FBXO32 promotes gastric cancer progression by regulating NME1

Introduction

Gastric cancer, a common cancer, has a high incidence rate. In 2022, there were 980,000 new cases of gastric cancer worldwide, ranking after lung cancer, breast cancer, colorectal cancer and prostate cancer, and 660,000 deaths, ranking after lung cancer, colorectal cancer, liver cancer and breast cancer (1). The 5-year survival rate of gastric cancer with distant metastasis is less than 10%, so finding new targets for gastric cancer is of clinical importance (2).

As a member of the F-box protein family (3), F-box protein 32 (FBXO32) functions as a ubiquitin ligase in various biological activities (4). Study found that FBXO32 degrades small-conductance calcium-activated potassium channel 2 protein in diabetic mice through ubiquitination (5). Also, study found that FBXO32 activates the NF-κB pathway by ubiquitination and degradation of IκBα protein, thus playing a role in inflammatory response. In addition, FBXO32 also plays an important role in various cancers. For example, FBXO32 promotes the progression of lung adenocarcinoma by degrading the tumor suppressor protein PTEN through ubiquitination (3). Moreover, it was found that F-box protein FBXO32 ubiquitinates and stabilizes D-type cyclins to drive cancer progression (6). Currently, the role of FBXO32 in gastric cancer is unclear, and there is only one report suggesting that FBXO32 is expressed at a high level in the cytoplasm of gastric cancer cells (7).

Through the database analyses, it was found that FBXO32 expression is increased in gastric cancer, which is associated with poor prognosis. FBXO32 expression is also increased in gastric cancer cell lines. The knockdown of FBXO32 can inhibit the proliferation, migration, invasion and stemness of gastric cancer cells. Non-metastatic cells 1 (NME1), formerly known as NM23, is the first tumor metastasis suppressor discovered (8-10). According to the results of database analyses, low expression of NME1 is associated with poor prognosis, and the knockdown of NME1 expression can offset part of the tumor suppressor activity of the knockdown of FBXO32. Therefore, it is believed that FBXO32 promotes the progression of gastric cancer by regulating NME1. Our findings provide information for the mechanism of gastric cancer and the discovery of new targets. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2426/rc).

Methods

Clinical database

The prognostic data of FBXO32 and NME1 were from Kaplan-Meier Plotter (https://kmplot.com/) and R2 database (https://hgserver1.amc.nl/cgi-bin/r2/main.cgi), and the expression data of FBXO32 were from Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.cancer-pku.cn/) and Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/).

Cell culture

MKN45, MKN7 and HGC27 cells were purchased from Procell (Wuhan, China), AGS cells were purchased from Cell Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China), GES1 cells were purchased from Sunncell (Wuhan, China). The cells were cultured in complete medium consisting of 89.5% of Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Logan, USA), 10% of fetal bovine serum (Gibco) and 0.5% of penicillin-streptomycin solution (Gibco) at 37 ℃ and 5% of carbon dioxide.

Cell transfection

Lentiviral short hairpin RNA-negative control (shRNA-NC) and shRNA-FBXO32 were purchased from HANBIO (Shanghai China), and the targeting sequence was GCCTTTGTGCCTACAACTGAA (11). The transfection procedure was to drip the virus into the cells, puromycin was added 24 h later, the culture medium and dead cells were removed, and the expression of fluorescent protein was observed under a fluorescence microscope, and protein was extracted for Western blotting. Small interfering RNA-negative control (siRNA-NC) and siRNA-NME1 (sense: 5’-GGAACACUACGUUGACCUGtt-3’; anti-sense: 5’-CAGGUCAACGUAGUUCCtt-3’) were purchased from RiboBio (Guangzhou, China) (12). The transfection procedure mainly involved the starving of the cells with Opti-MEM (Gibco) for 6 h, and then the adding of Lipofectamine 3000 (Invitrogen, California, USA) and siRNA to the cells for 6 h.

Cell Counting Kit-8 (CCK8) assay

A total of 1,000 cells were placed in a 96-well plate and measured at three time points: 0, 24, and 72 h. Additionally, 10 µL of CCK8 (Solarbio, Beijing, China) was added and incubated for 1 h, and then the optical density (OD) value was measured at 450 nm.

Cell cloning assay

A total of 1,000 cells were seeded in a six-well plate and complete culture medium was added. After 10 days, the culture medium was removed and the cells were fixed and stained with crystal violet and photographed.

Wound-healing assay

The cells were cultured in a six-well plate. When the cells filled the six-well plate, an equidistant line was drawn in the middle with a white pipette tip. Subsequently, the complete culture medium was replaced with DMEM, and then the pictures were taken under a microscope after 24 h.

Transwell invasion assay

BD Matrigel (Solarbio) was added to the upper layer of the transwell plate, 100 µL of DMEM medium containing a cell concentration of 5×10⁴ cells/mL was added to the upper layer, 500 µL of complete medium was added to the lower layer, during this period, some cells with strong invasive ability can penetrate BD Matrigel and enter the lower layer, the lower medium after 24 h was removed to fix the cells, then crystal violet was added, the upper cells were washed and wiped off, and pictures were taken under a microscope.

Cancer stem cell sphere-forming assay

A total of 1,000 HGC27 cells were cultured in low-adhesion six-well plates (Corning, New York, USA) with serum-free DMEM-F12 (Gibco) supplemented with 20 ng/mL epidermal growth factor (EGF) (Beyotime, Shanghai, China) and 10 ng/mL FGF2 (Solarbio) for 10 days. The number of spheres in each well was observed under a microscope.

Western blot assay

First, radio immunoprecipitation assay (RIPA) (Beyotime) was used to extract the protein, after centrifugation, remove the supernatant and add protease inhibitors and phosphatase inhibitors, then protein loading buffer (Beyotime) was added and boiled for 10 min, electrophoresis was performed at 60 V for 20 min, changed to 90 V for 1 h, and then it was transferred to polyvinylidene fluoride (PVDF) membrane, washed and incubated with the primary antibody (ABclonal, Wuhan, China, 1:1,000) overnight at 4 ℃ and rewarmed at room temperature for 1 h. The next day, it was washed and added with secondary antibody (ABclonal, 1:3,000) and incubated at room temperature for 1 h, and washed and added with enhanced chemiluminescence (ECL) luminescent solution (Beyotime) for exposure.

Animal assay

1×10⁷ HGC27 cells were placed in DMEM and 100 µL was injected into the armpits of nude mice. After 30 days, the nude mice were anesthetized and euthanized, and the tumor tissue was removed to calculate its volume and weigh it. Since the specific pathogen free (SPF) animal room at the Animal Center of the Eighth Affiliated Hospital of Sun Yat-sen University is relatively limited, we conducted the experiment in the SPF animal room of Shenzhen TopBiotech. The animal assay was performed under a project license (No. TOP-IACUC-2023-0322) granted by the Animal Ethics committee of Shenzhen TopBiotech, in compliance with national guidelines for the care and use of animals. A protocol was prepared before the study without registration.

Immunohistochemistry

First, the tumor tissue was fixed, paraffin-embedded, sectioned, dewaxed, hydrated, antigen-retrieved, inactivated, blocked, added with primary antibody (ABclonal, 1:200) and incubated at room temperature for 1 h, and then it was washed, added with secondary antibody (ABclonal, 1:500) and incubated at room temperature for 30 min. Finally, it was added with diaminobenzidine (DAB) (Beyotime) for color development, counterstained with hematoxylin, and then sealed for observation.

Statistical analysis

Outcomes were compared using Student’s t-test (n=3), and the prognostic comparison was performed using the Kaplan-Meier method. All statistical data were analyzed using GraphPad Prism 8 (La Jolla, CA, USA).

Results

High expression of FBXO32 is associated with poor prognosis in gastric cancer patients, and FBXO32 expression is elevated in gastric cancer tissues and cell lines

Through the Kaplan-Meier plotter database, it was found that high expression of FBXO32 is closely related to poor prognosis in gastric cancer patients (Figure 1A). In addition, the same conclusion was also reached in the R2 database (Figure 1B-1D). Through the GEPIA database (Figure 1E), it was discovered that the expression level of FBXO32 is increased in gastric cancer tissues, and of course, the data of the GEPIA database is based on the famous The Cancer Genome Atlas (TCGA) database. Similarly, by analyzing the data in the GEO database, it was also found that the expression level of FBXO32 in gastric cancer tissues was higher than that in non-tumor tissues (Figure 1F-1L). In addition, the expression level of FBXO32 protein in gastric cancer cell lines (HGC27, AGS, MKN45, MKN7) was higher than that in gastric epithelial cells (GES1) through Western blot assay (Figure 1M,1N).

Figure 1 High expression of FBXO32 is associated with poor prognosis in gastric cancer patients, FBXO32 expression is elevated in gastric cancer tissues and cell lines. (A) The relationship between FBXO32 expression and prognosis of gastric cancer patients in the Kaplan-Meier Plotter database. (B-D) The relationship between FBXO32 expression and prognosis of gastric cancer patients in the R2 database. (E) Expression of FBXO32 in gastric cancer tissues in GEPIA database. (F) Expression of FBXO32 in gastric cancer tissues in GSE13911. (G) Expression of FBXO32 in gastric cancer tissues in GSE19826. (H) Expression of FBXO32 in gastric cancer tissues in GSE54129. (I) Expression of FBXO32 in gastric cancer tissues in GSE63098. (J) Expression of FBXO32 in gastric cancer tissues in GSE65081. (K) Expression of FBXO32 in gastric cancer tissues in GSE79973. (L) Expression of FBXO32 in gastric cancer tissues in GSE81948. (M) Expression of FBXO32 protein in gastric cancer cell lines and gastric epithelial cells. (N) Quantification of FBXO32 protein expression in gastric cancer cell lines and gastric epithelial cells. *, P<0.05; **, P<0.01. CI, confidence interval; FBXO32, F-box protein 32; GEPIA, Gene Expression Profiling Interactive Analysis; HR, hazard ratio; STAD, stomach adenocarcinoma.

The knockdown efficiency of FBXO32 and reduced expression of FBXO32 inhibit the proliferation of gastric cancer cells

Since the lentiviral shRNA was labeled with green fluorescent protein, the expression of green fluorescent protein can be seen under a fluorescence microscope (Figure 2A). Therefore, it is believed that the lentiviral shRNA could successfully transfect gastric cancer cells. Based on Western blotting experiments, the knockdown efficiency of FBXO32 protein was about 65% (Figure 2B,2C).

Figure 2 Knockdown efficiency of FBXO32 and reduced expression of FBXO32 inhibits the proliferation of gastric cancer cells. (A) Expression of green fluorescent protein of transfected cells and non-transfected cells. (B) Expression of FBXO32 protein after knockdown. (C) Quantification after FBXO32 protein knockdown. (D) Cell cloning experiments of NC group and FBXO32 knockdown group. 1,000 FBXO32 knockdown group cells and NC group cells were placed in a six-well plate, complete culture medium was added, and crystal violet staining was performed after 10 days to count the number of spheres in each well. (E) Statistics of cell cloning experiments. (F) CCK8 assay of NC group and FBXO32 knockdown group. (G) Expression of CDK2 and CDK6 proteins after FBXO32 protein knockdown. (H) Quantification of CDK2 protein after FBXO32 protein knockdown. (I) Quantification of CDK6 protein after FBXO32 protein knockdown. *, P<0.05; **, P<0.01; ***, P<0.001 (n=3). FBXO32, F-box protein 32; shRNA-NC, short hairpin RNA-negative control.

According to cell cloning experiments, reducing the expression of FBXO32 could reduce the number of gastric cancer cell spheres by about 50% (Figure 2D,2E). In addition, CCK8 experiments also revealed that knocking down FBXO32 can inhibit the proliferation of gastric cancer cells (Figure 2F). CDK2 and CDK6 are marker proteins of cell proliferation (13). After reducing the protein expression of FBXO32, it was observed that the expression levels of CDK2 and CDK6 proteins decreased (Figure 2G-2I).

In summary, FBXO32 protein was successfully knocked down in this study, and it was found that reducing the expression of FBXO32 inhibited the proliferation of gastric cancer cells and reduced the expression of cell proliferation-related proteins.

The knockdown of FBXO32 expression inhibits migration, invasion and stemness of gastric cancer cells

After reducing the expression of FBXO32 protein, the migration rate of gastric cancer cells decreased by about 50% (Figure 3A,3B). Besides, the number of invasive gastric cancer cells after knocking down FBXO32 protein also decreased by about 60% (Figure 3C,3D). Gastric cancer stem cells are considered as the origin of gastric cancer cells, compared with ordinary gastric cancer cells, and gastric cancer stem cells have stronger proliferation and metastasis capabilities (14). Cancer stem cell sphere experiments showed that the stemness of gastric cancer cells decreased after reducing the expression of FBXO32 protein (Figure 3E,3F).

Figure 3 Knockdown of FBXO32 expression inhibits migration, invasion and stemness of gastric cancer cells. (A) Wound-healing assay of NC group and FBXO32 knockdown group (scale bar =100 μm, direct observation under a ×10 microscope). (B) Statistics of wound-healing assay. (C) Transwell invasion assay of NC group and FBXO32 knockdown group (crystal violet staining, scale bar =100 μm). (D) Statistics of transwell invasion assay. (E) Cancer stem cell sphere-forming assay of NC group and FBXO32 knockdown group (scale bar =100 μm). 1,000 FBXO32 knockdown group cells and NC group HGC27 cells were cultured in low-adhesion six-well plates with serum free DMEM-F12 supplemented with 20 ng/mL EGF and 10 ng/mL FGF2 for 10 days. The number of spheres in each well was observed under a microscope. (F) Statistics of cancer stem cell sphere-forming assay. (G) Expression of MMP2, MMP9, CD44 and LGR5 proteins of NC group and FBXO32 knockdown group. (H) Quantification of expression of MMP2, MMP9, CD44 and LGR5 proteins. *, P<0.05; **, P<0.01; ***, P<0.001 (n=3). FBXO32, F-box protein 32; shRNA-NC, short hairpin RNA-negative control.

MMP2 and MMP9 proteins are considered as key proteins in cancer metastasis (15), and the knockdown of FBXO32 can reduce the expression of MMP2 and MMP9 proteins (Figure 3G,3H). CD44 and LGR5 are marker proteins of gastric cancer stem cells (16), and reducing the expression of FBXO32 can reduce the expression of CD44 and LGR5 proteins (Figure 3G,3H).

The knockdown of FBXO32 inhibits gastric cancer tumor growth and increases NME1 expression

After knocking down the expression of FBXO32, both the volume and weight of gastric cancer tumors were reduced by approximately 60% (Figure 4A-4C). To explore the mechanism by which FBXO32 inhibits the progression of gastric cancer, we consulted relevant literature and found that NME1 might be the downstream protein of FBXO32 (3). NME1 is the first tumor metastasis suppressor discovered (17).

Figure 4 Knockdown of FBXO32 inhibits gastric cancer tumor growth and increases NME1 expression. (A) Photo of gastric cancer tumor in nude mice of NC group and FBXO32 knockdown group. (B) Volumetric statistics of gastric cancer tumors. (C) Gastric cancer tumor weight statistics. (D) Immunohistochemistry of NME1 protein in gastric cancer tumors of NC group and FBXO32 knockdown group (DAB staining, scale bar =20 μm). (E) Quantification of NME1 protein by immunohistochemistry in gastric cancer tumors. (F) Western blot assay of NME1 protein in gastric cancer cell lines. (G) Quantification of NME1 protein in gastric cancer cell lines HGC27 by Western blot assay. (H) Quantification of NME1 protein in gastric cancer cell lines AGS by Western blot assay. *, P<0.05; **, P<0.01. DAB, diaminobenzidine; FBXO32, F-box protein 32; NME1, non-metastatic cells 1; shRNA-NC, short hairpin RNA-negative control.

After reducing the expression of FBXO32, the expression of NME1 in tumor tissues increased (Figure 4D,4E). In addition, to verify whether the increased expression of NME1 protein can also be observed in the cell experiment, the Western blot assay was re-performed on FBXO32 knockdown gastric cancer cells and also an increased expression of NME1 protein was observed (Figure 4F-4H).

The knockdown of NME1 expression can offset part of the tumor suppressor activity of knockdown of FBXO32

NME1 is the first tumor metastasis suppressor discovered. According to the database, low expression of NME1 is associated with poor prognosis in gastric cancer patients (Figure 5A,5B). The knockdown efficiency of NME1 siRNA was first verified, and it was found that the protein expression level decreased by about 60% after NME1 knockdown (Figure 5C,5D). After knocking down FBXO32, the migration ability of gastric cancer cells decreased, but reducing the expression of NME1 could partially offset the decrease in cell migration ability caused by reducing FBXO32 (Figure 5E,5F). Such results can also be seen in the invasion, stemness and proliferation of gastric cancer cells (Figure 5G-5L).

Figure 5 Knockdown of NME1 expression can offset part of the tumor suppressor activity of knockdown of FBXO32. (A) The relationship between NME1 expression and prognosis of gastric cancer patients in the Kaplan-Meier plotter database. (B) The relationship between NME1 expression and prognosis of gastric cancer patients in the R2 database. (C) Protein expression after NME1 knockdown. (D) Quantification of protein expression after NME1 knockdown. (E) Wound-healing assay (scale bar =100 μm, direct observation under a ×10 microscope). (F) Statistics of wound-healing. (G) Statistics of transwell invasion assay. (H) Statistics of cancer stem cell sphere-forming assay. (I) Statistics of cell cloning experiments. (J) Transwell invasion assay (crystal violet staining, scale bar =100 μm). (K) Cancer stem cell sphere-forming assay (scale bar =100 μm). 1,000 HGC27 cells were cultured in low-adhesion six-well plates with serum free DMEM-F12 supplemented with 20 ng/mL EGF and 10 ng/mL FGF2 for 10 days. The number of spheres in each well was observed under a microscope. (L) Cell cloning experiments. 1,000 HGC27 cells were placed in a six-well plate, complete culture medium was added, and crystal violet staining was performed after 10 days to count the number of spheres in each well. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001 (n=3). CI, confidence interval; FBXO32, F-box protein 32; NME1, non-metastatic cells 1; shRNA-NC, short hairpin RNA-negative control; siRNA-NC, small interfering RNA-negative control.

In summary, we demonstrated that the knockdown of NME1 expression can offset part of the tumor suppressor activity of the knockdown of FBXO32, and thus we believe that FBXO32 promotes gastric cancer progression by regulating NME1.

Discussion

As a common cancer, gastric cancer endangers the health of many patients. The 5-year survival rate of patients with distant metastasis is very low. Therefore, the discovery of new targets for gastric cancer patients is of great importance clinically. FBXO32 is a ubiquitin ligase that plays a role in multiple cancers, but its role in gastric cancer is currently unknown. NME1 is the first cancer metastasis suppressor discovered.

Based on the results of database analyses, FBXO32 expression is increased in gastric cancer tissues and gastric cancer cell lines, and high expression of FBXO32 is associated with poor prognosis in gastric cancer patients. The knockdown of FBXO32 can inhibit the proliferation, migration, invasion and stemness of gastric cancer cells and reduce the expression of related proteins, inhibit the growth of gastric cancer tumors, and increase the expression of NME1. Reducing the expression of NME1 can offset part of the inhibitory effect of knockdown of FBXO32 on gastric cancer. Therefore, we believe that FBXO32 promotes gastric cancer progression by regulating NME1.

FBXO32 often functions as a ubiquitin ligase in various cancers. Study have found that FBXO32 regulates melanoma progression by ubiquitinating and degrading c-MYC protein (18), and FBXO32 ubiquitin degrades the cancer suppressor protein CtBP1 to promote tumor metastasis (19). In addition, study have found that the expression of FBXO32 is related to tumor immunity. Zhang et al. found that FBXO32 is highly expressed in pancreatic ductal adenocarcinoma, and high expression of FBXO32 is related to the patient’s poor prognosis and immune infiltration and activation status (20). Therefore, promoting cancer progression by degrading tumor suppressor proteins through ubiquitination may be a typical role of FBXO32. NME1 is a key protein in nucleotide metabolism, also known as nucleoside diphosphate kinase 1, formerly known as NM23, and it is a recognized tumor metastasis suppressor (21). For example, study have found that NME1 inhibits the metastasis of breast cancer cells (22). Other study has proved that NME1 inhibits tumor metastasis by changing tumor endocytosis and motility (23). Therefore, our findings are consistent with the classical role of FBXO32 that may promote the progression of gastric cancer by ubiquitinating and degrading NME1. However, co-immunoprecipitation experiments were not performed, so the specific mechanism is unclear. In future studies, co-immunoprecipitation experiments will be conducted to explore whether FBXO32 promotes the progression of gastric cancer by ubiquitinating and degrading NME1.

Overall, FBXO32 could promote the progression of gastric cancer by regulating NME1. Most importantly, our findings provide information for the mechanism of gastric cancer and the discovery of new targets.

Conclusions

It is believed that FBXO32 promotes the progression of gastric cancer by regulating NME1. Most importantly, our findings could provide information for the mechanism of gastric cancer and the discovery of new targets.

Acknowledgments

None.

Footnote

Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2426/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2426/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2426/prf

Funding: This work was supported by the public health scientific research project of Futian District, Shenzhen (No. FTWS2020011), Special Fund for Outstanding Youth Reserve Talent Program of the Eighth Affiliated Hospital of Sun Yat-sen University (No. FBJQ2019006), and Research Initiation Fund of the Eighth Affiliated Hospital of Sun Yat-sen University (No. GCC RCY J011).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2024-2426/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Since the SPF animal room at the Animal Center of the Eighth Affiliated Hospital of Sun Yat-sen University is relatively limited, we conducted the experiment in the SPF animal room of Shenzhen TopBiotech. The animal assay was performed under a project license (No. TOP-IACUC-2023-0322) granted by the Animal Ethics committee of Shenzhen TopBiotech, in compliance with guidelines for the care and use of animals. A protocol was prepared before the study without registration.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229-63. [Crossref] [PubMed]
2. Li Q, Lin Y, Ni B, et al. Circadian system disorder induced by aberrantly activated EFNB2-EPHB2 axis leads to facilitated liver metastasis in gastric cancer. Cell Oncol (Dordr) 2024;47:2113-34. [Crossref] [PubMed]
3. Wu J, Wen T, Marzio A, et al. FBXO32-mediated degradation of PTEN promotes lung adenocarcinoma progression. Cell Death Dis 2024;15:282. [Crossref] [PubMed]
4. Sukari A, Muqbil I, Mohammad RM, et al. F-BOX proteins in cancer cachexia and muscle wasting: Emerging regulators and therapeutic opportunities. Semin Cancer Biol 2016;36:95-104. [Crossref] [PubMed]
5. Ling TY, Yi F, Lu T, et al. F-box protein-32 down-regulates small-conductance calcium-activated potassium channel 2 in diabetic mouse atria. J Biol Chem 2019;294:4160-8. [Crossref] [PubMed]
6. Li F, Yu H, Zhang Y, et al. F-box protein FBXO32 ubiquitinates and stabilizes D-type cyclins to drive cancer progression. Nat Commun 2025;16:4060. [Crossref] [PubMed]
7. Lei KF, Liu BY, Wang YF, et al. SerpinB5 interacts with KHDRBS3 and FBXO32 in gastric cancer cells. Oncol Rep 2011;26:1115-20. [Crossref] [PubMed]
8. MacDonald NJ, de la Rosa A, Steeg PS. The potential roles of nm23 in cancer metastasis and cellular differentiation. Eur J Cancer 1995;31A:1096-100. [Crossref] [PubMed]
9. Yu L, Wang X, Zhang W, et al. The multiple regulation of metastasis suppressor NM23-H1 in cancer. Life Sci 2021;268:118995. [Crossref] [PubMed]
10. Gelman IH. Metastasis suppressor genes in clinical practice: are they druggable? Cancer Metastasis Rev 2023;42:1169-88. [Crossref] [PubMed]
11. Chen Z, Ren D, Lv J, et al. The atypical ubiquitin ligase RNF31 stabilizes c-Myc via epigenetic inactivation of FBXO32 and promotes cancer development. Cell Signal 2023;107:110677. [Crossref] [PubMed]
12. Gong L, Wu Z, Guo L, et al. Metastasis suppressor Nm23-H1 inhibits STAT3 signaling via a negative feedback mechanism. Biochem Biophys Res Commun 2013;434:541-6. [Crossref] [PubMed]
13. Witkiewicz AK, Kumarasamy V, Sanidas I, et al. Cancer cell cycle dystopia: heterogeneity, plasticity, and therapy. Trends Cancer 2022;8:711-25. [Crossref] [PubMed]
14. Rao X, Zhang C, Luo H, et al. Targeting Gastric Cancer Stem Cells to Enhance Treatment Response. Cells 2022;11:2828. [Crossref] [PubMed]
15. Das S, Amin SA, Jha T. Inhibitors of gelatinases (MMP-2 and MMP-9) for the management of hematological malignancies. Eur J Med Chem 2021;223:113623. [Crossref] [PubMed]
16. Chen Z, Gao Y, Zhang P, et al. Identification of gastric cancer stem cells with CD44 and Lgr5 double labelling and their initial roles on gastric cancer malignancy and chemotherapy resistance. Cell Biol Toxicol 2024;41:12. [Crossref] [PubMed]
17. Romani P, Ignesti M, Gargiulo G, et al. Extracellular NME proteins: a player or a bystander? Lab Invest 2018;98:248-57. [Crossref] [PubMed]
18. Xu J, Shi P, Xia F, et al. RAI14 Promotes Melanoma Progression by Regulating the FBXO32/c-MYC Pathway. Int J Mol Sci 2022;23:12036. [Crossref] [PubMed]
19. Sahu SK, Tiwari N, Pataskar A, et al. FBXO32 promotes microenvironment underlying epithelial-mesenchymal transition via CtBP1 during tumour metastasis and brain development. Nat Commun 2017;8:1523. [Crossref] [PubMed]
20. Zhang Y, Liu Q, Cui M, et al. Comprehensive Analysis of Expression, Prognostic Value, and Immune Infiltration for Ubiquitination-Related FBXOs in Pancreatic Ductal Adenocarcinoma. Front Immunol 2021;12:774435. [Crossref] [PubMed]
21. Liu J, Li H, Wang L, et al. Spatial transcriptome and single-cell reveal the role of nucleotide metabolism in colorectal cancer progression and tumor microenvironment. J Transl Med 2024;22:702. [Crossref] [PubMed]
22. Saini V, Do Y, Yam JWP, et al. Elevated extracellular vesicular Nm23-H1 subdues the pro-migratory potential of breast cancer cell-derived extracellular vesicles. Cell Signal 2024;120:111203. [Crossref] [PubMed]
23. Khan I, Gril B, Steeg PS. Metastasis Suppressors NME1 and NME2 Promote Dynamin 2 Oligomerization and Regulate Tumor Cell Endocytosis, Motility, and Metastasis. Cancer Res 2019;79:4689-702. [Crossref] [PubMed]