A pentacyclic triterpene tormentic acid inhibits the proliferation and migration of pancreatic ductal adenocarcinoma cells
Original Article

A pentacyclic triterpene tormentic acid inhibits the proliferation and migration of pancreatic ductal adenocarcinoma cells

Mohammed Merae Alshahrani ORCID logo, Ahmed Abdullah Al Awadh ORCID logo

Department of Clinical Laboratory Sciences, Faculty of Applied Medical Sciences, Najran University, Najran, Saudi Arabia

Contributions: (I) Conception and design: Both authors; (II) Administrative support: Both authors; (III) Provision of study materials or patients: Both authors; (IV) Collection and assembly of data: Both authors; (V) Data analysis and interpretation: Both authors; (VI) Manuscript writing: Both authors; (VII) Final approval of manuscript: Both authors.

Correspondence to: Ahmed Abdullah Al Awadh, PhD. Department of Clinical Laboratory Sciences, Faculty of Applied Medical Sciences, Najran University, P.O. Box 1988, Najran, 61441, Saudi Arabia. Email: aaalawadh@nu.edu.sa.

Background: Pancreatic ductal adenocarcinoma (PDAC) was one of the most aggressive and deadly cancers, with limited treatment options and unfavorable prognosis. Tormentic acid, a pentacyclic triterpene, has shown promising anticancer properties in various cancers. However, its effects on PDAC remain unclear. The aim of this study was to assess the anticancer property of tormentic acid in PDAC cell lines and to attempt to understand its mechanism of action.

Methods: Effects of tormentic acid were tested in PDAC cell lines (PANC-1 and MIA PaCa-2) by employing several assays such as Cell Counting Kit-8 (CCK-8) assay for cell viability, comet assay for DNA damage, Annexin V/PI staining for apoptosis, flow cytometry for cell cycle analysis and wound healing assays for cell migration. Gene expression analysis was conducted to determine changes in critical apoptotic and cell cycle controlling proteins.

Results: Tormentic acid significantly reduced the viability of PDAC cells in a dose-dependent manner. It induced DNA damage, as evidenced by comet tail formation, and promoted apoptosis through the activation of caspases-3 and -9, and modulation of Bax and Bcl-2 expression. Tormentic acid also caused a G1 cell cycle arrest, with upregulation of p21 and downregulation of cyclins D and E. Furthermore, tormentic acid inhibited PDAC cell migration by downregulating matrix metalloproteinases (MMPs).

Conclusions: Tormentic acid showed potent anticancer effects in PDAC cells by inducing apoptosis, arresting the cell cycle, and suppressing metastasis. These findings highlight its potential as a therapeutic agent for PDAC treatment.

Keywords: Tormentic acid; pancreatic ductal adenocarcinoma (PDAC); apoptosis; migration; cell cycle arrest


Submitted May 20, 2025. Accepted for publication Aug 26, 2025. Published online Oct 10, 2025.

doi: 10.21037/tcr-2025-1050


Highlight box

Key findings

• Tormentic acid, a pentacyclic triterpene, demonstrated strong anticancer activity against pancreatic ductal adenocarcinoma (PDAC) cell lines. It significantly inhibited cell viability, induced DNA damage and apoptosis, caused G1 cell cycle arrest, and suppressed cell migration by downregulating matrix metalloproteinases. The compound showed selective cytotoxicity toward cancer cells over normal cells.

What is known and what is new?

• Pentacyclic triterpenes, including tormentic acid, are known for their anticancer activities across various cancer types such as hepatocellular carcinoma and melanoma. They act by inducing apoptosis, inhibiting cell proliferation, and arresting the cell cycle.

• This study is the first to systematically evaluate the effects of tormentic acid on PDAC cells. It provides novel evidence that tormentic acid induces DNA damage, activates apoptotic pathways, causes G1 phase arrest, and inhibits migration in PDAC, supporting its potential as a therapeutic agent.

What is the implication, and what should change now?

• These findings suggest that tormentic acid may hold promise as a therapeutic compound for PDAC. Future studies are needed in vivo validation, combination therapy with existing chemotherapeutics, and clinical translation. This study may support the broader exploration of natural triterpenes in targeting treatment-resistant cancers like PDAC.


Introduction

Pancreatic ductal adenocarcinoma (PDAC) is highly malignant and deadly cancer and its prognosis is extremely poor. It is characterized by rapid tumor growth, frequent metastatic behaviour and resistance to combination therapy. The survival rate for PDAC patients is strikingly low, with a five-year survival rate of only about 10% despite ongoing advances in diagnostic and therapeutic approaches (1). This high mortality rate is mainly due to the late-stage diagnosis, as the disease often remains asymptomatic in its early stages, leading to its detection only after the cancer has spread (2). As a result, surgical resection becomes a viable treatment option in only a small percentage of patients, and the effectiveness of chemotherapy is limited by the inherent resistance of tumor to treatment (3).

Because of the destructive nature of PDAC and the very difficult treatment of PDAC (4), a new and more effective treatment strategy for PDAC is urgently needed. Among natural products, notably those of plant origin, therapeutic agents are of promise owing to their capability to act on several signaling pathways associated with cancer progression (5). Among these natural products, pentacyclic triterpenoids have attracted much attention for the wide-range anticancer properties (6).

Recent comprehensive analyses [2023–2024] have highlighted that pentacyclic triterpenoids exert multi-targeted actions, including modulation of apoptosis, induction of cell cycle arrest, suppression of angiogenesis, inhibition of invasion and metastasis, and interference with chemoresistance-related signaling cascades, making them attractive candidates for drug development against aggressive cancers such as PDAC (7,8).

These compounds have various biological effects, such as anti-anticancer activities, justifying their use as antitumour agents (9). Pentacyclic triterpenoids have been shown to modulate key cellular processes such as apoptosis, cell cycle regulation, and metastasis inhibition, which are all crucial factors in the context of cancer treatment (10).

A typical example for this pentacyclic triterpene is tormentic acid, a product extracted from many plants such as Eriobotrya japonica which has demonstrated significant anticancer potential (11). Tormentic acid has been reported to inhibit the proliferation of several cancer cell lines including hepatocellular carcinoma, melanoma and leukemia by causing apoptosis and cell cycle arrest (11-13). Antitumor activity of the compound is ascribed to the three modulatory effects that it exerts on various signaling pathways, such as cell survival, cell proliferation, and cell motility. Through disrupting these pathways, tormentic acid can inhibit the spread of cancer cells to areas outside the primary site (14), a crucial event for enhancing the clinical outcome of the patients.

Moreover, recent experimental findings indicate that tormentic acid and structurally related analogues can inhibit SUMO-specific protease 1 (SENP1) activity, thereby sensitizing resistant cancer cells to platinum-based chemotherapies, suggesting a promising role in overcoming drug resistance (15).

In addition to its effects on tumor growth and metastasis, tormentic acid shows potential in overcoming chemotherapy resistance by modulating apoptotic pathways and reducing oxidative stress within the tumor microenvironment (16). It has been reported that the targeted chemical modification of pentacyclic triterpenoids can enhance their bioavailability and potency, opening avenues for developing clinically viable derivatives for PDAC treatment (17). The fact that it modulates multiple cancer-relevant pathways makes it a good candidate for combination therapy.

The aim of the present study was to investigate anticancer activity of tormentic acid against PDAC cells and attempt to explore the underlying mechanisms. Through the discovery of molecular mechanisms by which tormentic acid works, this work aims to determine therapeutic utility tormentic acid can provide as a new therapeutic approach for PDAC. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1050/rc).


Methods

Cell lines and culture conditions

Human PDAC cell lines PANC-1 (ATCC® CRL-1469™, RRID:CVCL_0480) and MIA PaCa-2 (ATCC® CRM-CRL-1420™, RRID:CVCL_0428), along with normal human pancreatic ductal epithelial cells HPDE (HPDE6-C7, RRID:CVCL_4376), were obtained from the American Type Culture Collection (ATCC) and relevant sources. All cell lines are of human origin (Homo sapiens) and were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, and 1% L-glutamine at 37 ℃ in a humidified incubator containing 5% CO2.

Cell viability assay

Cell viability was determined using Cell Counting Kit-8 (CCK-8) assay. PANC-1 cells were seeded into 96-well plates at a density of 5×103 cells per well and allowed to attach overnight. Cells were treated with increasing concentrations of tormentic acid (0–100 µM) for 24 h. After treatment, each well received an addition of 10 µL of CCK-8 solution and the cells were incubated for 2 hr at 37 ℃. Absorbance at 450 nm was determined by a microplate reader. Cell viability percentage was determined by comparing the absorbance of treated cells with that of control cells and IC50 was determined from dose-response curve.

Phase contrast microscopy

Morphological changes after tormentic acid treatment in PANC-1 cells were analyzed by an inverted phase contrast microscope. Cells were treated with 0, 5, 10, and 20 µM tormentic acid for 24 hours, and representative images were captured at 20× magnification. Changes in cell morphology, including alterations in shape, attachment, and density, were assessed to determine the effects of the compound on cell structure.

Comet assay

PANC-1 cells were exposed to tormentic acid (0, 5, 10 and 20 µM) for 24 h, followed by inclusion in low-melting agarose then onto slides. Slides were stained with ethidium bromide after lysis and electrophoresis. DNA damage was assessed under an epi-fluorescent microscope, where intact cells appeared as bright red heads and damaged cells showed red comet tails, indicating DNA fragmentation. Tail length was measured to determine DNA damage (using CometScore software).

4’,6-diamidino-2-phenylindole (DAPI) and Annexin V/propidium iodide (PI) staining

For apoptosis assessment, PANC-1 tumor cells (PANC-1) were exposed to 0, 5, 10, and 20 µM tormentic acid for 24 h and processed for DAPI and Annexin V/PI staining. For DAPI staining, cells were fixed with 4% paraformaldehyde, stained with DAPI, and examined under a fluorescence microscope to detect nuclear changes associated with apoptosis, including chromatin condensation and fragmentation. For Annexin V/PI staining, cells were labeled with Annexin V-FITC and PI according to the manufacturer’s instructions. Annexin V-positive/PI-negative cells were classified as early apoptotic, whereas Annexin V-positive/PI-positive cells represented late apoptosis. Apoptotic cell populations were quantified by flow cytometry.

Cell cycle analysis

The effects of tormentic acid on the cell cycle were assessed using flow cytometry. PANC-1 cells were exposed to 0, 5, 10 and 20 µM tormentic acid for 24 h. After treatment, cells were harvested, fixed in 70% ethanol and stained with solution of PI containing RNase A to degrade RNA, respectively. Flow cytometric analysis was conducted to estimate the proportion of cells in various stages of the cell cycle. Data analysis was performed using FlowJo software, which enabled the determination of cell cycle distribution in the treated and control groups.

Wound healing assay

Cell migration was assessed by the wound healing assay. PANC-1 cells were cultured to confluence in 6-well dishes and a scratch was created by pipette tip. Cells were exposed to 5 µM tormentic acid and the wound closure was imaged at 0 and 24 hours with an inverted microscope. Closure was measured with ImageJ software, and percentage of closure was compared in control and treated cells.

Expression analysis

For the evaluation of apoptosis-related genes expression levels, quantitative real-time polymerase chain reaction (qRT-PCR) was carried out on PANC-1 cells exposed to tormentic acid (0, 5, 10 and 20 µM) at 24 h. Total RNA was obtained by using an RNA extraction kit and complementary DNA (cDNA) was synthesized by using a reverse transcription kit. The cDNA was subsequently amplified by qRT-PCR with specific primers used for apoptosis-related genes, including Bax, Bcl-2, caspase-3, and caspase-9. β-actin was used as a housekeeping gene for normalization. Relative expression levels of the target genes were determined using ΔΔCt method. All qRT-PCR experiments were performed in triplicate. Primers are shown in (Table 1).

Table 1

List of primers used in the study

Primer Direction Sequence
Bax Forward TCAGGATGCGTCCACCAAGAAG
Reverse TGTGTCCACGGCGGCAATCATC
Bcl-2 Forward ATCGCCCTGTGGATGACTGAGT
Reverse GCCAGGAGAAATCAAACAGAGGC
Caspase-3 Forward GGAAGCGAATCAATGGACTCTGG
Reverse GCATCGACATCTGTACCAGACC
Caspase-9 Forward GTTTGAGGACCTTCGACCAGCT
Reverse CAACGTACCAGGAGCCACTCTT
Cyclin D1 Forward TCTACACCGACAACTCCATCCG
Reverse TCTGGCATTTTGGAGAGGAAGTG
Cyclin E Forward GTCCTGGCTGAATGTATACATGC
Reverse GTCCTGGCTGAATGTATACATGC
p21 Forward CCCTATTTTGTTCAGACAACATGGC
Reverse AGGTGGACCTGGAGACTCTCAG
MMP-2 Forward CCTGAATACTTTCTATGGCTGC
Reverse GTATGTAGT GGA GCACCAGAGC
MMP-3 Forward GGTTCTCCATTCCTTTGATGGGGGGAAAG
Reverse CTTCCTGGAATTTCACATCACTGCCACCAC
MMP-9 Forward GCAACG GAGACGGCAAAC C
Reverse GAC GAA GGG GAA GAC GCA
Actin Forward AGGTCATCACCATCGGCAACGA
Reverse GCTGTTGTAGGTGGTCTCGTGA

MMP, matrix metalloproteinase.

Statistical analysis

All experiments were carried out in triplicate and results are reported as mean ± standard deviation (SD). For comparisons between two groups a t-test has been applied, and for comparisons between multiple groups one-way analysis of variance (ANOVA) was applied with Tukey’s post hoc. A P value below 0.05 was deemed statistically significant.


Results

Tormentic acid inhibits PDAC cell viability

The effect of tormentic acid (Figure 1A) on the viability of PDAC cell was tested by CCK-8 assay. In PANC-1 and MIA PaCa-2 cells, tormentic acid exhibited significant anti-proliferative effects, with IC50 values of 10 µM (Figure 1B,1C). In contrast, normal HPDE cells showed a much higher IC50 of 75 µM (Figure 1D), indicating that tormentic acid selectively inhibits PDAC cell viability over normal pancreatic cells. Phase contrast microscopy of PANC-1 cells showed notable morphological alterations after the exposure to tormentic acid, such as decreased monolayer confluence, altered cell shape and shedding, suggestive of cytotoxic effects (Figure 1E).

Figure 1 Effect of tormentic acid on the proliferation of PDAC cells. (A) Chemical structure of tormentic acid. Viability of (B) PANC-1, (C) MIA PaCa-2 and (D) HPDE cells treated with various concentrations of tormentic acid, measured by the CCK-8 assay. (E) Phase contrast images of PANC-1 cells showed morphological changes following treatment with tormentic acid. Experiments were performed in triplicate, and data are presented as mean ± standard deviation. Images captured at ×20 magnification. *, P<0.05. CCK-8, Cell Counting Kit-8; PDAC, pancreatic ductal adenocarcinoma.

Tormentic acid induces DNA damage

The alkaline comet assay was used to assess the DNA-damaging effects of tormentic acid on PANC-1 cells. A dose-dependent enhancement of comet tail formation was noted with increasing comet tails at higher concentrations (10 and 20 µM) (Figure 2). This showed the induction of DNA strand breaks and genomic instability. The comet assay data corroborated that tormentic acid effectively damages DNAs integrity in PDAC cells and is therefore responsible for its anti-cancer activity.

Figure 2 Tormentic acid induces DNA damage in PANC-1 cells. The comet assay results showed DNA damage induced by tormentic acid at different concentrations in PANC-1 cells. Experiments were conducted in triplicate.

Tormentic acid induces apoptosis in PDAC Cells

To assess if tormentic acid triggers apoptosis, DAPI and Annexin V/PI staining were carried out. DAPI staining showed characteristic alterations of nuclei, such as chromatin condensation and fragmentation in PANC-1 cells in the presence of tormentic acid, indicating apoptotic cell death (Figure 3A). Furthermore, Annexin V/PI staining showed that the percentage of apoptotic PANC-1 cells increased from 3.17% in the control group to 25.03% at 20 µM tormentic acid, indicating a statistically significant increase in apoptosis (Figure 3B).

Figure 3 Tormentic acid induces apoptosis in PANC-1 cells. (A) DAPI staining and (B) Annexin V/PI staining showed apoptosis induction in PANC-1 cells treated with tormentic acid. Experiments were conducted in triplicate. DAPI, 4',6-diamidino-2-phenylindole; PI, propidium iodide.

Additionally, qRT-PCR analysis revealed that tormentic acid treatment altered the expression of apoptosis-related proteins. There was a marked increase in Bax expression and a decrease in Bcl-2 expression, which promotes apoptosis (Figure 4A,4B). Furthermore, the expression of caspase-3 and caspase-9 was upregulated (Figure 4C,4D), indicating the activation of intrinsic and extrinsic apoptotic pathways.

Figure 4 Effect of tormentic acid on the expression of apoptosis-related proteins. (A) Bax, (B) Bcl-2, (C) caspase-3, and (D) caspase-9 expression in PANC-1 cells treated with tormentic acid, as determined by qRT-PCR. Experiments were performed in triplicate, and data are shown as mean ± standard deviation. *, P<0.05. qRT-PCR, quantitative real-time polymerase chain reaction.

Tormentic acid induces G1 arrest in PDAC cells

Flow cytometry analysis of the cell cycle distribution showed that tormentic acid treatment induced a dose-dependent increase in the percentage of PANC-1 cells in the G1 phase. In untreated control cells, 42.62% of the cells were in G1. On the other hand, treatment with 20 µM tormentic acid drove 77.33% of cells to arrest in G1 phase (Figure 5A). This G1 arrest was accompanied by large changes in the expression of cell cycle controllers (Figure 5B-5D). Tormentic acid treatment led to an upregulation of p21 expression, which plays a crucial role in regulating the G1/S checkpoint. Additionally, the expression of cyclins D and E, which are involved in G1/S transition, was significantly inhibited in a dose-dependent manner, suggesting that tormentic acid interferes with the progression of PDAC cells through the cell cycle.

Figure 5 Tormentic acid induces G1 arrest in PDAC cells. (A) Flow cytometric analysis showed the effect of tormentic acid on cell cycle distribution of PANC-1 cells. The qRT-PCR analysis of the expression of (B) cyclin D, (C) cyclin E, and (D) p21 in response to tormentic acid treatment. Experiments were conducted in triplicate, and data are presented as mean ± standard deviation. *, P<0.05. PDAC, pancreatic ductal adenocarcinoma; PI, propidium iodide; qRT-PCR, quantitative real-time polymerase chain reaction.

Tormentic acid inhibits PDAC cell migration

The migratory potential of PDAC cells was assessed by wound healing assays. Treatment with 5 µM tormentic acid inhibited cell migration of PANC-1 cells as shown by a delay in wound closure 24 h after treatment (Figure 6).

Figure 6 Tormentic acid reduces migration of PDAC cells. Wound healing assays showed the impact of tormentic acid on PANC-1 cell migration. Experiments were performed in triplicate, and data are presented as mean ± standard deviation. *, P<0.05. PDAC, pancreatic ductal adenocarcinoma.

To investigate the molecular mechanisms of this effect, qRT-PCR was carried out to evaluate matrix metalloproteinases (MMPs), MMP-2, MMP-3 and MMP-9 that are key mediators for cell migration and metastasis (Figure 7A-7C). The findings revealed that tormentic acid treatment inhibited the expression of these MMPs in a dose-dependent manner, suggesting inhibition of PDAC cell migratory ability through the disruption of the extracellular matrix remodeling for cell-migration.

Figure 7 Effect of tormentic acid on metalloproteinase expression. qRT-PCR analysis of the expression of (A) MMP-2, (B) MMP-3, and (C) MMP-9 in PANC-1 cells treated with varying concentrations of Tormentic acid. Experiments were conducted in triplicate, and data are presented as mean ± standard deviation. *, P<0.05. MMP, matrix metalloproteinase; PDAC, pancreatic ductal adenocarcinoma; qRT-PCR, quantitative real-time polymerase chain reaction.

Discussion

PDAC is one of the most malignant, aggressive carcinomas with dismal prognosis, restricted therapeutic approach, and resistance to standard therapies (18). Our study findings show that tormentic acid, a pentacyclic triterpene, showed significant anticancer effects in PDAC cells. Our data suggest its emergence as a potential therapeutic agent of choice for PDAC, an aggressive cancer with unfavorable prognosis and limited treatment options.

These findings are consistent with recent preclinical studies [2023–2024] where diverse pentacyclic triterpenes—including oleanolic acid, ursolic acid, betulinic acid, and lupeol—were shown to induce apoptosis, cause DNA damage, arrest the cell cycle, and modulate oxidative stress in pancreatic and other solid tumor models, further supporting their broad-spectrum anticancer potential (7,19).

In the first step, we found that tormentic acid markedly decreased cell viability with IC50 as low as 10 µM in PDAC cell lines (PANC-1 and MIA PaCa-2) and displayed PDAC cell-selective cytotoxicity compared to normal pancreatic cells (HPDE). This specific cytotoxic effect is crucial, for instance, in the treatment of cancer, reflecting relative selectivity toward malignant cells over normal cells. The anti-proliferative effects were further supported by phase contrast microscopy, which revealed marked morphological changes, such as reduced monolayer confluence and cell detachment, indicative of cytotoxicity and impaired cell adhesion. These findings are in line with previous studies on pentacyclic triterpenoids, which have been shown to exhibit selective anticancer properties by targeting cancer cells while sparing normal cells (20,21).

Our study also demonstrated that tormentic acid induces DNA damage in a dose-dependent manner, as shown by the comet assay. Comet tail formation, as a marker of DNA strand breaks and genomic instability has long been established as a genotoxic marker. This finding supports the notion that tormentic acid may act as a genotoxic agent, disrupting the DNA integrity of PDAC cells and contributing to its anticancer effects. Previous research has highlighted the importance of DNA damage as a critical mechanism underlying the anticancer effects of various natural compounds, including triterpenoids, which can trigger cell death by causing DNA damage (22,23).

Furthermore, apoptosis induction was one of the significant findings of this study. Both markers for DAPI and Annexin V/PI staining showed marked apoptotic cell death by tormentic acid treatment in PANC-1 cells, and dose-dependent increase in apoptotic cells. The upregulation of pro-apoptotic genes such as Bax and the downregulation of anti-apoptotic genes such as Bcl-2, along with the activation of caspases-3 and -9, suggests that tormentic acid triggers both intrinsic and extrinsic apoptotic pathways in PDAC cells. The involvement of Bax in the initiation and enhancement of apoptosis by provoking mitochondrial membrane permeabilization followed by Bcl-2 inhibition is well established in the literature (24). In addition, the caspase-3 and -9 caspases are both involved in intrinsic and extrinsic apoptotic signaling pathways, and caspase-3 is the central effector protease during the execution phase of apoptosis (25). These molecular alterations are consistent with the apoptotic features observed by morphological and flow cytometry analysis, underlining tormentic acid ability to induce efficiently the death of PDAC cells.

Cell cycle analysis showed that tormentic acid resulted in a pronounced accumulation in G1 phase, mainly at higher dose, that was accompanied by modifications in the expression of the main cell cycle regulators. The upregulation of p21 and downregulation of cyclins D and E indicate that tormentic acid inhibits cell cycle progression, arresting PDAC cells at the G1 stage. The G1 arrest is known to be controlled by cyclin-dependent kinase (CDK) inhibitors, e.g., p21 which inhibits transition from G1 to S phase through inhibition of cyclin-CDK complexes (26,27).

Additionally, the inhibition of cyclins D and E, members of the G1/S transition, strengthens the idea that tormentic acid inhibits cell cycle progression in a dose-dependent manner. In addition, other studies have reported that triterpenoids can change cell cycle regulatory molecules to promote G1 arrest, thus suppressing cancer cell proliferation (23). The G1 arrest is a classical mechanism of tumor suppression because it can prevent cells from entering S phase and DNA replication, in consequence, to inhibit cell proliferation (28). The G1 arrest is a classical mechanism of tumor suppression because it can prevent cells from entering S phase and DNA replication, in consequence, to inhibit cell proliferation (29).

Another major result of this work is that tormentic acid shows PDAC cell migration inhibition. Wound healing assays showed a marked decrease in migration, and qRT-PCR showed a decrease in the expression of MMPs, whose function is to remodel extracellular matrix and promote cell migration. MMPs, especially MMP-2, MMP-3, and MMP-9, are instrumental in cancer cell migration and invasion by degrading the extracellular matrix (30). This indicates that tormentic acid could impede PDAC metastasis, preventing the cancer cells from invasion of adjacent tissues, one critical step in cancer progression. A variety of studies indicated that triterpenoids can competitively suppress the production of MMPs, as a result, cancer cell invasion and metastasis can be inhibited (31).

As mentioned in this study, the anticancer activity of tormentic acid observed in this study is consistent with the previously reported anti-proliferative, pro-apoptotic and anti-metastatic properties of tormentic acid in various other cancers such as hepatocellular carcinoma, leukemia and melanoma (11-13). These reports showed the capacity of tormentic acid to inhibit multiple molecular signals, such as apoptosis, cell cycle, and metastasis inhibition. Our findings expand on these studies by providing evidence for its efficacy in PDAC, one of the most aggressive and treatment-resistant cancers.

Additionally, the compound’s ability to interfere with metastatic signaling and overcome therapy resistance has been substantiated by new data from 2024, reinforcing its potential as a lead structure for novel PDAC therapeutics (15,17).

Based on the findings of this study, tormentic acid holds potential as a therapeutic drug for PDAC, either as monotherapy or in combination with other therapies. Due to its capacity to address a number of hallmarks of cancer such as proliferation, apoptosis and metastasis, it is a promising compound for future clinical studies. Future research should include the in vivo efficacy of tormentic acid in PDAC animal models to validate its therapeutic use. In addition, investigating its combination with additional chemotherapy drugs and targeted therapies is expected to increase its anticancer effect and to mitigate potential mechanisms of resistance.

The results of this study are encouraging, but there are certain limitations which must be considered. To begin with, this work mainly concerns the in vitro models, which are not entirely transferable to the in vivo complex tumor microenvironment and interactions. Hence, additional research with animal models is warranted to validate the anticancer action of tormentic acid in a more physiologically relevant manner. Second, although our data indicate that tormentic acid exhibit selective inhibitory effect on PDAC cells proliferation, how tormentic acid showed selective cytotoxicity remains to be further elucidated. Studying the possible molecular targets of tormentic acid on PDAC cells could be beneficial to understand its mechanisms of action. Third, while we observed significant apoptosis and cell cycle arrest in response to tormentic acid, the exact role of other cellular pathways, such as autophagy or necroptosis, in its anticancer effects remains to be elucidated.


Conclusions

In conclusion, tormentic acid demonstrates significant anticancer effects in PDAC cells by inhibiting cell proliferation, inducing apoptosis, arresting the cell cycle, and suppressing cell migration. These results support its possible use as PDAC therapeutic candidate, and it is warranted to conduct further studies to possibly transfer these exciting results into clinical practice.


Acknowledgments

The authors are thankful to the Deanship of Graduate Studies and Scientific Research at Najran University for funding this work under the Easy Funding Program grant code (NU/EFP/MRC/13/191).


Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1050/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1050/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1050/prf

Funding: None.

Conflicts of Interest: Both authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1050/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Chouari T, La Costa FS, Merali N, et al. Advances in Immunotherapeutics in Pancreatic Ductal Adenocarcinoma. Cancers (Basel) 2023;15:4265. [Crossref] [PubMed]
  2. Ushio J, Kanno A, Ikeda E, et al. Pancreatic Ductal Adenocarcinoma: Epidemiology and Risk Factors. Diagnostics (Basel) 2021;11:562. [Crossref] [PubMed]
  3. Christenson ES, Jaffee E, Azad NS. Current and emerging therapies for patients with advanced pancreatic ductal adenocarcinoma: a bright future. Lancet Oncol 2020;21:e135-45. [Crossref] [PubMed]
  4. Anderson EM, Thomassian S, Gong J, et al. Advances in Pancreatic Ductal Adenocarcinoma Treatment. Cancers (Basel) 2021;13:5510. [Crossref] [PubMed]
  5. Naeem A, Hu P, Yang M, et al. Natural Products as Anticancer Agents: Current Status and Future Perspectives. Molecules 2022;27:8367. [Crossref] [PubMed]
  6. Ghante MH, Jamkhande PG. Role of Pentacyclic Triterpenoids in Chemoprevention and Anticancer Treatment: An Overview on Targets and Underling Mechanisms. J Pharmacopuncture 2019;22:55-67. [Crossref] [PubMed]
  7. Similie D, Minda D, Bora L, et al. An Update on Pentacyclic Triterpenoids Ursolic and Oleanolic Acids and Related Derivatives as Anticancer Candidates. Antioxidants (Basel) 2024;13:952. [Crossref] [PubMed]
  8. Moralev AD, Zenkova MA, Markov AV. Complex Inhibitory Activity of Pentacyclic Triterpenoids against Cutaneous Melanoma In Vitro and In Vivo: A Literature Review and Reconstruction of Their Melanoma-Related Protein Interactome. ACS Pharmacol Transl Sci 2024;7:3358-84. [Crossref] [PubMed]
  9. Park KR, Leem HH, Lee J, et al. Anti-cancer effects of Hederoside C, a pentacyclic triterpene saponin, through the intrinsic apoptosis and STAT3 signaling pathways in osteosarcoma. Am J Cancer Res 2021;11:4541-50. [PubMed]
  10. Xiang L, Chi T, Tang Q, et al. A pentacyclic triterpene natural product, ursolic acid and its prodrug US597 inhibit targets within cell adhesion pathway and prevent cancer metastasis. Oncotarget 2015;6:9295-312. [Crossref] [PubMed]
  11. Li HH, Su MH, Yao DH, et al. Anti-Hepatocellular Carcinoma Activity of Tormentic Acid Derived from Suspension Cells of Eriobotrya japonica (Thunb.) Lindl. Plant Cell Tissue Organ Cult 2017;130:427-33. [Crossref]
  12. Loizzo MR, Bonesi M, Passalacqua NG, et al. Antiproliferative activities on renal, prostate and melanoma cancer cell lines of Sarcopoterium spinosum aerial parts and its major constituent tormentic acid. Anticancer Agents Med Chem 2013;13:768-76. [Crossref] [PubMed]
  13. Rocha Gda G, Simões M, Oliveira RR, et al. 3β-acetyl tormentic acid induces apoptosis of resistant leukemia cells independently of P-gp/ABCB1 activity or expression. Invest New Drugs 2012;30:105-13. [Crossref] [PubMed]
  14. Olech M, Ziemichód W, Nowacka-Jechalke N. The Occurrence and Biological Activity of Tormentic Acid—A Review. Molecules 2021;26:3797. [Crossref] [PubMed]
  15. Wei H, Guo J, Sun X, et al. Discovery of Natural Ursane-type SENP1 Inhibitors and the Platinum Resistance Reversal Activity Against Human Ovarian Cancer Cells: A Structure-Activity Relationship Study. J Nat Prod 2022;85:1248-55. [Crossref] [PubMed]
  16. Wu J, Wang N, Jin G, et al. Tormentic acid induces anticancer effects in cisplatin-resistant human cervical cancer cells mediated via cell cycle arrest, ROS production, and targeting mTOR/PI3K/AKT signalling pathway. J BUON 2020;25:74-9. [PubMed]
  17. Zeng LR, Pan BW, Cai J, et al. Construction, structural modification, and bioactivity evaluation of pentacyclic triterpenoid privileged scaffolds in active natural products. RSC Adv 2024;14:39436-61. [Crossref] [PubMed]
  18. Dhillon J, Betancourt M. Pancreatic Ductal Adenocarcinoma. Monogr Clin Cytol 2020;26:74-91. [Crossref] [PubMed]
  19. Torres-Sanchez A, Torres G, Estrada S, et al. Unraveling the Impact of Six Pentacyclic Triterpenes Regulating Metabolic Pathways on Lung Carcinoma Cells. Pharmaceuticals (Basel) 2024;17:694. [Crossref] [PubMed]
  20. Shanmugam MK, Nguyen AH, Kumar AP, et al. Targeted inhibition of tumor proliferation, survival, and metastasis by pentacyclic triterpenoids: potential role in prevention and therapy of cancer. Cancer Lett 2012;320:158-70. [Crossref] [PubMed]
  21. Salvador JAR, Leal AS, Alho DPS, et al. Chapter 2 - Highlights of Pentacyclic Triterpenoids in the Cancer Settings. Stud Nat Prod Chem 2014;41:33-73.
  22. Wu GS, Lu JJ, Guo JJ, et al. Ganoderic acid DM, a natural triterpenoid, induces DNA damage, G1 cell cycle arrest and apoptosis in human breast cancer cells. Fitoterapia 2012;83:408-14. [Crossref] [PubMed]
  23. Smina TP, De S, Devasagayam TP, et al. Ganoderma lucidum total triterpenes prevent radiation-induced DNA damage and apoptosis in splenic lymphocytes in vitro. Mutat Res 2011;726:188-94. [Crossref] [PubMed]
  24. D'Orsi B, Mateyka J, Prehn JHM. Control of mitochondrial physiology and cell death by the Bcl-2 family proteins Bax and Bok. Neurochem Int 2017;109:162-70. [Crossref] [PubMed]
  25. Kashyap D, Garg VK, Goel N. Intrinsic and extrinsic pathways of apoptosis: Role in cancer development and prognosis. Adv Protein Chem Struct Biol 2021;125:73-120. [Crossref] [PubMed]
  26. Hengstschläger M, Braun K, Soucek T, et al. Cyclin-dependent kinases at the G1-S transition of the mammalian cell cycle. Mutat Res 1999;436:1-9. [Crossref] [PubMed]
  27. Hume S, Dianov GL, Ramadan K. A unified model for the G1/S cell cycle transition. Nucleic Acids Res 2020;48:12483-501. [Crossref] [PubMed]
  28. Wei SY, Li M, Tang SA, et al. Induction of apoptosis accompanying with G(1) phase arrest and microtubule disassembly in human hepatoma cells by jaspolide B, a new isomalabaricane-type triterpene. Cancer Lett 2008;262:114-22. [Crossref] [PubMed]
  29. Li DM, Sun H. PTEN/MMAC1/TEP1 suppresses the tumorigenicity and induces G1 cell cycle arrest in human glioblastoma cells. Proc Natl Acad Sci U S A 1998;95:15406-11. [PubMed]
  30. Niland S, Riscanevo AX, Eble JA. Matrix Metalloproteinases Shape the Tumor Microenvironment in Cancer Progression. Int J Mol Sci 2021;23:146. [PubMed]
  31. Cha HJ, Bae SK, Lee HY, et al. Anti-invasive activity of ursolic acid correlates with the reduced expression of matrix metalloproteinase-9 (MMP-9) in HT1080 human fibrosarcoma cells. Cancer Res 1996;56:2281-4. [PubMed]
Cite this article as: Alshahrani MM, Al Awadh AA. A pentacyclic triterpene tormentic acid inhibits the proliferation and migration of pancreatic ductal adenocarcinoma cells. Transl Cancer Res 2025;14(10):6442-6453. doi: 10.21037/tcr-2025-1050

Download Citation