Nicotine-induced PD-L1 expression in lung squamous cell carcinoma is mediated by the α7-nAChR/STAT3 signaling pathway
Highlight box
Key findings
• Nicotine activates the α7 nicotinic acetylcholine receptor (α7-nAChR)/signal transducer and activator of transcription 3 (STAT3) axis to upregulate programmed death-ligand 1 (PD-L1) in lung squamous cell carcinoma (LUSC).
What is known and what is new?
• Nicotine promotes tumor growth through α7-nAChR. PD-L1 mediates immune evasion in.
• First demonstration that nicotine directly upregulates PD-L1 in LUSC via α7-nAChR/STAT3. Identifies CHRNA7 as a smoking-linked prognostic marker and actionable target.
What is the implication, and what should change now?
• Smoking may compromise immune checkpoint inhibitor (ICI) efficacy by nicotine-driven PD-L1 induction. α7-nAChR/STAT3 pathway could predict ICI resistance.
• Clinical studies to validate α7-nAChR as a biomarker for smoker LUSC patients. Develop α7-nAChR antagonists to enhance ICI responses. Strengthen smoking cessation programs for LUSC patients.
Introduction
Lung cancer remains the leading cause of cancer-related mortality worldwide (1). Lung squamous cell carcinoma (LUSC), the second most common histological subtype, accounts for 30% of all primary pulmonary malignancies (2). Extensive epidemiological studies have confirmed that smoking is a major risk factor for non-small cell lung cancer (NSCLC), with squamous cell carcinoma showing a stronger association with cigarette smoking compared to other histological subtypes. Most patients with LUSC have extensive smoking histories (2,3).
Nicotine, the primary addictive component in cigarette smoke, activates the nervous system and modulates various physiological responses (4,5) through direct interaction with and activation of nicotinic acetylcholine receptors (nAChRs) on cell membranes. Recent study demonstrated that nAChRs are widely expressed in various solid tumors, including lung, breast, and colorectal cancers (6). Ongoing research into the molecular structure and function of the nAChR family has revealed that multiple subtypes of nAChRs can be activated by nicotine and its derivatives, specifically regulating numerous tumorigenesis-related signaling cascades.
Signal transducer and activator of transcription 3 (STAT3), a member of the cytoplasmic transcription factor family, is activated by various cytokines, growth factors, and oncogenic signals and translocates to the nucleus to activate gene transcription. It is considered to play crucial roles in regulating every stage of cellular life “from birth to death” (7). STAT3 regulates fundamental cellular processes, including inflammation, cell growth, proliferation, differentiation, migration, and apoptosis. In tumor cells, activated STAT3 can promote uncontrolled cell proliferation by generating and maintaining cancer stem cells (CSCs), upregulating anti-apoptotic proteins, and inducing resistance to cytotoxic and targeted drugs (8,9).
Moreover, STAT3 induces vascular endothelial growth factor (VEGF) expression in endothelial cells and promotes angiogenesis within the tumor microenvironment (10). It also facilitates tumor invasion and epithelial-mesenchymal transition by inducing the synthesis of matrix metalloproteinases (MMPs) (11). Additionally, dysregulated STAT3 in various immune cells upregulates immunosuppressive factors such as interleukin-10 (IL-10) in the tumor microenvironment, impairs dendritic cell (DC) maturation, and inhibits tumor antigen presentation to the cellular immune system. Furthermore, it modulates the programmed cell death protein 1 (PD-1) or programmed death-ligand 1 (PD-L1) immune checkpoint and directly suppresses the anti-tumor activity of cytotoxic T cells, thereby contributing to tumor immune evasion (12).
In recent years, PD-1/PD-L1 immune checkpoint inhibitors (ICIs) have demonstrated remarkable clinical efficacy in treating LUSC and other malignancies (13). Studies have revealed that lung cancer patients with smoking history show better responses to PD-L1 therapy (14,15) compared to non-smokers. Moreover, Nguyen et al. have demonstrated that nicotine can upregulate PD-L1 expression in melanoma cell lines through α9-nAChR signaling (16). In LUSC tissues, multiple nAChR subtypes are upregulated, particularly α7-nAChR, suggesting its potential as a therapeutic target (17,18).
This study aims to investigate the expression patterns of α7-nAChR and its encoding gene CHRNA7 in LUSC and their correlation with PD-L1, providing a theoretical basis for LUSC clinical treatment strategies. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2587/rc).
Methods
Bioinformatics analysis
RNA sequencing (RNA-Seq) data from LUSC patients and their corresponding clinicopathological parameters were obtained from The Cancer Genome Atlas (TCGA) database (http://portal.gdc.cancer.gov/). After data filtering and normalization, sequencing data from 193 LUSC tissues and 58 normal lung tissues were included in the analysis. Patients were stratified into high and low expression groups based on the median CHRNA7 messenger RNA (mRNA) expression levels.
Study population
Thirty-two LUSC tissue samples were collected from patients who underwent surgical resection at the Department of Thoracic Surgery, Qingdao Municipal Hospital, between December 2019 and July 2020. All samples were pathologically confirmed. The cohort comprised 27 males and five females, aged 54–84 years. None of the patients had received prior chemotherapy, radiotherapy, nor targeted therapy. Complete clinical data were available for all patients. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Clinical Trial Ethics Committee of Qingdao Municipal Hospital (No. 2024-KY-074) and informed consent was taken from all the patients.
Cell culture and small interfering RNA (siRNA) transfection
Three cell lines were used in this study: SK-MES-1 (Homo sapiens, human LUSC, Procell Life Science & Technology Co., Ltd., Wuhan, China, Cat#CL-0213), H520 (Homo sapiens, human LUSC, Procell Life Science & Technology Co., Ltd., Cat#CL-0402), and BEAS-2B (Homo sapiens, human normal bronchial epithelial cells, Procell Life Science & Technology Co., Ltd., Cat#CL-0496). Cells were cultured in either RPMI 1640 medium or minimum essential medium (MEM) (Wuhan Procell Life Science & Technology Co., Ltd., Wuhan, China) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin antibiotic mixture (Gibco, Grand Island, NY, USA). Cells were cultured at 37 ℃ in a humidified atmosphere containing 5% CO2. All cell lines were authenticated using short tandem repeat (STR) analysis (Procell). SK-MES-1 and H520 cells were treated with varying concentrations of nicotine or phosphate-buffered saline (PBS) (control), and gene expression levels were analyzed using quantitative real-time polymerase chain reaction (qRT-PCR). Target-specific and control siRNAs were synthesized by RayBiotech (Guangzhou, China). siRNA transfections were performed using riboFECT™ CP according to the manufacturer’s protocol.
RNA extraction and qRT-PCR
Total RNA was extracted using RNAiso Plus reagent (Takara, Dalian, China) according to the manufacturer’s instructions. Reverse transcription and qRT-PCR were performed using the PrimeScript RT Reagent Kit (Takara) and TB Green® Premix Ex Taq II (Takara), respectively. All primers were synthesized by Sangon Biotech (Shanghai, China), and their sequences are presented in Table 1.
Table 1
| Genes | Forward primer (5'-3') | Reverse primer (5'-3') |
|---|---|---|
| CHRNA7 | CCGACTCTGGGTAGTGTGT | ATGGTGCAGATGATGGTGAA |
| STAT3 | CAGCAGCTTGACACACGGTA | AAACACCAAAGTGGCATGTGA |
| CD274 | TGGCATTTGCTGAACGCATTT | TGCAGCCAGGTCTAATTGTTTT |
| GAPDH | CAACGTGTCAGTGGTGGACCTG | GTGTCGCTGTTGAAGTCAGAGGAG |
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; STAT3, signal transducer and activator of transcription 3.
Western blot (WB)
Total cellular proteins were extracted using radioimmunoprecipitation assay (RIPA) lysis buffer and quantified using a bicinchoninic acid (BCA) protein assay kit (Elabscience, Wuhan, China). Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Ballerica, MA, USA). The membranes were blocked with 5% non-fat milk and then incubated overnight at 4 ℃ with the following primary antibodies: anti-α7-nAChR (Affinity Biosciences, Changzhou, China), anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Abcam, Cambridge, MA, USA), anti-STAT3 (Hua Bio, Hangzhou, China), anti-STAT3 phosphorylation (pSTAT3) (Hua Bio), and anti-PD-L1 (Hua Bio). After incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam; 1:4,000 dilution) for 2 hours at room temperature, protein bands were visualized using a chemiluminescence imaging system.
Immunohistochemistry
Tissue sections were fixed in 10% neutral buffered formalin for 24 hours, followed by deparaffinization and rehydration through a graded alcohol series. Antigen retrieval was performed using citrate buffer (pH 6.0). Endogenous peroxidase activity was blocked with 3% hydrogen peroxide, and non-specific binding was blocked with 10% goat serum (ZSGB-BIO, Beijing, China). Sections were then incubated overnight at 4 ℃ with primary antibodies (dilution 1:200) in a humidified chamber. Immunodetection was performed using HRP-conjugated secondary antibodies with 3,3'-diaminobenzidine (DAB) as the chromogen.
Immunostaining was evaluated based on both the percentage of positive cells and staining intensity. Five random fields were examined at 100× magnification. The percentage of positive cells was scored as follows: ≤25% [1], 26–50% [2], 51–75% [3], and 76–100% [4]. Staining intensity was graded as negative [0], weak [1], moderate [2], and strong [3]. The final score was calculated by multiplying these two parameters, with scores <6 classified as low α7-nAChR expression and ≥6 as high expression. PD-L1 expression was assessed using the Roche VENTANA automated immunostaining platform (Tucson, AZ, USA). Tumor proportion score (TPS) for PD-L1 was categorized as TPS <50% or TPS ≥50%, according to the criteria established in the KEYNOTE-024 and KEYNOTE-010 clinical trials.
Statistical analysis
All statistical analyses were performed using Origin 2021 and GraphPad Prism 9 software. The Kolmogorov-Smirnov test was used to assess data normality. For normally distributed continuous variables, comparisons between the two groups were conducted using Student’s t-test, while correlations were evaluated using Pearson correlation analysis. Comparisons among three or more groups were performed using one-way analysis of variance (ANOVA). Non-parametric tests were applied for non-normally distributed variables. Categorical variables were compared using either Chi-squared test or Fisher’s exact test, as appropriate, and univariate logistic regression was performed for clinical and pathological parameters. Survival analyses were conducted using the Kaplan-Meier method with log-rank test.
Results
CHRNA7/α7-nAChR expression and its correlation with clinicopathological features and prognosis
Analysis of TCGA database data revealed significantly higher CHRNA7 mRNA expression in 193 LUSC tissues compared to 58 normal lung tissues (P<0.001; Figure 1A). This elevated CHRNA7 expression in LUSC tissues suggests its potential involvement in tumor development and progression.
While CHRNA7 expression showed no significant correlation with patients’ age, sex, tumor size, lymph node metastasis, distant metastasis, tumor-node-metastasis (TNM) stage, or histological type (P>0.05; Figure 1B), it was significantly associated with patients’ smoking status (P=0.01, 0.02; Figure 1B). Non-smokers and reformed smokers exhibited lower CHRNA7 expression levels compared to current smokers (P<0.05; Figure 1C), indicating that nicotine exposure might upregulate CHRNA7 expression in tumor tissues.
Among the 108 smoking patients, Kaplan-Meier analysis demonstrated that those with high CHRNA7 expression had significantly shorter overall survival [hazard ratio (HR) =2.522; 95% confidence interval (CI): 1.301–4.890; P=0.02; Figure 1D], suggesting that elevated CHRNA7 expression is associated with poor prognosis.
Immunohistochemical analysis of specimens from 32 LUSC patients revealed significantly higher α7-nAChR expression in LUSC tissues compared to adjacent non-tumorous lung tissues (P<0.001; Figure 1E). Consistent with the TCGA database findings, α7-nAChR expression was significantly higher in current smokers compared to non-smokers and former smokers (P=0.048, 0.02; Figure 1F). No significant associations were observed between α7-nAChR expression and patient sex, tumor size, lymph node metastasis, or TNM stage (all P>0.05; Figure 1G).
Correlation between α7-nAChR and PD-L1 expression in LUSC
Immunohistochemical staining showed that α7-nAChR was predominantly localized to the cell membrane and cytoplasm of tumor cells, while PD-L1 expression was restricted to the cell membrane (Figure 2A). Using the scoring criteria described in the methods, Fisher’s exact test demonstrated that patients with high α7-nAChR expression exhibited significantly higher PD-L1 TPS (P<0.001; Figure 2B). Pearson correlation analysis revealed a strong positive correlation between α7-nAChR staining scores and PD-L1 TPS in tumor tissues (r=0.610, P<0.001; Figure 2C).
Nicotine-induced regulation of α7-nAChR, STAT3, and CD274 expression in LUSC cell lines
Expression analysis revealed significantly higher α7-nAChR levels in LUSC cell lines (SK-MES-1 and H520) compared to the normal bronchial epithelial cell line BEAS-2B (P=0.03 and 0.002, respectively; Figure 3A).
Nicotine treatment enhanced CHRNA7 mRNA expression in H520 cells and simultaneously upregulated STAT3 and CD274 expression (Figure 3B). Notably, at 1.0 µM nicotine concentration, significant increases were observed in the expression levels of CHRNA7 (P=0.03), STAT3 (P=0.046), and CD274 (P=0.04) compared to untreated controls. These findings suggest that α7-nAChR may play a regulatory role in STAT3 and CD274 expression.
Impact of CHRNA7 and STAT3 silencing on α7-nAChR, STAT3, pSTAT3, and PD-L1 expression in LUSC cell lines
To investigate whether α7-nAChR mediates nicotine-induced upregulation of STAT3 and PD-L1, we employed CHRNA7-specific siRNA. Nicotine treatment (1 µM) increased both PD-L1 protein expression and pSTAT3 in LUSC cells (Figure 4A). CHRNA7 silencing significantly decreased α7-nAChR expression (P<0.001), reduced pSTAT3 (P=0.04), and downregulated PD-L1 protein levels (P=0.004) compared to controls. Moreover, CHRNA7 knockdown attenuated nicotine-induced upregulation of both PD-L1 (P<0.001) and pSTAT3, suggesting that nicotine modulates PD-L1 and STAT3 expression through α7-nAChR signaling.
To elucidate the role of STAT3 in the nicotine-α7-nAChR-PD-L1 pathway, LUSC cells were transfected with STAT3 siRNA and treated with nicotine (0.1 µM). WB analysis revealed significantly decreased STAT3 protein levels (P<0.001), reduced PD-L1 protein expression (P=0.02), and diminished nicotine-induced PD-L1 upregulation (P<0.001) compared to controls (Figure 4B). Notably, α7-nAChR protein levels remained unchanged (P=0.10), suggesting that α7-nAChR functions as an upstream regulator of STAT3 in this signaling pathway.
Discussion
This study represents the first investigation of the relationship between α7-nAChR, its encoding gene CHRNA7, and PD-L1 in LUSC. Our findings demonstrate that nicotine may upregulate PD-L1 expression through the nicotine/α7-nAChR/STAT3/PD-L1 signaling pathway.
Recent advances in understanding the molecular structure and function of nAChRs have revealed their significance beyond traditional neuromuscular and autonomic transmission. These receptors exhibit crucial functions in various non-neuronal cells, particularly in cancer biology. Different nAChR subtypes respond to nicotine and its derivatives, regulating specific downstream signaling cascades and significantly influencing tumor progression (19,20). For example, α9-nAChR promotes proliferation in breast cancer and melanoma (16,21), while α5-nAChR facilitates tumor metastasis by modulating epithelial-mesenchymal transition through deubiquitination pathways (22).
The α7-nAChR subtype, which has been most extensively investigated within the nAChR family, shows associations with multiple malignancies (23). In hepatocellular carcinoma, it recruits protein phosphatase 1γ (PP1γ) and promotes tumor progression via the nuclear factor-κB (NF-κB) pathway (24). In lung cancer, α7-nAChR has emerged as a critical mediator of tumor progression (25,26). In vitro study demonstrated that the α7-nAChR-specific inhibitor QND7 suppresses NSCLC cell proliferation by blocking the protein kinase B (Akt)/mechanistic target of rapamycin (mTOR) pathway (27). Additionally, differential expression of CHRNA7 mRNA between NSCLC tissues and adjacent normal tissues has been reported, with elevated CHRNA7 mRNA levels correlating with reduced progression-free survival (28).
Our study comprehensively analyzed α7-nAChR and CHRNA7 expression using the TCGA database, LUSC tissue specimens, and in vitro cell lines, examining their associations with clinicopathological features and patient outcomes. We demonstrated upregulated expression of both α7-nAChR and its encoding gene CHRNA7 in LUSC, with elevated CHRNA7 expression correlating with poorer prognosis, consistent with previous findings.
Historically, treatment options for advanced, inoperable LUSC were limited to conventional chemotherapy and radiation. Although targeted therapies have improved survival in some patients, their utility in LUSC remains limited due to the relative scarcity of actionable driver mutations. Furthermore, patients receiving targeted therapy often experience disease progression due to acquired drug resistance. The advent of immunotherapy, particularly PD-1/PD-L1 inhibitors, has revolutionized LUSC treatment. PD-1 and its ligand PD-L1, members of the B7 immunoglobulin superfamily, are expressed across various solid tumors and serve as crucial checkpoints in tumor immune evasion (29,30). A multinational phase III clinical trial encompassing over 200 medical centers across 32 countries demonstrated that patients with high PD-L1 expression (TPS ≥50%) derived significantly greater benefit from pembrolizumab monotherapy compared to standard platinum-based chemotherapy (31). However, patients with low PD-L1 expression showed limited clinical benefit (32,33), emphasizing the importance of understanding PD-L1’s upstream regulatory mechanisms.
Current investigations into PD-L1 regulation have primarily focused on tumor driver genes and their interactions with tumor-infiltrating immune cells and inflammatory signals (34,35). Clinical observations suggest enhanced responses to PD-L1 immunotherapy among smoking lung cancer patients. Large clinical study established strong associations between smoking status and both PD-L1 expression and treatment response (33). Our analysis revealed that elevated α7-nAChR expression correlated with smoking exposure in LUSC patients. Furthermore, we identified a positive correlation between α7-nAChR and PD-L1 expression in tumor tissues, suggesting that α7-nAChR may serve as a crucial upstream regulator of PD-L1.
STAT3, a highly conserved gene, plays a crucial role in regulating cellular PD-L1 protein expression (35). Previous study established α7-nAChR as an upstream regulator of STAT3, where high-affinity agonists, including nicotine and nitrosamine derivatives, activate the STAT3 signaling pathway through α7-nAChR, subsequently modulating inflammatory responses by inhibiting NF-κB nuclear translocation (36). STAT3 functions as a central mediator of inflammatory responses and contributes significantly to tumor proliferation and migration (7,16). Recent research has demonstrated that α9-nAChR, which is overexpressed in melanoma, mediates nicotine-induced PD-L1 upregulation through STAT3 signaling (16).
Based on these established relationships among α7-nAChR, STAT3, and PD-L1, we conducted a series of in vitro experiments using LUSC cell lines (SK-MES-1 and H520) and the human bronchial epithelial cell line BEAS-2B. Our findings revealed significantly higher α7-nAChR expression in both LUSC cell lines compared to BEAS-2B cells. Notably, nicotine treatment (1.0 µM) significantly enhanced the mRNA expression of CHRNA7, STAT3, and CD274 in LUSC cells compared to controls (P<0.05). At a nicotine concentration of 1.0 µM, the mRNA expression levels of CHRNA7, STAT3, and CD274 were significantly elevated in the LUSC cell lines compared to the control group (P<0.05). After silencing CHRNA7 in the LUSC cell lines, pSTAT3 level was reduced, PD-L1 protein expression was downregulated, and the nicotine-induced upregulation of PD-L1 was weakened compared to the control group. Similarly, after silencing STAT3 using si-STAT3, STAT3 level was decreased, α7-nAChR protein expression level did not change significantly, PD-L1 protein expression was downregulated, and the nicotine-induced upregulation of PD-L1 was weakened. These findings demonstrate that nicotine upregulates PD-L1 expression in LUSC cells through the α7-nAChR/STAT3 signaling pathway. Our findings suggest that patients with advanced or late-stage LUSC who are current or former smokers may have a higher likelihood of benefiting from immunotherapy.
However, several limitations of this study warrant discussion. Firstly, although we confirmed smoking status (never/reformed/current) for all patients, the lack of quantitative pack-year data may have had an impact on the results of our analysis. This is a common limitation in retrospective studies using archival clinical data. Prior study reported that the copy number variation (CNV)-3956 in CHRNA7 exerts a direct effect on lung cancer development, with no significant mediation by smoking pack-years observed, suggesting our conclusions may be robust to this confounder (37). Similar to our study, Pal et al. demonstrated strong positive correlations between PD-L1/CHRNA5 and CHRNA5/CHRNA7 without pack-year adjustment due to data availability, yet their findings were independently validated (38). Secondly, the specific mechanism by which α7-nAChR stimulates STAT3 signaling activation is rarely reported. A study indicated that the ubiquitination and degradation of poly (ADP-ribose) polymerase 1 (PARP1) are involved in the activation of STAT3 (39). Whether epigenetic pathways are involved in the activation of STAT3 by α7-nAChR remains unknown. Thirdly, STAT3 is still considered to play a positive role in tumor growth, so choosing specific targets to regulate PD-L1 synthesis while avoiding the tumor-promoting effects of STAT3 remains a gap in current research. Future studies are needed to better understand the upstream regulatory pathways of PD-L1 and to design in vivo experiments to test whether small molecule targeted drugs combined with PD-L1 monoclonal antibodies can enhance the response to immune checkpoint therapy. Finally, our study did not assess tumor-infiltrating lymphocytes (TILs), which could interact with the α7-nAChR/PD-L1 axis. Published study demonstrated that: a significant positive correlation was found between PD-L1 expression and CD8+ TIL density (40), but direct evidence linking α7-nAChR to TILs in LUSC remains scarce. Future prospective studies should integrate multiplex immunofluorescence to evaluate spatial relationships between CHRNA7, PD-L1, and TIL subsets.
Conclusions
In conclusion, this study is the first to explore the correlation between α7-nAChR, its encoding gene CHRNA7, and PD-L1, finding that nicotine may upregulate PD-L1 expression in LUSC cells through the α7-nAChR/STAT3 pathway. Further research is needed to confirm our conclusions and provide a basis for improving tumor immunotherapy response.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2587/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2587/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2587/prf
Funding: This work received funding support from
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2587/coif). The authors have no conflicts of interest to declare.
Ethical Statement:
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. CA Cancer J Clin 2024;74:12-49. [Crossref] [PubMed]
- Barta JA, Powell CA, Wisnivesky JP. Global Epidemiology of Lung Cancer. Ann Glob Health 2019;85:8. [Crossref] [PubMed]
- Schuller HM. The impact of smoking and the influence of other factors on lung cancer. Expert Rev Respir Med 2019;13:761-9. [Crossref] [PubMed]
- Neves Cruz J, Santana de Oliveira M, Gomes Silva S, et al. Insight into the Interaction Mechanism of Nicotine, NNK, and NNN with Cytochrome P450 2A13 Based on Molecular Dynamics Simulation. J Chem Inf Model 2020;60:766-76. [Crossref] [PubMed]
- Hajiasgharzadeh K, Sadigh-Eteghad S, Mansoori B, et al. Alpha7 nicotinic acetylcholine receptors in lung inflammation and carcinogenesis: Friends or foes? J Cell Physiol 2019;234:14666-79. [Crossref] [PubMed]
- Chen J, Cheuk IWY, Shin VY, et al. Acetylcholine receptors: Key players in cancer development. Surg Oncol 2019;31:46-53. [Crossref] [PubMed]
- Zou S, Tong Q, Liu B, et al. Targeting STAT3 in Cancer Immunotherapy. Mol Cancer 2020;19:145. [Crossref] [PubMed]
- Lu L, Dong J, Wang L, et al. Activation of STAT3 and Bcl-2 and reduction of reactive oxygen species (ROS) promote radioresistance in breast cancer and overcome of radioresistance with niclosamide. Oncogene 2018;37:5292-304. [Crossref] [PubMed]
- Zhou M, Zhao J, Zhang Q, et al. Nicotine Upregulates the Level of Mcl-1 through STAT3 in H1299 Cells. J Cancer 2020;11:1270-6. [Crossref] [PubMed]
- Mu G, Zhu Y, Dong Z, et al. Calmodulin 2 Facilitates Angiogenesis and Metastasis of Gastric Cancer via STAT3/HIF-1A/VEGF-A Mediated Macrophage Polarization. Front Oncol 2021;11:727306. [Crossref] [PubMed]
- Jia ZH, Jia Y, Guo FJ, et al. Phosphorylation of STAT3 at Tyr705 regulates MMP-9 production in epithelial ovarian cancer. PloS One 2017;12:e0183622. [Crossref] [PubMed]
- Song TL, Nairismägi ML, Laurensia Y, et al. Oncogenic activation of the STAT3 pathway drives PD-L1 expression in natural killer/T-cell lymphoma. Blood 2018;132:1146-58. [Crossref] [PubMed]
- Faivre-Finn C, Vicente D, Kurata T, et al. Four-Year Survival With Durvalumab After Chemoradiotherapy in Stage III NSCLC-an Update From the PACIFIC Trial. J Thorac Oncol 2021;16:860-7. [Crossref] [PubMed]
- Lantuejoul S, Sound-Tsao M, Cooper WA, et al. PD-L1 Testing for Lung Cancer in 2019: Perspective From the IASLC Pathology Committee. J Thorac Oncol 2020;15:499-519. [Crossref] [PubMed]
- Nie RC, Duan JL, Liang Y, et al. Smoking status-based efficacy difference in anti-PD-1/PD-L1 immunotherapy: a systematic review and meta-analysis. Immunotherapy 2020;12:1313-24. [Crossref] [PubMed]
- Nguyen HD, Liao YC, Ho YS, et al. The α9 Nicotinic Acetylcholine Receptor Mediates Nicotine-Induced PD-L1 Expression and Regulates Melanoma Cell Proliferation and Migration. Cancers (Basel) 2019;11:1991. [Crossref] [PubMed]
- Pepper C, Tu H, Morrill P, et al. Tumor cell migration is inhibited by a novel therapeutic strategy antagonizing the alpha-7 receptor. Oncotarget 2017;8:11414-24. [Crossref] [PubMed]
- Papapostolou I, Ross-Kaschitza D, Bochen F, et al. Contribution of the α5 nAChR Subunit and α5SNP to Nicotine-Induced Proliferation and Migration of Human Cancer Cells. Cells 2023;12:2000. [Crossref] [PubMed]
- Nimmakayala RK, Seshacharyulu P, Lakshmanan I, et al. Cigarette Smoke Induces Stem Cell Features of Pancreatic Cancer Cells via PAF1. Gastroenterology 2018;155:892-908.e6. [Crossref] [PubMed]
- Bu X, Zhang A, Chen Z, et al. Migration of gastric cancer is suppressed by recombinant Newcastle disease virus (Rl-RVG) via regulating α7-nicotinic acetylcholine receptors/ERK- EMT. BMC Cancer 2019;19:976. [Crossref] [PubMed]
- Kumari K, Das B, Adhya A, et al. Nicotine associated breast cancer in smokers is mediated through high level of EZH2 expression which can be reversed by methyltransferase inhibitor DZNepA. Cell Death Dis 2018;9:152. [Crossref] [PubMed]
- Chen X, Jia Y, Zhang Y, et al. α5-nAChR contributes to epithelial-mesenchymal transition and metastasis by regulating Jab1/Csn5 signalling in lung cancer. J Cell Mol Med 2020;24:2497-506. [Crossref] [PubMed]
- Wang S, Hu Y. α7 nicotinic acetylcholine receptors in lung cancer. Oncol Lett 2018;16:1375-82. [Crossref] [PubMed]
- Wan C, Wu M, Zhang S, et al. α7nAChR-mediated recruitment of PP1γ promotes TRAF6/NF-Kb cascade to facilitate the progression of Hepatocellular Carcinoma. Mol Carcinog 2018;57:1626-39. [Crossref] [PubMed]
- Zhang C, Yu P, Zhu L, et al. Blockade of α7 nicotinic acetylcholine receptors inhibit nicotine-induced tumor growth and vimentin expression in non-small cell lung cancer through MEK/ERK signaling way. Oncol Rep 2017;38:3309-18. [Crossref] [PubMed]
- Zhang C, Ding XP, Zhao QN, et al. Role of α7-nicotinic acetylcholine receptor in nicotine-induced invasion and epithelial-to-mesenchymal transition in human non-small cell lung cancer cells. Oncotarget 2016;7:59199-208. [Crossref] [PubMed]
- Witayateeraporn W, Arunrungvichian K, Pothongsrisit S, et al. α7-Nicotinic acetylcholine receptor antagonist QND7 suppresses non-small cell lung cancer cell proliferation and migration via inhibition of Akt/Mtor signaling. Biochem Biophys Res Commun 2020;521:977-83. [Crossref] [PubMed]
- Ma G, Ji D, Qu X, et al. Mining and validating the expression pattern and prognostic value of acetylcholine receptors in non-small cell lung cancer. Medicine (Baltimore) 2019;98:e15555. [Crossref] [PubMed]
- Ai L, Xu A, Xu J. Roles of PD-1/PD-L1 Pathway: Signaling, Cancer, and Beyond. Adv Exp Med Biol 2020;1248:33-59. [Crossref] [PubMed]
- Parvez A, Choudhary F, Mudgal P, et al. PD-1 and PD-L1: architects of immune symphony and immunotherapy breakthroughs in cancer treatment. Front Immunol 2023;14:1296341. [Crossref] [PubMed]
- Reck M, Rodríguez-Abreu D, Robinson AG, et al. Updated Analysis of KEYNOTE-024: Pembrolizumab Versus Platinum-Based Chemotherapy for Advanced Non-Small-Cell Lung Cancer With PD-L1 Tumor Proportion Score of 50% or Greater. J Clin Oncol 2019;37:537-46. [Crossref] [PubMed]
- Ng TL, Liu Y, Dimou A, et al. Predictive value of oncogenic driver subtype, programmed death-1 ligand (PD-L1) score, and smoking status on the efficacy of PD-1/PD-L1 inhibitors in patients with oncogene-driven non-small cell lung cancer. Cancer 2019;125:1038-49. [Crossref] [PubMed]
- D’Incecco A, Andreozzi M, Ludovini V, et al. PD-1 and PD-L1 expression in molecularly selected non-small-cell lung cancer patients. Br J Cancer 2015;112:95-102. [Crossref] [PubMed]
- Chen X, Gao A, Zhang F, et al. ILT4 inhibition prevents TAM- and dysfunctional T cell-mediated immunosuppression and enhances the efficacy of anti-PD-L1 therapy in NSCLC with EGFR activation. Theranostics 2021;11:3392-416. [Crossref] [PubMed]
- Singhal S, Stadanlick J, Annunziata MJ, et al. Human tumor-associated monocytes/macrophages and their regulation of T cell responses in early-stage lung cancer. Sci Transl Med 2019;11:eaat1500. [Crossref] [PubMed]
- Yang NN, Yang JW, Ye Y, et al. Electroacupuncture ameliorates intestinal inflammation by activating α7nAChR-mediated JAK2/STAT3 signaling pathway in postoperative ileus. Theranostics 2021;11:4078-89. [Crossref] [PubMed]
- Yang L, Lu X, Qiu F, et al. Duplicated copy of CHRNA7 increases risk and worsens prognosis of COPD and lung cancer. Eur J Hum Genet 2015;23:1019-24. [Crossref] [PubMed]
- Pal K, Hussain T, Xie H, et al. Expression, correlation, and prognostic significance of different nicotinic acetylcholine receptors, programed death ligand 1, and dopamine receptor D2 in lung adenocarcinoma. Front Oncol 2022;12:959500. [Crossref] [PubMed]
- Zhou B, Yan J, Guo L, et al. Hepatoma cell-intrinsic TLR9 activation induces immune escape through PD-L1 upregulation in hepatocellular carcinoma. Theranostics 2020;10:6530-43. [Crossref] [PubMed]
- Jiang T, Shi J, Dong Z, et al. Genomic landscape and its correlations with tumor mutational burden, PD-L1 expression, and immune cells infiltration in Chinese lung squamous cell carcinoma. J Hematol Oncol 2019;12:75. [Crossref] [PubMed]

