Overexpression of miR-1283 inhibits cell proliferation and migration of colorectal cancer cells by targeting PDZD8
Highlight box
Key findings
• The study revealed that PDZ domain-containing protein 8 (PDZD8) is highly expressed in colorectal cancer tissues and cells, with significant elevation in HCT 116 and RKO cell lines. Knockdown of PDZD8 inhibited cell proliferation, migration, and promoted apoptosis, effects that were further validated in vivo through reduced tumor growth in xenograft models. Additionally, miR-1283 was found to be negatively correlated with PDZD8, directly binding to its 3' UTR and reducing PDZD8 expression, thereby inhibiting colorectal cancer cell proliferation and migration. These findings highlight the regulatory role of miR-1283 on PDZD8 in colorectal cancer and suggest potential therapeutic implications.
What is known and what is new?
• PDZD8 has been implicated in various cancers, including colorectal cancer, where it plays a pro-oncogenic role. miR-1283 has been shown to regulate gene expression in other cancer types.
• Our findings demonstrate that miR-1283 directly targets PDZD8, inhibiting its expression and thereby suppressing colorectal cancer development. This study is the first to elucidate the role of miR-1283 in regulating PDZD8 in colorectal cancer.
What is the implication, and what should change now?
• The identification of miR-1283 as a negative regulator of PDZD8 suggests a potential therapeutic strategy for colorectal cancer. Targeting the miR-1283/PDZD8 axis could offer a novel approach to inhibit tumor growth and progression in colorectal cancer.
• Further research is warranted to explore the therapeutic potential of miR-1283 in colorectal cancer. Additionally, the mechanisms underlying the regulation of miR-1283 expression in colorectal cancer should be investigated to identify potential biomarkers and therapeutic targets.
Introduction
Colorectal cancer, a common malignancy, impacts the gastrointestinal system (1,2). The annual increase in new cases of this cancer has been averaging 2.3%, a trend that poses significant challenges for early diagnosis and treatment (3,4). Often, this cancer is detected at later stages owing to its varied clinical presentations, leading to less favorable treatment outcomes than other malignancies (3). Furthermore, colorectal cancer displays unique responses to treatments, requiring tailored therapeutic strategies (5). There is an evident need for research that uncovers the mechanisms and pathogenesis of this cancer to inform the development of targeted and personalized treatments.
The protein PDZ domain-containing protein 8 (PDZD8), which contains a PDZ domain, is essential for the stability of the capsid in certain viruses, including murine leukemia virus (MLV), simian immunodeficiency virus (SIV), and Human immunodeficiency virus type 1 (HIV-1) (6). Overexpression of PDZD8 increases cell susceptibility to these viruses, and it is known to interact with the Gag polyprotein of HIV-1, an interaction that is crucial for viral infection (7). In the case of HIV-1, PDZD8 interacts with the viral Gag polyprotein and its depletion has been found to impair HIV-1 infection (7). PDZD8 interacting with moesin, a protein that affects microtubule stability, has also been documented (8). The connection between PDZD8 and human cancers, particularly colorectal cancer, remains largely unexplored.
Our study detected elevated PDZD8 expression in colorectal cancer cells. By employing short hairpin RNA (shRNA) to suppress PDZD8, we observed reduced cancer cell proliferation and migration, along with increased apoptosis. Inhibition of PDZD8 also led to cell cycle arrest, with a decrease in S phase and an increase in G2 phase cells. We found that miR-1283 directly targeted PDZD8, reducing its expression. Overexpressing PDZD8 mitigated the inhibitory effects of miR-1283 on cancer cell growth and migration. These results indicated that PDZD8 could be an oncogenic factor in colorectal cancer, highlighting its potential as a therapeutic target for developing specific treatments. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-291/rc).
Methods
Bioinformatics analysis
To investigate the expression levels of PDZD8 in colorectal cancer, we utilized publicly available data from The Cancer Genome Atlas (TCGA) database, specifically focusing on paired tumor and normal tissue samples. The data were accessed through the Genomic Data Commons (GDC) Data Portal (https://portal.gdc.cancer.gov/). To analyze the expression levels of PDZD8, we employed the R package DESeq2, a widely used tool for differential gene expression analysis of RNA sequencing data. The raw count data were first normalized using the DESeq2 pipeline to account for differences in sequencing depth and other technical variations. The Spearman correlation coefficient, calculated using R’s cor.test function, was employed to explore the relationship between PDZD8 and hsa-miR-1283. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.
Cell lines and cell culture
We obtained five distinct cell lines, FHC, DLD-1, SW480, RKO, and HCT 116, from American Type Culture Collection (ATCC) (https://www.atcc.org/). The FHC line is indicative of normal colorectal mucosa, whereas DLD-1, SW480, RKO, and HCT 116 are cancerous epithelial derivatives. Customized media and conditions were employed for culturing: FHC, DLD-1, RKO, and HCT 116 were placed in 1640 medium with 10% fetal bovine serum (FBS), whereas SW480 was cultured in L-15 medium with 10% FBS. These conditions, including a 37 ℃ incubation with 5% CO2, were optimized to simulate physiological cell growth requirements, with media renewals occurring every 72 h to sustain cell health.
Lentivirus shRNA construction and transfection
We crafted three shRNA sequences targeting PDZD8, selecting the most potent one post-efficiency assessment. To achieve PDZD8 overexpression, a lentiviral system was engaged, ensuring the constructs’ efficient cellular integration. This led to the establishment of cell lines with elevated PDZD8 levels. Concurrently, miR-1283 was overexpressed using synthetic mimics, which were introduced to enhance endogenous miR-1283 levels.
RNA extraction and real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR)
RNA extraction was facilitated by TRIzol reagent (Sigma-Aldrich, St. Louis, MO, USA), followed by reverse transcription to complementary DNA (cDNA) using the Promega M-MLV Kit (Promega Corporation, Madison, WI, USA). qRT-PCR was conducted with SYBR Green Mastermix (Vazyme, Nanjing, China), with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as a reference gene. The primer sequence of stem-loop was 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAAAG-3'. The 2-ΔΔCt method was applied to ascertain the relative gene expression, with primer sequences detailed in Table 1.
Table 1
| Gene | Forward primer sequence (5'-3') | Reverse primer sequence (5'-3') |
|---|---|---|
| PDZD8 | ATCATCAAGCGCAAGCACAC | GTAAGTGCCCATTGTTGTATATGGA |
| miR-1283 | GCTCTACAAAGGAAAGCG | GTGCAGGGTCCGAGGT |
| GAPDH | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PDZD8, PDZ domain-containing protein 8; qRT-PCR, quantitative reverse transcription-polymerase chain reaction.
Western blot assay
Proteins were extracted from cells, and their concentrations were quantified using the BCA assay kit from Thermo Fisher Scientific (Cat. # A53227, Waltham, MA, USA). The proteins were then separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% gel based on molecular weight and transferred to a polyvinylidene fluoride (PVDF) membrane. To reduce non-specific binding, the membrane was blocked before incubation with primary antibodies targeting PDZD8 (1:1,500, Rabbit, #25512-1-AP, Sanying, Wuhan, China) and GAPDH (1:30,000, Mouse, #60004-1-lg, Proteintech, Wuhan, China). After primary antibody treatment, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies. The ECL+plus™ system (GE, Marlborough, MA, USA) was used for signal detection, which involves a chemiluminescent reaction with HRP, and the signal was captured using imaging systems.
Cell Counting Kit-8 (CCK-8) assay
Post-lentiviral transfection, RKO and HCT 116 cells were plated in a 96-well format and allowed to grow overnight. The next day, CCK-8 reagent was added, and the plate was incubated for 2 to 4 h, after which the optical density (OD) at 450 nm was measured to assess cell proliferation. This process was repeated daily for 5 days to track cell growth, with the experiment conducted in triplicate for reliability.
Cell migration detection
Cell migration of RKO and HCT 116 cells was evaluated using both transwell and wound-healing assays. In the transwell assay, cells were seeded in the upper chamber with serum-free medium and allowed to migrate towards a chemoattractant in the lower chamber over 40 h. The migrated cells were stained and quantified by measuring absorbance at 570 nm. The wound-healing assay involved creating scratches in a confluent monolayer and monitoring closure over time, with the migration area analyzed using Cellomics software (Thermo). Both assays were repeated three times for consistency.
Detection of cell apoptosis and cell cycle by fluorescence-activated cells sorting (FACS)
Post-lentiviral transfection, RKO and HCT 116 cells were cultured in 6-well plates until reaching 85% confluence. The cells were harvested, centrifuged, and the supernatant was removed. They were then washed with cold D-Hanks buffer at 4 ℃. For apoptosis detection, cells were stained with Annexin V-APC and incubated in the dark before being analyzed using a FACSCalibur™ cytometer (Millipore, Burlington, MA, USA). This device quantified apoptosis levels based on Annexin V-APC staining patterns. For cell cycle analysis, cells were fixed with ethanol, stained with propidium iodide (PI), and analyzed using the same cytometer to detect changes in cell cycle distribution. Both assays were performed in triplicate to ensure data reliability.
Luciferase reporter assay
We constructed pmirGLO vectors with PDZD8 3'-untranslated region (UTR) sequences, including wild-type and mutant forms, to explore the interaction with miR-1283. HCT 116 cells were co-transfected with these vectors and either NC or miR-1283 mimics using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA), following the protocol for optimal gene delivery. After a 48-h incubation, luciferase activities of the PDZD8 constructs were measured using a Dual Luciferase Reporter Assay Kit to evaluate the interaction effects.
Subcutaneous tumor formation in nude mice
A total of 36 male BALB/c nude mice (IMSR_JAX: 00065) from Jiangsu GemPharmatech Co., Ltd. [SCXK(Su)2023-0009], aged four weeks, were randomly divided into six groups for subcutaneous tumorigenesis assays. The mice, averaging 17.98 g in weight, were housed in a specific pathogen-free (SPF) environment with a 12-h light and 12-h dark cycle daily, with light intensity ranging from 200 to 300 lux and light duration from 8:00 am to 20:00 pm. Room temperature was maintained at approximately 25 ℃, with ad libitum access to water and food. For tumorigenesis, lentivirus-transfected or untransfected RKO cells were injected into the right flank of mice. Tumor development was monitored, and sizes were recorded every three days using a digital caliper. Tumor volumes were calculated with the formula: Volume = (length × width2)/2, over a 60-day period. At the end of the experiment, mice were euthanized by injection of 1% sodium pentobarbital (P3761; Sigma-Aldrich), 120 mg/kg body weight, and tumors were excised and weighed. All animal experiments were approved by the ethics committee of the First Affiliated Hospital of Naval Medical University, in compliance with Chinese national or institutional guidelines for the care and use of animals. A protocol was prepared before the study without registration.
Statistical analysis
The experiments were performed in triplicate to ensure data reliability. Data analysis was conducted using GraphPad Prism 6, presenting results as mean ± standard deviation. The Student’s t-test was applied to assess significance between groups, with a P value ≤0.05 considered statistically significant.
Results
HCT 116 and RKO cell models with PDZD8 depletion are created
To investigate the expression levels of PDZD8 in colorectal cancer, we analyzed data from the TCGA database, specifically comparing tumor and normal tissue samples, using the GDC Data Portal (https://portal.gdc.cancer.gov/). We employed the R package DESeq2 to normalize the count data and perform differential expression analysis. The results revealed significantly elevated PDZD8 levels in tumor tissues compared to normal tissues (Padj=8.34e−13) (Figure 1A). To further investigate the functional roles of PDZD8 in colorectal cancer, qRT-PCR and Western blot analysis were performed to detect the expression levels of PDZD8 in human normal colorectal mucosal cell FHC and a panel of colorectal cancer cell lines DLD-1, SW480, RKO, and HCT 116. The analysis highlighted elevated PDZD8 messenger RNA (mRNA) and protein levels in colorectal cancer-derived lines, with RKO and HCT 116 showing the most significant increase (Figure 1B,1C). This prompted us to select these two cell lines for subsequent study. We utilized shRNA targeting PDZD8 (shPDZD8-1, shPDZD8-2, and shPDZD8-3) to knock down its expression in HCT 116 and RKO cell models. shPDZD8-3 exhibited the most optimal interference efficiency, with a knockdown efficiency of 41.00% (P<0.01) based on qRT-PCR results (Figure 1D). Following this, we introduced shPDZD8-3 into HCT 116 and RKO cell lines to evaluate the transfection and knockdown efficiencies. By monitoring the green fluorescence produced by green fluorescent protein (GFP) within the cells, we observed transfection efficiencies exceeding 80% in both cell lines (Figure 1E). Subsequently, the knockdown efficiencies of PDZD8 were assessed using qRT-PCR and Western blot analysis. As depicted in Figure 1F, the knockdown efficiencies of PDZD8 were 92.53% (P<0.001) in HCT 116 cells and 44.49% (P<0.01) in RKO cells. Consistent with this, Western blot assay results indicated a decreased PDZD8 protein level in both cell lines following the introduction of shPDZD8-3 (Figure 1G). Taken together, these findings demonstrated the successful establishment of PDZD8 knockdown cell models, allowing us to further investigate the functional roles of PDZD8 in colorectal cancer.
Knockdown of PDZD8 inhibits malignant phenotypes of colorectal cancer cells
After establishing HCT 116 and RKO cell models with PDZD8 depletion, the effects of PDZD8 knockdown on cell phenotypes were investigated. We first assessed cell proliferation using the CCK-8 assay and observed that silencing PDZD8 significantly impaired cell proliferation abilities. The results presented in Figure 2A showed that the fold changes of the OD values were −1.7 and −1.3 in HCT 116 and RKO cells, respectively, with statistical significance (P<0.001). This demonstrated a noteworthy reduction in cell proliferation subsequent to PDZD8 knockdown in both cell lines. To further evaluate the impact of PDZD8 knockdown on cell migration, we conducted transwell and wound-healing experiments. In the transwell assay (as illustrated in Figure 2B), we observed a substantial decrease in the migration rate of cells following PDZD8 knockdown. Specifically, in HCT 116 cells, the migration rate of cells in the shPDZD8 group decreased by an impressive 98% in comparison to the control group (shCtrl). Likewise, in RKO cells, the migration rate of cells in the shPDZD8 group exhibited a significant decrease of 79% (P<0.001). These findings strongly indicated that PDZD8 knockdown had a significant inhibitory effect on the migratory capacity of colorectal cancer cells. Furthermore, the findings in Figure 2C, which were captured 24 h after wounding, provide additional support for the impaired migration capability of colorectal cancer cells following PDZD8 downregulation. The reduced cell migration observed in the wound-healing experiment reinforced the notion that PDZD8 knockdown hindered the migratory potential of these cancer cells. In addition to examining proliferation and migration, we also investigated the impact of PDZD8 knockdown on cell apoptosis and cell cycle using flow cytometry analysis. In Figure 2D, it could be observed that PDZD8 knockdown resulted in an increase in cell apoptosis in both HCT 116 and RKO cells, with fold changes of 2.0 and 1.8, respectively. Furthermore, flow cytometry data depicted a decrease in the cell population within the S phase and a concurrent increase in the G2 phase (as illustrated in Figure 2E). In summary, these results suggested that silencing PDZD8 inhibited cell proliferation and migration, while promoting cell apoptosis and arresting cell cycle.
miR-1283 is negatively correlated with PDZD8, and directly binds to PDZD8 to regulate colorectal cancer development
Previous research has established that PDZD8 plays a pro-oncogenic role in colorectal cancer (9). Consequently, we aimed to investigate the factors responsible for the upregulation of PDZD8. In a previous study focused on lung adenocarcinoma cells, the regulatory role of miR-1283 on PDZD8 had been demonstrated (10). We also found a significant reduction in both PDZD8 mRNA (Figure 3A) and protein (Figure 3B) levels in miR-1283-overexpressed HCT 116 and RKO cells compared to the control cells. More notably, miR-1283 was downregulated in colorectal cancer cell lines relative to human normal colorectal mucosal cell FHC (Figure 3C). Additionally, we conducted an analysis using primary tumor samples from the TCGA database to extract the normalized expression levels of PDZD8 and miR-1283. Employing the R cor.test function, we performed a Spearman rank correlation analysis that revealed a negative correlation between PDZD8 and miR-1283 (P<0.01, Figure 3D). To further confirm the interaction between miR-1283 and PDZD8, we generated a mutant form of the PDZD8 3' UTR and co-transfected it, along with the wild type PDZD8, into HCT 116 cells in the presence of miR-1283. Dual-luciferase assays were then performed to assess the impact on luciferase activity. The results demonstrated that miR-1283 transfection led to a significant reduction in luciferase activity specifically in the wild type PDZD8 group (P<0.05). However, this decrease was not observed in the mutant group, suggesting that the binding of miR-1283 to the PDZD8 3' UTR region was necessary for the observed regulatory effect (Figure 3E).
To provide evidence that the upregulated expression of PDZD8 contributed to the pro-carcinogenic effects in colorectal cancer and was regulated by miR-1283, we conducted experiments in HCT 116 and RKO cells. Specifically, we overexpressed miR-1283 and/or PDZD8 in these cells and assessed their effects on cell viability and migration. Cell viability was examined using a CCK-8 assay, and migration was assessed using a transwell assay. Compared to the control cells, the overexpression of PDZD8 significantly promoted the proliferation and metastasis of both HCT 116 and RKO cells. Furthermore, when miR-1283 was simultaneously overexpressed along with PDZD8, there was a significant increase in the proliferative and metastatic abilities of the cells compared with miR-1283 overexpression alone (Figure 3F,3G). These findings suggested that miR-1283 could directly bind to PDZD8 and regulate the development of colorectal cancer. The concurrent upregulation of miR-1283 and PDZD8 appeared to have a synergistic effect on enhancing the pro-carcinogenic properties of the cells.
In vivo validation of miR-1283 and PDZD8 on colorectal cancer tumor growth
The in vivo experiments were conducted to substantiate the effects of miR-1283 and PDZD8 on colorectal cancer tumor growth. Nude mice were inoculated with RKO cells transfected with shCtrl or shPDZD8, and tumor volume was monitored over a 60-day period. As depicted in Figure 4A, mice treated with shPDZD8 exhibited a significant reduction in tumor volume compared to the shCtrl group. Tumor weight was measured and presented in Figure 4B. Consistent with the volume data, shPDZD8 treated mice had significantly lighter tumors. Macroscopic examination of the harvested tumors, as shown in Figure 4C, revealed a visually apparent reduction in tumor size in the shPDZD8 group compared to shCtrl. Immunohistochemical analysis of Ki67, a marker of cell proliferation, was performed on tumor sections from shCtrl and shPDZD8 treated mice (Figure 4D). The staining intensity of Ki67 was notably diminished in the shPDZD8 group, indicating a decrease in tumor cell proliferation.
To further explore the combined effects of miR-1283 and PDZD8, nude mice were inoculated with RKO cells transfected with PDZD8, miR-1283, and their respective controls. The results, as shown in Figure 4E-4G, demonstrated that PDZD8 overexpression led to a more pronounced increase in tumor volume, weight and size compared to the control group, while miR-1283 overexpression had the opposite result and reversed the promoting effects from PDZD8 overexpression. Immunohistochemical staining for Ki67 was depicted in Figure 4H. The staining intensity for Ki67 was enhanced in the PDZD8 group, along with the significant decrease observed in the PDZD8 + miR-1283 treatment group. These findings collectively indicated that miR-1283 suppressed colorectal cancer tumor growth through PDZD8.
Discussion
Colorectal cancer though relatively rare, constitutes less than 0.6% of new cancer cases annually (1), has seen a rise in incidence in recent years (2). This cancer is characterized by a diverse range of malignant tumors, each with distinct features (11), necessitating tailored therapeutic strategies. Despite progress in treating small bowel adenocarcinoma, enhancing the quality of life for colorectal cancer patients remains a challenge (4,12). There is an imperative need to understand the mechanisms underlying colorectal cancer to devise more potent treatment strategies.
A prior study had identified PDZD8 as a promising target for potential interventions in HIV-1 infection (13). In their study, the technique of small interfering RNA (siRNA) was employed to knock down PDZD8, resulting in a noticeable decrease in the ability of cytoplasmic lysates from human cells to stabilize HIV-1 conical capsid comprising ~1,500 capsid (CA) proteins with N-terminal and C-terminal domains complexes in vitro. This PDZD8 knockdown also led to an accelerated disassembly of HIV-1 capsids in infected cells, effectively blocking the infection process prior to reverse transcription (6). The study also revealed an interaction between the host protein PDZD8 and the HIV-1 Gag protein. Moreover, the transient overexpression of PDZD8 significantly enhanced HIV-1 infectivity temporarily. Conversely, a temporary suppression of PDZD8 led to a notable reduction in cell infection by both HIV-1 and MLV vectors, strongly suggesting PDZD8’s role in early post-entry events (6,7). Building upon these earlier discoveries, our current research delved into the expression levels and functional roles of PDZD8 in colorectal cancer cells. Our findings unveiled that PDZD8 was expressed at elevated levels in colorectal cancer tissues and cells. Critically, silencing PDZD8 in these cancer cells had a profound impact, inhibiting both cell proliferation and migration, inducing apoptosis, and triggering cell cycle arrest. These findings strongly indicate that PDZD8 likely holds a central role in promoting the growth and advancement of colorectal cancer cells. It is crucial to emphasize that further research is essential to uncover the exact mechanisms by which PDZD8 influences the development of colorectal cancer.
MiR-1283 is a recently discovered microRNA that has been found to play a substantial role in the development and advancement of several cancer types, including colorectal cancer (14-16). Numerous studies have demonstrated that miR-1283 can modulate multiple pathways and target genes that are involved in cell proliferation, migration, apoptosis, and tumor angiogenesis. For instance, in glioma, miR-1283 was found to be downregulated, and its overexpression inhibited glioma cell proliferation and invasion by directly targeting and suppressing the expression of activating transcription factor 4 (ATF4) (17). Similarly, in human epidermal growth factor receptor 2 positive (HER2+) breast cancer, miR-1283 was also shown to be downregulated, and its overexpression suppressed cancer cell proliferation and invasion (18). In the context of colorectal cancer, our research focused on investigating the regulatory relationship between miR-1283 and PDZD8. PDZD8 is a newly identified oncogene that is overexpressed in various cancer types. A previous study has highlighted the association between miR-1283 and PDZD8 (10). We aimed to explore this relationship specifically in colorectal cancer cells. Our findings revealed that miR-1283 directly targets PDZD8 and negatively regulates its expression in colorectal cancer cells. Moreover, we observed that the overexpression of miR-1283 led to inhibitory effects on cell proliferation and migration, which were rescued by upregulating PDZD8. These results strongly suggest that the PDZD8/miR-1283 regulatory axis plays a crucial role in the development and progression of colorectal cancer. Despite the promising findings presented in this study, several limitations must be acknowledged. Public datasets, including those from the TCGA and other repositories, currently lack sufficient paired miR-1283/PDZD8-clinical data for colorectal cancer, which precludes bioinformatic validation of our findings. While our study provides a strong preclinical foundation for the role of the PDZD8/miR-1283 axis in colorectal cancer, future clinical validation is essential to fully understand its therapeutic potential.
Conclusions
In summary, our study provides evidence supporting the regulatory connection between miR-1283 and PDZD8 in colorectal cancer. These findings indicate that targeting PDZD8 holds promise as a therapeutic strategy for cancer treatment. Nevertheless, additional research is essential to attain a more comprehensive understanding of the exact mechanisms through which the PDZD8/miR-1283 regulatory axis impacts cancer progression. These additional studies will contribute to advancing our knowledge of colorectal cancer biology and may potentially lead to the development of novel treatment approaches.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-291/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-291/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-291/prf
Funding: None.
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-291/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. All animal experiments were approved by ethics committee of the First Affiliated Hospital of Naval Medical University, in compliance with Chinese national or institutional guidelines for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin 2019;69:7-34. [Crossref] [PubMed]
- Matsuda T, Fujimoto A, Igarashi Y. Colorectal Cancer: Epidemiology, Risk Factors, and Public Health Strategies. Digestion 2025;106:91-9. [Crossref] [PubMed]
- Benson AB, Venook AP, Al-Hawary MM, et al. Small Bowel Adenocarcinoma, Version 1.2020, NCCN Clinical Practice Guidelines in Oncology. J Natl Compr Canc Netw 2019;17:1109-33. [Crossref] [PubMed]
- Abedizadeh R, Majidi F, Khorasani HR, et al. Colorectal cancer: a comprehensive review of carcinogenesis, diagnosis, and novel strategies for classified treatments. Cancer Metastasis Rev 2024;43:729-53. [Crossref] [PubMed]
- Tanaka H, Yamashita K, Urabe Y, et al. Management of T1 Colorectal Cancer. Digestion 2025;106:122-30. [Crossref] [PubMed]
- Guth CA, Sodroski J. Contribution of PDZD8 to stabilization of the human immunodeficiency virus type 1 capsid. J Virol 2014;88:4612-23. [Crossref] [PubMed]
- Henning MS, Morham SG, Goff SP, et al. PDZD8 is a novel Gag-interacting factor that promotes retroviral infection. J Virol 2010;84:8990-5. [Crossref] [PubMed]
- Henning MS, Stiedl P, Barry DS, et al. PDZD8 is a novel moesin-interacting cytoskeletal regulatory protein that suppresses infection by herpes simplex virus type 1. Virology 2011;415:114-21. [Crossref] [PubMed]
- Li Z, Wang D, Zhang W, et al. Novel PBMC LncRNA signatures as diagnostic biomarkers for colorectal cancer. Pathol Res Pract 2024;253:154985. [Crossref] [PubMed]
- Wei W, Wang C, Wang L, et al. circ_0020123 promotes cell proliferation and migration in lung adenocarcinoma via PDZD8. Open Med (Wars) 2022;17:536-49. [Crossref] [PubMed]
- Cañellas-Socias A, Sancho E, Batlle E. Mechanisms of metastatic colorectal cancer. Nat Rev Gastroenterol Hepatol 2024;21:609-25. [Crossref] [PubMed]
- Jiang C, Zhou Q, Yi K, et al. Colorectal cancer initiation: Understanding early-stage disease for intervention. Cancer Lett 2024;589:216831. [Crossref] [PubMed]
- Zhang S, Sodroski J. Efficient human immunodeficiency virus (HIV-1) infection of cells lacking PDZD8. Virology 2015;481:73-8. [Crossref] [PubMed]
- Chang J, Tian J, Yang Y, et al. A Rare Missense Variant in TCF7L2 Associates with Colorectal Cancer Risk by Interacting with a GWAS-Identified Regulatory Variant in the MYC Enhancer. Cancer Res 2018;78:5164-72. [Crossref] [PubMed]
- Yu H, Liu Y, Wang Y, et al. Circ_0005397 enhances hepatocellular carcinoma progression through miR-1283/HEG1. Ann Hepatol 2022;27:100712. [Crossref] [PubMed]
- Han C, Wang S, Wang H, et al. Knockdown of circ-TTBK2 Inhibits Glioma Progression by Regulating miR-1283 and CHD1. Cancer Manag Res 2020;12:10055-65. [Crossref] [PubMed]
- Chen H, Zhang Y, Su H, et al. Overexpression of miR-1283 Inhibits Cell Proliferation and Invasion of Glioma Cells by Targeting ATF4. Oncol Res 2019;27:325-34. [Crossref] [PubMed]
- Chen XZ, He WX, Luo RG, et al. KLF14/miR-1283/TFAP2C axis inhibits HER2-positive breast cancer progression via declining tumor cell proliferation. Mol Carcinog 2023;62:532-45. [Crossref] [PubMed]

