular carcinoma; WT, high-risk Wilms tumor; SKCM, skin cutaneous melanoma; BLCA, bladder urothelial carcinoma; THCA, thyroid carcinoma; READ, rectum adenocarcinoma; OV, ovarian serous cystadenocarcinoma; PAAD, pancreatic adenocarcinoma; TGCT, testicular germ cell tumors; UCS, uterine carcinosarcoma; ALL, acute lymphoblastic leukemia; LAML, acute myeloid leukemia; PCPG, pheochromocytoma and paraganglioma; ACC, adrenocortical carcinoma; KICH, kidney chromophobe; CHOL, cholangiocarcinoma; ABALON, apoptotic BCL2L1-antisense long non-coding RNA; CMS, consensus molecular subtypes; TPM, transcripts per million; HR, hazard ratio; CI, confidence interval; L, low; H, high; CRC, colorectal cancer; TCGA, The Cancer Genome Atlas; GTEx, Genotype-Tissue Expression.

ABALON was required for CRC cell viability and proliferation

Next, the expression of ABALON in DLD1 and SW480 cells transfected with short hairpin RNA (shRNA) were confirmed using qRT-PCR, and the expression of ABALON in CACO2 cells transfected with ABALON full-length plasmid was also examined by qRT-PCR. We found that shRNA (134# and 1044#) distinctly decreased ABALON expression, compared with the shRNA negative control group (Figure 2A). In contrary, the expression of ABALON in CACO2 transfected with ABALON cDNA plasmid was significantly upregulated (Figure 2B). CCK8 assay displayed that shRNA remarkably reduced cell viability compared with shRNA negative control group in DLD1 and SW480 at 48 and 72 hours (Figure 2C), whereas ABALON overexpression accelerated cell viability in CACO2 (Figure 2D). Furthermore, knocking down ABALON in DLD1 and SW480 cells resulted in a considerable decrease of colony formation (Figure 2E), however, overexpression of ABALON in CACO2 was accompanied with enhanced colony formation (Figure 2F). EDU staining confirmed that inhibiting ABALON expression obviously reduced the red fluorescence intensity and ABALON overexpression enhanced the red fluorescence intensity, suggesting that ABALON regulated the proliferation ability of CRC cells through affecting the percentage of S-phase cells (Figure 2G,2H). These results indicated that ABALON acted as a pro-oncogene in CRC.

Figure 2 ABALON promoted CRC cell proliferation. (A) The knockdown efficiency of ABALON in DLD1 and SW480 cells transfected with shRNA. (B) The overexpression efficiency of ABALON in CACO2; the proliferation of CRC transfected with shRNA and pc-DNA, (C,D) CCK8 assay. (E,F) Colony formation assay. The staining method of colony formation assay: crystal violet staining. (G,H) EDU assay (scale bar =75 µm). *, P<0.05; **, P<0.01; ***, P<0.001. shRNA, short hairpin RNA; pcDNA, pcDNA^TM3.2/V5-DEST; shNC, short hair negative control; OD, optical density; ABALON, apoptotic BCL2L1-antisense long non-coding RNA; CRC, colorectal cancer; CCK8, cell counting kit-8; EDU, 5-ethynyl-2’-deoxyuridine.

ABALON modulated cell migration, invasion and apoptosis in CRC

Boyden chamber trans-well assay was used to observe the effect of ABALON on the metastasis ability of CRC cells. Knockdown of ABALON significantly inhibited the migration and invasion ability of DLD1 and SW480 cells (Figure 3A), while overexpression of ABALON promoted the migration and invasion ability of CACO2 cells (Figure 3B). Flow cytometry indicated that knocking down ABALON in DLD1 and SW480 markedly enhanced the percentage of total cell apoptosis (both early and late) (Figure 3C), and overexpression ABALON in CACO2, the amount of apoptosis was significantly weakened, indicating that ABALON can inhibit tumor cell apoptosis (Figure 3D). These results further validated ABALON executed oncogene function in CRC.

Figure 3 ABALON influenced migration, invasion and cell apoptosis. (A,B) Boyden chamber trans-well assay was used to validate the invasion and migration via ABALON knockdown and overexpression (scale bar =100 µm, magnification: ×40). (C,D) Flow cytometry was performed to determine the cell apoptosis after transfected with shRNA and pc-DNA and on DLD1 and SW480 cells. The staining method of trans-well assay: crystal violet staining. *, P<0.05; **, P<0.01; ***, P<0.001. shNC, short hair negative control; pcDNA, pcDNA^TM3.2/V5-DEST; FITC, fluorescein isothiocyanate; PI, propidium iodide; ABALON, apoptotic BCL2L1-antisense long non-coding RNA; shRNA, short hairpin RNA.

ABALON regulated oxidative phosphorylation

It is well known that tumor cells require mitophagy to sustain mitochondrial balance by utilizing lysosomes to consume useless mitochondria. However, the unbalanced mitochondrial degradation process would cause trouble to energy metabolism in the tumor microenvironment. ABALON belongs to the family of antisense RNA transcribed from the protein-coding gene Bcl2 like 1 (BCL2L1), which has been previously demonstrated involved in mitophagy inhibition (25-29). Accordingly, we speculated that ABALON might be implicated in mitophagy in CRC. To validate this hypothesis, we performed differential gene functional analysis of TCGA CRC patients varying ABALON high expression versus ABALON low expression. The Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analysis showed these differential expressed genes were obviously correlated with mitochondrial inner membrane, mitochondrial protein-containing complex, mitochondrial respirasome, and oxidative phosphorylation pathways (Figure 4A). KEGG also suggested ABALON was corelated with immune activation pathways, such as tumor necrosis factor (TNF) signaling via nuclear transcription factor (NF-kB) and interferon-gamma (IFN-γ) response, corresponding to high expression of ABALON in CMS1 CRC (Figure 4B). Subsequently, KEGG and gene set enrichment analysis (GESA) also confirmed autophagy pathway was closely correlated with ABALON expression (Figure 4C,4D). Nuclear/cytosol fractionation and FISH were shown ABALON was mainly expressed in the cytoplasm and may be involved in the regulation of mitochondrial function (Figure 4E,4F). DCFH-DA staining proved that ABALON was relevant to the generation of cellular ROS (Figure 4G). These results indicated ABALON was associated with oxidative phosphorylation and ROS generation in CRC cells.

Figure 4 ABALON was related with oxidative phosphorylation. (A-C) KEGG and GO analysis showed ABALON was mainly related to mitochondrial related pathways, IFN-γ response and autophagy. (D) GSEA demonstrated ABALON was implicated in autophagy pathway. (E,F) FISH and nuclear cytoplasmic fractionation showed ABALON was mainly expressed in the cytoplasm (scale bar =10 µm, magnification: ×1,000). (G) The cellular ROS generation was detected by DCFH-DA staining (scale bar =200 µm, magnification: ×400). BP, biological process; CC, cellular component; MF, molecular function; KEGG, Kyoto Encyclopedia of Genes and Genomes; ABALON, apoptotic BCL2L1-antisense long non-coding RNA; GO, Gene Ontology; IFN-γ, interferon-gamma; GSEA, gene set enrichment analysis; FISH, fluorescence in situ hybridization; ROS, reactive oxygen species; DCFH-DA, 2’,7’-dichlorodihydrofluorescein diacetate.

Knocking down ABALON inactivated mitophagy

Previous studies have confirmed mitophagy mainly occurs through two classical pathways: the PINK1/Parkin mediated ubiquitin dependent pathway and receptor mediated pathways, including BNIP3, FUNDC1 and NIX (30-34). Western blot showed the mitochondrial protein TOMM20 and autophagy related protein p62 were increased when transfected with ABALON shRNA plasmids, indicating the reduction of mitochondrial degradation. A decrease of autophagy marker cytoplasmic protein light chain 3 I (LC3I) converted to membrane protein light chain 3 II (LC3II) was detected, and the ratio of LC3II/LC3I was also decreased. Simultaneously, the expression of PINK1 and Parkin was also decreased upon knocking down ABALON (Figure 5A,5B). Conversely, an increase of LC3II, PINK1, and Parkin expression in CRC cells transfected with ABALON cDNA was demonstrated by western blot, and the mitochondrial protein TOMM20 and autophagy related protein p62 was decreased upon overexpression ABALON (Figure 5C). The mitochondrial membrane potential detection kit (JC-1 probe) showed that knocking down ABALON significantly increased the green fluorescence intensity of DLD1 and SW480 cells, indicating that ABALON inhibition enhanced the loss of mitochondrial membrane potential (Figure 5D,5E). These results indicated that ABALON regulated autophagy by affecting mitochondrial quantity.

Figure 5 ABALON regulated mitochondrial function in CRC cells. (A-C) Western blot was used to detect the expression of mitophagy associated proteins. (D,E) JC-1 staining showed knocking down ABALON increased the green fluorescence intensity (scale bar =200 µm, magnification: ×400). **, P<0.01; ***, P<0.001. shNC, short hair negative control; ABALON, apoptotic BCL2L1-antisense long non-coding RNA; CRC, colorectal cancer.

ABALON knockdown strengthened 5-FU sensitivity

According to the above studies, ABALON was higher expressed in CMS1 CRC, which is resistant to 5-FU, and exerted oncogene function. Therefore, we considered whether ABALON could regulate the chemotherapy sensitivity of 5-FU. When treated with different dosages of 5-FU, the half maximal inhibitory concentration (IC50) of DLD1, SW480 and CACO2 were 23.62, 31.33 and 18.04 µg/mL, respectively. Compared with shRNA negative control group, silencing ABALON expression was clearly able to decrease the IC50 of 5-FU in DLD1 and SW480, while overexpression of ABALON upregulated the IC50 of 5-FU in CACO2 (Figure 6A-6C). At the same contact time conditions, along with 5-FU concentration increasing, the inhibition rate of 5-FU on tumor cells significantly increased, and the inhibition rate of ABALON interference group was significantly higher than that of shRNA negative control group (Figure 6D,6E). At the same concentration of 5-FU, with the extension of contact time, the relative survival rate in each group significantly decreased, and the survival rate of CRC cells in the interference group was significantly lower than that in the shRNA negative control group (Figure 6F,6G). ABALON interference enhances the sensitivity of CRC cells to 5-FU in a concentration dependent and time-dependent manner. In brief, these studies suggested that loss of ABALON strengthen the sensitivity of CRC cells to 5-FU after interfering ABALON expression.

Figure 6 ABALON knockdown strengthened the sensitivity of CRC cells to 5-FU. (A,B) The IC50 in DLD1 and SW480 cells was reduced following ABALON knockdown. (C) The IC50 in CACO2 cells was upregulated by overexpression of ABALON. (D-G) The effect of 5-FU with different concentration and time on the inhibition and viability of DLD1 and SW480 cells. *, P<0.05; **, P<0.01. IC50, the half maximal inhibitory concentration; 5-FU, 5-fluorouracil; shNC, short hair negative control; ABALON, apoptotic BCL2L1-antisense long non-coding RNA; CRC, colorectal cancer.

Inhibiting mitophagy enhanced the anti-tumor ability of 5-FU

To investigate whether ABALON regulated 5-FU chemosensitivity by mitophagy in CRC cells, si-PINK1 and autophagy inhibitors (CQ) were employed for mitophagy inhibition. Flow cytometry was used to detect the effects of inhibiting mitophagy on apoptosis. Inhibiting ABALON expression evidently promoted the apoptosis levels of DLD1 cells, while mitophagy inhibition clearly diminished the apoptosis ability (Figure 7A). Correspondingly, inhibiting mitophagy in CACO2 cells sensibly reversed the decrease of apoptosis induced by ABALON overexpression (Figure 7B). Colony formation and trans-well assay were used to verify the effect of inhibiting mitophagy on the proliferation and metastasis. Mitophagy inhibition weaken the cloning and metastasis of DLD1 cells (Figure 7C,7D and Figures S1,S2). Besides, PINK1 siRNA or CQ reversed the increased colony formation and metastasis caused by ABALON overexpression (Figure 7E,7F and Figures S3,S4). We further validated the effects of 5-FU and mitophagy blockage on tumor growth in vivo. Xenograft models confirmed that 5-FU (10 or 20 mg/kg) and mitophagy inhibitors (CQ 50 mg/kg) restrained tumor tumorigenesis. The combination of 5-FU (20 mg/kg) and CQ (50 mg/kg) deeply impeded tumor growth (Figure 7G,7H). In summary, these in vitro and in vivo experiments fully demonstrated ABALON administrated vital roles in mitophagy, which promoting the progression of CRC and inhibiting mitophagy enhanced the anti-tumor effect of 5-FU. Figure 7I was shown the graphic description.

Figure 7 Inhibition of mitophagy enhanced the sensitivity to 5-FU treatment. DLD1 and CACO2 were co-treated with 5-FU and CQ (the autophagy inhibitor, 5 µM) or transfected with siPINK1. (A) With the treatment of 5-FU, ABALON knockdown increased the apoptosis ability of DLD1 cells, and mitophagy inhibition weaken the apoptosis. (B) CACO2 transfected with siPINK1 or treated with CQ reversed the apoptotic cells induced by ABALON overexpression. (C-F) Transfection with siPINK1 or CQ treatment inhibited the colony formation and migration. (G,H) The effect of 5-FU (10 or 20 mg/kg) and CQ (50 mg/kg) on nude mice growth. (I) Graphic description shown the regulatory mechanism. ns, nonsense; *, P<0.05; **, P<0.01; ***, P<0.001. 5-FU, 5-fluorouracil; WT, high-risk Wilms tumor; shNC, short hair negative control; CQ, chloroquine; PI, propidium iodide; pcDNA, pcDNA^TM3.2/V5-DEST; ABALON, apoptotic BCL2L1-antisense long non-coding RNA; CNV, copy number variation.

Discussion

Chemotherapy still occupies an indispensable position in cancer treatment, and the main reason for the failure of chemotherapy is drug resistance. Whether it is preexisting innate drug resistance or acquired secondary drug resistance, the abnormal activation of intracellular signaling pathways are closely related to tumor drug resistance. In recent years, the mechanisms of lncRNAs in antitumor drug resistance have been gradually discovered. LncRNAs can repair abnormal DNA damage, change the drug efflux system, enhance tumor cell apoptosis, promote cell cycle changes, induce epithelial-mesenchymal transition, and lncRNA can also target miRNA binding through endogenous competitive RNA ways to participate in drug resistance (35). In this study, we firstly investigated if lncRNA ABALON can affect the sensitivity of CRC cells to 5-FU.

According to existing studies, the roles of lncRNAs in mitophagy mainly occur in metabolic diseases such as diabetes, nonalcoholic fatty liver, or traumatic injure-like organ ischemia reperfusion (36-39). LncRNA MEG3 inhibited mitophagy through Rac1/ROS/FUNDC1 axis thus ameliorating the cognitive dysfunction caused by diabetes (40). LncRNA NEAT1 inhibited mitophagy through miR-150-5P/DRP1 axis and promoted the damage of renal tubular epithelial cells (HK-2) induced by high glucose. Knockout of NEAT1 in HK-2 cells attacked by high glucose enhanced mitophagy, thus inhibiting the production of ROS and the release of lactate dehydrogenase (LDH) (41). Another study had shown that lncRNA SNHG14 can promote mitophagy in mouse hippocampal neuronal cells to establish a cerebral ischemia-reperfusion model through miR-182-5p/BNIP3 signal axis (42). LncRNA SNHG17 knockdown amplified Parkin-dependent mitophagy and reduced cell apoptosis of podocytes through regulating MST1 degradation (43). DNA methylation induced downregulation of lncRNA H19 expression plays a key role in the metabolic disorders of cardiomyocytes and induces cardiac respiratory dysfunction by promoting mitophagy. LncRNA H19 may inhibit excessive mitophagy by restricting the translation of PINK1 mRNA, thereby reducing heart defect that occurs during obesity (44). However, few studies have revealed that lncRNAs are involved in mitophagy with respect to malignancies.

In our research, we initially found that lncRNA-ABALON was highly expressed in CRC, and CRC patients with high ABALON expression were associated with tumor differentiation, TNM staging, lymph node metastasis. Knockdown of ABALON significantly inhibited proliferation, colony formation, migration and promoted apoptosis of tumor cells, revealing that ABALON mainly functioned as an oncogene. In addition, interference of ABALON could especially decrease LC3II, PINK1, and Parkin expression, instead of upregulating TOMM20 and p62 expression, which was manifested by reduced mitochondrial degradation. And, overexpression of ABALON demonstrated an increase of LC3II, PINK1, and Parkin expression and decreased expression of TOMM20 and p62. These results revealed that ABALON exerted critical effect in regulating mitophagy through PINK1/Parkin pathway, while the specific regulation mechanism of ABALON presenting in mitophagy is still unclear, deserved for in-depth prospecting.

Mitophagy administrates the balance of mitochondrial quality and quantity, through selectively removing redundant mitochondria. Increasing evidence has exhibited that mitophagy is influential for cancer stemness, immune infiltration, radio-resistance or chemotherapy resistance, etc. When mitophagy is enhanced, the p53 gene can co-localize with mitochondria, and mitochondria can be removed through a mitophagy-dependent pathway. When mitophagy is weakened, p53 is phosphorylated by PINK1 at the serine-392 site and further transferred into the nucleus, which binds to the NANOG promoter, ultimately leading to a reduction in the number of liver cancer stem cells (45). LACTB2 promoted mitophagy and enhanced radio-resistance of nasopharyngeal carcinoma (NPC) by interacting with the N-terminal domain of PINK1, and thus served as a prognostic biomarker for NPC radiotherapy (46). More interestingly, when tumor-infiltrating T lymphocytes (TILs) accumulated depolarized mitochondria on account of decreased mitophagy activity, TILs were gradually committed to the exhaustion program (47). However, the study of mitophagy in CRC chemotherapy resistance remains unclear. In the present study, we found that inhibition of ABALON significantly reduced the IC50 of CRC cells to 5-FU, and overexpression of ABALON upregulated the IC50 of CACO2 to 5-FU. Transfected cells with siRNA-PINK1 reversed the enhanced colony formation and migration ability of CACO2 cells induced by ABALON overexpression, and up-regulated the impaired apoptosis level of ABALON overexpression. Therefore, we propose the hypothesis that inhibiting mitophagy enhances the sensitivity of CRC cells to 5-FU, however, the specific regulatory mechanism deserves further study. This study links the relationship between ABALON and CRC drug resistance and its role in CRC mitophagy.

Conclusions

ABALON was overexpressed in CRC and associated with advanced CRC stage, lymph node metastasis. ABALON promoted mitophagy and modulated CRC cell chemosensitivity to 5-FU. The present study provides a novel sight for CRC tumorigenesis and confirms the potential value of ABALON for CRC diagnosis and therapy.

Acknowledgments

Funding: This study was supported by the National Nature Science Foundation (grant number: 81972015), The Social Development Project from Jiangsu Provincial Department of Science and Technology (grant number: BE2020770) and The Health Commission of Nantong (grant number: QA2021038).

Footnote

Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-933/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-933/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-933/prf

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-24-933/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the Clinical Research Ethics Committee of the Affiliated Hospital of Nantong University (No. 2019-L053) and informed consent was taken from all the patients. Experiments were performed under a project license (No. S20211217-005) granted by the Animal Experimental Ethics Committee of Nantong University, in compliance with the Animal Experimental Ethics Committee of Nantong University guidelines for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018;68:394-424. [Crossref] [PubMed]
2. Dekker E, Tanis PJ, Vleugels JLA, et al. Colorectal cancer. Lancet 2019;394:1467-80. [Crossref] [PubMed]
3. Guinney J, Dienstmann R, Wang X, et al. The consensus molecular subtypes of colorectal cancer. Nat Med 2015;21:1350-6. [Crossref] [PubMed]
4. André T, de Gramont A, Vernerey D, et al. Adjuvant Fluorouracil, Leucovorin, and Oxaliplatin in Stage II to III Colon Cancer: Updated 10-Year Survival and Outcomes According to BRAF Mutation and Mismatch Repair Status of the MOSAIC Study. J Clin Oncol 2015;33:4176-87. [Crossref] [PubMed]
5. Vilar E, Gruber SB. Microsatellite instability in colorectal cancer-the stable evidence. Nat Rev Clin Oncol 2010;7:153-62. [Crossref] [PubMed]
6. García-Alfonso P, Muñoz Martín AJ, Ortega Morán L, et al. Oral drugs in the treatment of metastatic colorectal cancer. Ther Adv Med Oncol 2021;13:17588359211009001. [Crossref] [PubMed]
7. Kopp F, Mendell JT. Functional Classification and Experimental Dissection of Long Noncoding RNAs. Cell 2018;172:393-407. [Crossref] [PubMed]
8. Djebali S, Davis CA, Merkel A, et al. Landscape of transcription in human cells. Nature 2012;489:101-8. [Crossref] [PubMed]
9. Guttman M, Donaghey J, Carey BW, et al. lincRNAs act in the circuitry controlling pluripotency and differentiation. Nature 2011;477:295-300. [Crossref] [PubMed]
10. Loewer S, Cabili MN, Guttman M, et al. Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells. Nat Genet 2010;42:1113-7. [Crossref] [PubMed]
11. Khaitan D, Dinger ME, Mazar J, et al. The melanoma-upregulated long noncoding RNA SPRY4-IT1 modulates apoptosis and invasion. Cancer Res 2011;71:3852-62. [Crossref] [PubMed]
12. Wang KC, Yang YW, Liu B, et al. A long noncoding RNA maintains active chromatin to coordinate homeotic gene expression. Nature 2011;472:120-4. [Crossref] [PubMed]
13. Tsai MC, Manor O, Wan Y, et al. Long noncoding RNA as modular scaffold of histone modification complexes. Science 2010;329:689-93. [Crossref] [PubMed]
14. Liu F, Ai FY, Zhang DC, et al. LncRNA NEAT1 knockdown attenuates autophagy to elevate 5-FU sensitivity in colorectal cancer via targeting miR-34a. Cancer Med 2020;9:1079-91. [Crossref] [PubMed]
15. Bian Z, Jin L, Zhang J, et al. LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p. Sci Rep 2016;6:23892. [Crossref] [PubMed]
16. He W, Liang B, Wang C, et al. MSC-regulated lncRNA MACC1-AS1 promotes stemness and chemoresistance through fatty acid oxidation in gastric cancer. Oncogene 2019;38:4637-54. [Crossref] [PubMed]
17. Smith AG, Macleod KF. Autophagy, cancer stem cells and drug resistance. J Pathol 2019;247:708-18. [Crossref] [PubMed]
18. Georgakopoulos ND, Wells G, Campanella M. The pharmacological regulation of cellular mitophagy. Nat Chem Biol 2017;13:136-46. [Crossref] [PubMed]
19. Youle RJ, Narendra DP. Mechanisms of mitophagy. Nat Rev Mol Cell Biol 2011;12:9-14. [Crossref] [PubMed]
20. Zhu BS, Sun JL, Gong W, et al. Effects of 5-fluorouracil and class III phosphoinositide 3-kinase small interfering RNA combination therapy on SGC7901 human gastric cancer cells. Mol Med Rep 2015;11:1891-8. [Crossref] [PubMed]
21. Zheng Y, Huang C, Lu L, et al. STOML2 potentiates metastasis of hepatocellular carcinoma by promoting PINK1-mediated mitophagy and regulates sensitivity to lenvatinib. J Hematol Oncol 2021;14:16. [Crossref] [PubMed]
22. Mancias JD, Kimmelman AC. Mechanisms of Selective Autophagy in Normal Physiology and Cancer. J Mol Biol 2016;428:1659-80. [Crossref] [PubMed]
23. Jin SM, Lazarou M, Wang C, et al. Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL. J Cell Biol 2010;191:933-42. [Crossref] [PubMed]
24. Liu H, Gu X, Wang G, et al. Copy number variations primed lncRNAs deregulation contribute to poor prognosis in colorectal cancer. Aging (Albany NY) 2019;11:6089-108. [Crossref] [PubMed]
25. Lazarou M, Jin SM, Kane LA, et al. Role of PINK1 binding to the TOM complex and alternate intracellular membranes in recruitment and activation of the E3 ligase Parkin. Dev Cell 2012;22:320-33. [Crossref] [PubMed]
26. Wu H, Xue D, Chen G, et al. The BCL2L1 and PGAM5 axis defines hypoxia-induced receptor-mediated mitophagy. Autophagy 2014;10:1712-25. [Crossref] [PubMed]
27. Yu S, Du M, Yin A, et al. Bcl-xL inhibits PINK1/Parkin-dependent mitophagy by preventing mitochondrial Parkin accumulation. Int J Biochem Cell Biol 2020;122:105720. [Crossref] [PubMed]
28. Ma K, Zhang Z, Chang R, et al. Dynamic PGAM5 multimers dephosphorylate BCL-xL or FUNDC1 to regulate mitochondrial and cellular fate. Cell Death Differ 2020;27:1036-51. [Crossref] [PubMed]
29. Hollville E, Carroll RG, Cullen SP, et al. Bcl-2 family proteins participate in mitochondrial quality control by regulating Parkin/PINK1-dependent mitophagy. Mol Cell 2014;55:451-66. [Crossref] [PubMed]
30. Wang S, Long H, Hou L, et al. The mitophagy pathway and its implications in human diseases. Signal Transduct Target Ther 2023;8:304. [Crossref] [PubMed]
31. Park J, Lee SB, Lee S, et al. Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 2006;441:1157-61. [Crossref] [PubMed]
32. Chinnadurai G, Vijayalingam S, Gibson SB. BNIP3 subfamily BH3-only proteins: mitochondrial stress sensors in normal and pathological functions. Oncogene 2008;27:S114-27. [Crossref] [PubMed]
33. Diwan A, Koesters AG, Odley AM, et al. Unrestrained erythroblast development in Nix-/- mice reveals a mechanism for apoptotic modulation of erythropoiesis. Proc Natl Acad Sci U S A 2007;104:6794-9. [Crossref] [PubMed]
34. Zhang W. The mitophagy receptor FUN14 domain-containing 1 (FUNDC1): A promising biomarker and potential therapeutic target of human diseases. Genes Dis 2020;8:640-54. [Crossref] [PubMed]
35. Liu K, Gao L, Ma X, et al. Long non-coding RNAs regulate drug resistance in cancer. Mol Cancer 2020;19:54. [Crossref] [PubMed]
36. Wang S, Tao J, Chen H, et al. Ablation of Akt2 and AMPKα2 rescues high fat diet-induced obesity and hepatic steatosis through Parkin-mediated mitophagy. Acta Pharm Sin B 2021;11:3508-26. [Crossref] [PubMed]
37. Wu H, Wang Y, Li W, et al. Deficiency of mitophagy receptor FUNDC1 impairs mitochondrial quality and aggravates dietary-induced obesity and metabolic syndrome. Autophagy 2019;15:1882-98. [Crossref] [PubMed]
38. Zhang NP, Liu XJ, Xie L, et al. Impaired mitophagy triggers NLRP3 inflammasome activation during the progression from nonalcoholic fatty liver to nonalcoholic steatohepatitis. Lab Invest 2019;99:749-63. [Crossref] [PubMed]
39. Lin Q, Li S, Jiang N, et al. PINK1-parkin pathway of mitophagy protects against contrast-induced acute kidney injury via decreasing mitochondrial ROS and NLRP3 inflammasome activation. Redox Biol 2019;26:101254. [Crossref] [PubMed]
40. Wang Z, Xia P, Hu J, et al. LncRNA MEG3 Alleviates Diabetic Cognitive Impairments by Reducing Mitochondrial-Derived Apoptosis through Promotion of FUNDC1-Related Mitophagy via Rac1-ROS Axis. ACS Chem Neurosci 2021;12:2280-307. [Crossref] [PubMed]
41. Yang DY, Zhou X, Liu ZW, et al. LncRNA NEAT1 accelerates renal tubular epithelial cell damage by modulating mitophagy via miR-150-5p-DRP1 axis in diabetic nephropathy. Exp Physiol 2021;106:1631-42. [Crossref] [PubMed]
42. Deng Z, Ou H, Ren F, et al. LncRNA SNHG14 promotes OGD/R-induced neuron injury by inducing excessive mitophagy via miR-182-5p/BINP3 axis in HT22 mouse hippocampal neuronal cells. Biol Res 2020;53:38. [Crossref] [PubMed]
43. Guo F, Wang W, Song Y, et al. LncRNA SNHG17 knockdown promotes Parkin-dependent mitophagy and reduces apoptosis of podocytes through Mst1. Cell Cycle 2020;19:1997-2006. [Crossref] [PubMed]
44. Wang SH, Zhu XL, Wang F, et al. LncRNA H19 governs mitophagy and restores mitochondrial respiration in the heart through Pink1/Parkin signaling during obesity. Cell Death Dis 2021;12:557. [Crossref] [PubMed]
45. Liu K, Lee J, Kim JY, et al. Mitophagy Controls the Activities of Tumor Suppressor p53 to Regulate Hepatic Cancer Stem Cells. Mol Cell 2017;68:281-292.e5. [Crossref] [PubMed]
46. Chen Q, Zheng W, Zhu L, et al. LACTB2 renders radioresistance by activating PINK1/Parkin-dependent mitophagy in nasopharyngeal carcinoma. Cancer Lett 2021;518:127-39. [Crossref] [PubMed]
47. Yu YR, Imrichova H, Wang H, et al. Disturbed mitochondrial dynamics in CD8(+) TILs reinforce T cell exhaustion. Nat Immunol 2020;21:1540-51. [Crossref] [PubMed]