NSD2 mediates NF-κB and matrix metalloproteinases to drive hepatocellular carcinoma malignant progression
Original Article

NSD2 mediates NF-κB and matrix metalloproteinases to drive hepatocellular carcinoma malignant progression

Meng Xiong1#, Qianshan Ding2,3#, Yingjie Wu4, Muhammad Jamal5, Xingruo Zeng5, Yufei Lei5, Hengjing He5, Di Xiao5, Qiuping Zhang5, Liang Shao6*, Xiaoxing Huang7*, Xinran Li8,9* ORCID logo

1School of Physical Education, Hubei Engineering University, Xiaogan, China; 2School of Medicine, Northwest University, Xi’an, China; 3Department of Gastroenterology, Renmin Hospital of Wuhan University, Wuhan, China; 4Department of Pathology, Zhongnan Hospital of Wuhan University, Wuhan, China; 5Department of Immunology, School of Basic Medical Sciences, Wuhan University, Wuhan, China; 6Department of Hematology, Zhongnan Hospital of Wuhan University, Wuhan, China; 7Department of Blood Transfusion, Zhongnan Hospital of Wuhan University, Wuhan, China; 8Department of Laboratory Medicine, Zhongnan Hospital of Wuhan University, Wuhan, China; 9Hubei Provincial Clinical Research Center for Molecular Diagnostics, Wuhan, China

Contributions: (I) Conception and design: X Li, M Xiong; (II) Administrative support: X Huang, L Shao, Q Zhang; (III) Provision of study materials or patients: M Xiong; (IV) Collection and assembly of data: M Xiong, Q Ding, Y Wu, X Zeng; (V) Data analysis and interpretation: Y Lei, H He, D Xiao; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

#These authors contributed equally to this work as co-first authors.

*These authors contributed equally to this work.

Correspondence to: Dr. Xinran Li, PhD. Department of Laboratory Medicine, Zhongnan Hospital of Wuhan University, No. 169 Donghu Road, Wuhan 430071, China; Hubei Provincial Clinical Research Center for Molecular Diagnostics, No. 169 Donghu Road, Wuhan 430071, China. Email: xinran2827@whu.edu.cn; Dr. Xiaoxing Huang, PhD. Department of Blood Transfusion, Zhongnan Hospital of Wuhan University, No. 169 Donghu Road, Wuhan 430071, China. Email: huangxx@whu.edu.cn; Dr. Liang Shao, MD, PhD. Department of Hematology, Zhongnan Hospital of Wuhan University, No. 169 Donghu Road, Wuhan 430071, China. Email: liangsmd@163.com.

Background: Hepatocellular carcinoma (HCC) remains a leading cause of cancer-related mortality globally, with limited therapeutic options available for advanced stages. Elucidating the molecular drivers of hepatocarcinogenesis holds promise for the development of targeted therapeutic strategies. Nuclear receptor-binding SET domain-containing protein 2 (NSD2), a histone lysine methyltransferase, is now recognized as a critical modulator of tumor progression. The aim of this study was to investigate the role of NSD2 in HCC.

Methods: Messenger ribonucleic acid (mRNA) and protein levels were determined in 20 HCC patients, publicly available databases and HCC cell lines. The in vitro and in vivo phenotypic alterations upon NSD2 knockdown, such as cell proliferation, apoptosis, migration, invasion and xenograft tumor burden in male BALB/c nude mice, were assessed. The potential effects of NSD2 on nuclear factor kappa B (NF-κB) and matrix metalloproteinases (MMPs) were also analysed.

Results: The findings revealed that NSD2 expression was markedly elevated in both HCC patients’ samples and cell lines. Elevated NSD2 expression was closely linked to poor prognosis in HCC patients. Furthermore, our experimental findings highlighted the critical role of NSD2 in enhancing the proliferation, migration, and invasion of HCC cells, while simultaneously inhibiting apoptosis both in vitro and in vivo. Notably, our research indicated NF-κB and MMPs as key mediators in these critical processes.

Conclusions: In summary, NSD2 acts as a tumorigenic factor in the progression of HCC by activating the NF-κB and MMPs signalling pathways.

Keywords: Hepatocellular carcinoma (HCC); nuclear receptor-binding SET domain-containing protein 2 (NSD2); oncogenic phenotypes; xenograft model; nuclear factor kappa B (NF-κB)


Submitted Apr 15, 2025. Accepted for publication Jul 29, 2025. Published online Oct 28, 2025.

doi: 10.21037/tcr-2025-799


Highlight box

Key findings

• Elevated nuclear receptor-binding SET domain-containing protein 2 (NSD2) in hepatocellular carcinoma (HCC) drives cell in vitro and in vivo progression via mediating nuclear factor kappa B (NF-κB) and matrix metalloproteinases (MMPs).

What is known and what is new?

• NSD2 has been implicated in multiple cancer types, yet the role of this molecule in HCC has not been investigated.

• Here, we deciphered the pivotal role of NSD2 in HCC and provides mechanistic insights into disease management.

What is the implication, and what should change now?

• Our findings establish NSD2 as a master regulator driving HCC pathogenesis, suggesting its potential as a prognostic biomarker in cancer intervention and treatment strategies.


Introduction

Liver cancer ranks as the sixth most common cancer worldwide, and the fourth leading cause of cancer-related mortality in global health statistics. The World Health Organization anticipates that by 2040, more than one million patients are expected to succumb to liver cancer (1,2). Hepatocellular carcinoma (HCC) represents the main pathological subtype of primary liver cancer (3). The major risk factors include, genetic hereditary, non-genetic host factors, exposure to environmental carcinogens and pathogens, as well as carcinogenic progression with chronic liver diseases, such as cirrhosis (4,5).

The nuclear receptor-binding SET domain-containing protein (NSD) family belongs to the histone methyltransferase family and comprises of three members: NSD1, NSD2 [also known as Wolf-Hirschhorn syndrome candidate 1 (WHSC1) or Multiple Myeloma SET Protein (MMSET)], and NSD3 [Wolf-Hisrchhorn Syndrome Candidate 1-Like 1 (WHSC1L1)] (6). These proteins catalyse the methylation (H3K36me1) and demethylation (H3K36me2) of lysine 36 in histone H3 to regulate gene expression (7-9). Notably, the aberrated level of post-transcriptional modifications of histones and the dysregulated activity of histone methyltransferase are commonly observed during tumorigenesis (9-12). NSD2, is a member of the histone lysine methyltransferase family. NSD2 is highly expressed in 15% to 20% of multiple myeloma patients, contributing to the initiation and tumorigenesis of multiple myeloma, highlighting NSD2 as a potential target for the treatment of multiple myeloma (13,14). In addition to affecting downstream gene expression through epigenetic changes, NSD2 also functions as a gene regulator at the transcriptional level. NSD2 binds to the promoter region of the target genes and directly activates the transcription of a series of oncogenes or inhibits the transcription of tumour suppressors, thereby promoting tumorigenesis (15). NSD2 involves in the progression of several cancers, such as triple-negative breast cancer (7,16), prostate cancer (17,18), and colorectal cancer (19,20). However, its role and underlying molecular mechanisms in NSD2 HCC remain unclear.

In this study, we explored the expression and function of NSD2 in HCC cells and found that NSD2 promoted the proliferation and inhibited the apoptosis of HCC cells through the inhibitory kappa B kinase α (IKKα)/nuclear factor kappa B (NF-κB) signalling pathway. Additionally, NSD2 induced the migration and invasion of HCC cells by regulating the NF-κB/Twist Family BHLH Transcription Factor 1 (TWIST1), matrix metalloproteinase 7 (MMP7), matrix metalloproteinase 9 (MMP9), and matrix metalloproteinase 14 (MMP14) signalling pathways. Our results suggested that NSD2 may serve as a novel therapeutic target for HCC treatment. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-799/rc).


Methods

Bioinformatics analysis

Timer 2.0 (http://timer.cistrome.org/) Gene_DE was utilized to determine the differential expression of NSD2 between tumour and adjacent normal tissues across all the tumour types in The Cancer Genome Atlas (TCGA). Gene expression profiles were acquired from the Gene Expression Omnibus (GEO). Related GEO datasets were obtained to analyse the messenger ribonucleic acid (mRNA) expression levels of NSD2 in carcinoma and non-carcinoma tissues. The specific Gene Expression Data Series (GSE) datasets used in this analysis were presented in Figure S1. The GSE14520 dataset was used to analyse the differences of NSD2 expression levels in cancer and paracancerous tissues and the expression characteristics of NSD2 in cancer tissues with different American Joint Committee on Cancer (AJCC) T stages. The data from GSE14520 were stratified to high and low cohorts in accordant with NSD2 expression, and the correlations between NSD2 expression, survival time, and clinicopathological characteristics of patients were analysed. The Kaplan-Meier statistic was used to draw the survival curves in two cohort of patients. Log-rank and Wilcoxon tests were used to compare differences between the curves. The Java program for gene set enrichment analysis (GSEA) was used to identify potential pathways and biological processes perturbed by elevated NSD2. Gene expression data from RNA-sequencing and protein level from the reverse-phase protein array (RPPA) for TCGA Liver Cancer (LIHC) were obtained from UCSC Xena (https://xenabrowser.net/datapages/). These datasets were used to observe and validate the correlations between NSD2 expression levels and the NF-κB signalling pathway in 181 liver cancer cases. NSD2 gene expression levels and NF-κB pathway phosphorylation levels were matched using the sample ID in the database.

Patient samples

Clinical samples from 20 patients with HCC and their corresponding para-cancerous tissues were collected at the Renmin Hospital of Wuhan University. These samples were collected by surgeons. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Medical Ethics Committee of the Renmin Hospital of Wuhan University (No. WDRY2019-K104). The requirement for informed consent was waived.

Cell culture

The HCC cell lines HepG2, LM3, BEL-7402, HuH7, SMMC-7721, as well as the human liver cell line L02, were obtained from the American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified Eagle’s medium (DMEM) with high glucose (Gibco, Carlsbad, CA, USA) medium. Additional 10% foetal bovine serum (FBS; Hyclone Corp., Logan, UT, USA) and 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco, Carlsbad, CA, USA) were added in the culture medium. Cells were placed in a 5% CO2 incubator at body temperature. Trypsin (0.25%)-ethylenediaminetetraacetic acid (EDTA) (Gibco, Carlsbad, CA, USA) were used when cell confluency reached 80%.

Small interfering RNA (siRNA) transfection

We used siRNA duplexes specifically targeting NSD2 (sequences 5'-3’ GCACACGAGAACGACAUCAdTdT and 3'-5’ dTdTCGUGUGCUCUUGCUGUAGU; RIBOBIO, Guangzhou, China) for gene knockdown experiments. The siRNAs with 20 nM final concentration were transfected into HepG2 and BEL-7402 cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) in serum-free Opti-MEM according to the manufacturer’s instructions. The knockdown efficiency by siRNAs were determined using quantitative polymerase chain reaction (PCR, for mRNA level) and western blotting (for protein level).

Quantitative real-time PCR

Patients’ samples from cancerous tissues and paracancerous tissues and HCC cell lines were treated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) for RNA extraction, followed by reverse transcript to complementary deoxyribonucleic acid (cDNA) using a reverse transcriptase kit (Promega, Madison, WI, USA). SYBR Premix Ex TaqTM (Takara, Japan) and accordant primers (see Table S1) were mixed for PCR reaction and melt curve were determined using iQTM5 instrument (Bio-Rad, Hercules, CA, USA). Relative mRNA expression was calculated using the 2−ΔΔCt method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was served as housekeeping gene.

Immunohistochemistry (IHC)

Paraffin-embedded HCC tissue and paracancerous tissue sections were dewaxed before rehydrated with descending graded ethanol, followed by 20 min antigen retrieval in a 10 mM sodium citrate buffer (pH 6.0) with microwave heating. Endogenous peroxidase was removed by 3% hydrogen peroxide treatment for 30 min at room temperature. Non-specific binding was then blocked with 10% normal goat serum for 30 min. Subsequently, anti-NSD2 (1:500, Millpore, USA) primary antibody were incubated at 4 ℃ overnight, followed by secondary antibody (anti-rabbit detection system; GUGE, China) for 30 min at 37 ℃. Signals of the sections were stained with 3,3’-diaminobenzidine and dehydrated before mounting.

Protein extraction and western blot analysis

The HCC cell line cells treated with or without siRNAs were lysed with radioimmunoprecipitation assay buffer supplemented with the protease inhibitor phenylmethylsulfonyl fluoride on ice. Total protein concentrations were determined using a BCA kit (Thermo Scientific, Waltham, MA, USA), and absorbance values were obtained by the PerkinElmer 2030 VICTOR X Multilabel Plate Reader (PerkinElmer, Waltham, MA, USA). Proteins were then separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Bio-Rad, Hercules, CA, USA). The membranes were then incubated with primary antibodies overnight and followed by corresponding secondary antibodies for additional 2 hours. Primary antibodies were acquired from Millipore (Burlington, MA, USA; NSD2, 1:1,000), Cell Signalling Technology (Danvers, MA, USA; PARP, #9542; caspase 3, #14220), Abcam (Cambridge, MA, USA; IKK α+β, ab178870), Invitrogen (Carlsbad, CA, USA; phosphorylated IKKα, PA5-121282) and BIOPRIMACY (Wuhan, China; GAPDH, 1:5,000, used as housekeeping gene). Signals of the membrane were measured with a chemiluminescence phototope-HRP kit (Vilber, Marne-la-vallée, France).

Cell Counting Kit-8 (CCK-8) assay

The CCK-8 solution (Dojindo Molecular Technologies, Inc., Tabaru, Japan) was used to determine the viability of HCC cells. HepG2 and Bel-7402 cells treated with or without NSD2 siRNAs were seeded at a density of 2×105/mL cells in 100 µL of medium in 96-well cell culture plates. At specified culture points (16, 24, and 48 h), 10 µL of CCK-8 was supplemented onto the cells for additional 2 hours co-culturing. The absorbances were acquired at 450 nm with the PerkinElmer 2030 VICTOR X Multilabel Plate Reader.

Cell apoptosis analysis

Cells were stained with Annexin V-allophycocyanin and propidium iodide (PI) staining (BD Biosciences, San Jose, CA) for apoptosis measurement. HepG2 and Bel-7402 cells (1×106/mL) were harvested and washed with cold PBS. Then, the cells were stained with Annexin V, followed by PI staining. Apoptosis signals were obtained using flow cytometer (BD FACSARiaTM III; BD Biosciences, San Jose, CA). The total apoptosis was determined by early apoptosis (Annexin V positive and PI negative) and late apoptosis (Annexin V positive and PI positive).

Wound healing assay

HepG2 and BEL-7402 cells transfected with or without NSD2 siRNAs were seeded in a 24-well plate for 48 h with 100% confluency prior to serum starvation with 1% FBS DMEM medium for another 24 h. The wound was created in each well by scratching the cell monolayer with a 10 µL tip. The images of cells before scratching and after 48 h migration were captured using microscope equipped with a charge-coupled device (CCD) camera.

Cell migration and invasion assays

HepG2 and BEL-7402 cells (5×105) transfected with or without NSD2 siRNAs were suspended in 100 µL serum-free DMEM medium and transferred to a transwell chamber (8.0 µm, Corning, Tewksbury, MA, USA) with or without coating with Matrigel (Invitrogen, Carlsbad, CA, USA). Lower part of the tranwell chamber were filled with 10% FBS containing medium. Cells were incubated and allowed for migration (without Matrigel) or invasion (with Matrigel) for 24 h. Then, cells that not migrated/invaded were removed using cotton swabs. Subsequently, cells were fixed with methanol and visualized with 0.1% crystal violet. Figures were captured using a light microscope equipped with a CCD camera.

Xenograft experiments

To test the role of NSD2 in vivo, stable cell lines were generated. The NSD2 gene-stably silenced HepG2 cell line (HepG2-sh07-NSD2) and the corresponding control cell line (HepG2-sh07-NC) were constructed using lentivirus packaging. Both cell lines were labelled with an M-Cherry fluorescent tag. The primer sequence for the silencing lentivirus plasmid was AAAAGATGAAGCAGGCACCAGAAATCTCGAGATTTCTGGTGCCTGCTTCATC.

Male BALB/c nude mice (aged 4 weeks) were obtained from Beijing HFK Bioscience Company, maintained in an air-conditioned pathogen-free room under controlled lighting conditions (12 h light/dark cycle), and fed a standard diet of laboratory food and water at the Center for Animal Experiments of Wuhan University (Animal Biosafety Level-III Laboratory). All animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals with the approval from Medical Ethics Committee of Wuhan University School of Medicine (No. WP20220037). A protocol was prepared before the study without registration. The procedures and protocol were under the supervision of animal central’s welfare guidelines. All mice were maintained in a stable environment for 1 week prior to the experiment.

To test the xenograft ability of the cells, 12 mice were randomly divided into two groups (n=6 per group) in accordance with the 3R principles. One group of mice were received a subcutaneous injection of HepG2-sh07-NSD2 cells, and another 6 mice were injected with HepG2-sh07-NC cells. The mice were weighed every 2 days. Tumour mass volume was measured every 2 days after visible tumour mass formation was observed on the backs of the mice. After 12 days post-injection of cells, the mice were sacrificed, and the exfoliated tumour samples were completely immersed in 4% paraformaldehyde. After 24 h, tumour masses were embedded in paraffin and sectioned.

For in vivo metastasis analysis, 12 mice were randomly divided into two groups (n=6 mice). One group of mice were injected with HepG2-sh07-NSD2 cells via the tail vein and another group of mice were injected with HepG2-sh07-NC cells. The mice were weighed every 3 days. After 48 days, the mice were anaesthetised, and cell metastasis was measured using in vivo imaging (BRUKER, Billerica, MA, USA). The harvested liver, spleen, lungs, and other organs were weighed and imaged.

Statistical analysis

All analyses were performed in triplicate with biological replicates. All data were presented as the mean ± standard error. Comparisons between groups were conducted using either the Student’s t-test or one-way analysis of variance with a post-hoc test. Data were analysed using GraphPad Prism 5 software for Windows (La Jolla, CA, USA), and P values <0.05 indicated statistical significance.


Results

NSD2 expression was elevated in HCC and other cancers

To evaluate NSD2 expression across various cancer types, we analysed data from Timer 2.0, which revealed that NSD2 (gene name WHSC1) expression were upregulated in most cancer types, including liver, lung, breast, and prostate cancers (Figure 1A). This observation was further substantiated using publicly available GEO datasets (Figure S1). For a more in-depth analysis, we focused on the largest available HCC dataset with clinical features in the GEO, i.e., GSE14520. The expression analysis indicated that NSD2 transcriptional levels were significantly higher in tumour tissues than in adjacent normal tissues (Figure 1B) and exhibited a positive correlation with AJCC T stages (Figure 1C). Notably, patients with high NSD2 expression exhibited lower survival rates (Figure 1D), underscored the fatal role of NSD2 on HCC patients. To further explore the clinical impact of NSD2 on HCC, we divided the samples into NSD2 high and NSD2 low cohorts and the correlations with various clinicopathological features were explored. As shown in Table 1, the expression level of NSD2 were associated with higher alpha-fetoprotein (AFP) (P<0.001) and alanine aminotransferase (ALT) levels (P=0.014), larger tumour size (P=0.022), advanced Cancer Liver Italian Program stage (P<0.002), and significantly correlated with the predicted risk metastasis signature (P<0.001). These findings suggested that NSD2 was highly expressed in HCC patients and may involve in modulating cell proliferation and metastasis.

Figure 1 Expression of NSD2 was increased in various cancer types, including HCC. (A) Data were obtained from the Timer2.0 Gene_DE analysis, and the full names of abbreviations are provided in Table S2. (B) NSD2 expression in HCC. (C) NSD2 expression levels in tumours with different AJCC T stages. The differences in expression were assessed using ANOVA (P=0.002). (D) Overall survival rate in high vs. low NSD2 expression group. Log-rank test, P=0.02; Gehan-Breslow-Wilcoxon test, P=0.01. (B-D) Data were obtained from the GSE14520 dataset. *, P<0.05; **, P<0.01; ***, P<0.001. AJCC, American Joint Committee on Cancer; ANOVA, analysis of variance; HCC, hepatocellular carcinoma; NSD2, nuclear receptor-binding SET domain-containing protein; T, tumor; TPM, transcripts per million.

Table 1

Correlation between the NSD2 expression and the clinicopathologic features of HCC

Characteristics No. of patient NSD2 expression χ2 value P value
High Low
Age 0.036 0.84
   ≤55 years 166 83 83
   >55 years 76 37 39
Gender 3.170 0.07
   Male 211 100 111
   Female 31 20 11
AFP 17.151 <0.001
   ≤200 ng/mL 128 47 81
   >200 ng/mL 110 70 40
ALT 6.041 0.01
   ≤50 U/L 142 61 81
   >50 U/L 100 70 40
Cirrhosis 0.462 0.49
   Yes 223 112 111
   No 19 8 11
Tumor size 5.232 0.02
   <5 cm 153 67 86
   ≥5 cm 88 52 36
Tumor number 1.013 0.31
   Solitary 190 91 99
   Multiple 52 29 23
BCLC stage 2.447 0.48
   0 20 12 8
   A 152 71 81
   B 24 11 13
   C 29 17 12
CLIP stage 15.084 0.002
   0 98 35 63
   1 79 47 32
   2, 3 44 28 16
   4, 5 4 1 3
PRMS classification 37.998 <0.001
   High 121 83 38
   Low 121 37 84

χ2 text was used. Data are presented as number. AFP, a-fetoprotein; ALT, alanine aminotransferase; BCLC, Barcelona Clinic Liver Cancer; CLIP, Cancer Liver Italian Program; HCC, hepatocellular carcinoma; NSD2, nuclear receptor-binding SET domain-containing protein; PRMS, predicted risk metastasis signature.

To further validate NSD2 expression on HCC patients, we have collected tumour samples as well as adjacent noncancerous tissues from 20 HCC patients from local hospital. Median age of 20 patients were 61.5 (range, 42–73) years with a male-to-female ratio of 7:3. Other clinical information was de-identified to us. The patient’s tissues were firstly subjected to RNA extraction and NSD2 mRNA level evaluation. As shown in Figure 2A, HCC patients exhibited elevation of NSD2 mRNA expressions compared with marginal control, with 65% of cancerous tissues demonstrating more than a 1.5-fold increase than in the margin tissues. In particular, NSD2 mRNA levels in seven samples exhibited more than a 5-fold increase than that observed in margin tissues. Protein levels of NSD2 were also explored by IHC and similar trend were acquired (Figure 2B). Staining score of sections showed a significantly strong NSD2 expression in HCC samples compared with its corresponding control (Figure 2C,2D). In addition to clinical patient’s samples, five HCC cell lines and one human liver cell line L02 were also explored on NSD2 expression. As shown in Figure 2E,2F, the HCC cell lines (BEL-7402, Huh7, and HepG2) displayed high levels of NSD2 mRNA (Figure 2E) and protein expression (Figure 2F) than human liver cell line L02. Collectively, these findings consistently demonstrated elevated NSD2 expression levels in various cancer types, with a particular emphasis on HCC.

Figure 2 NSD2 expression was increased in HCC patients and cell lines. (A) Real-time PCR analysis of NSD2 expressions in 20 HCC patients. (B) Representative images of immunohistochemistry staining in HCC patients (magnification, upper ×400, lower ×200). (C) Positive staining scores of NSD2. (D) Percentage of staining score of NSD2 in cancerous tissue or resection margin of HCC patients. (E,F) NSD2 expression in HCC cell lines were detected by RT-PCR (E) and western blot analysis (F). ***, P<0.001. HCC, hepatocellular carcinoma; NSD2, nuclear receptor-binding SET domain-containing protein; RT-PCR, real-time polymerase chain reaction.

NSD2 promoted the proliferation and inhibited apoptosis of HCC cells in vitro

As indicated by the publicly available datasets and in-house clinical samples, we sought to explore the oncogenic phenotypes of NSD2. Among the five HCC cell lines, Bel-7402 and HepG2 were characterised by elevated NSD2 expression, which were selected for subsequent experiments. To investigate the effect of NSD2 on the proliferation of Bel-7402 and HepG2, we employed siRNA to knock down NSD2 expression (Figure S2). As revealed by cell proliferation assay (Figure 3A,3B), NSD2 depletion significantly reduced cell proliferation, starting at 48 h post-NSD2 inhibition and leading to substantial growth inhibition by the 72-h mark. Furthermore, we evaluated apoptosis in Bel-7402 and HepG2 cells following NSD2 siRNA knockdown. The results showed that NSD2 depletion significantly induced apoptosis in HCC cells, with more than a 1.5-fold increase than in those treated with negative control siRNA (Figure 3C-3F). Caspase 3 and PARP [poly (ADP-ribose) polymerase] have been suggested to have a central role on execution of apoptosis (21-23), which promoting us to explore on whether NSD2 regulate caspase 3/PARP. As expected, we observed an elevation of PARP cleavage upon NSD2 depletion (Figure 3G) and a decrease of PARP cleavage by NSD2 overexpression (Figure 3H), indicating that NSD2 inhibited apoptosis via PARP. However, such trends were not observed in caspase 3 (Figure S3).

Figure 3 NSD2 promoted proliferation and inhibits apoptosis in HCC cells. (A,B) CCK-8 assays for evaluating the proliferation of BEL-7402 (A) and HepG2 (B) cells. (C-F) Apoptosis and statistical analysis of BEL-7402 (C,E) and HepG2 (D,F) cells. (G,H) Western blot analysis showing full length and cleavage PARP upon NSD2 knockdown (G) or overexpression (H). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. CCK-8, Cell Counting Kit-8; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HCC, hepatocellular carcinoma; NSD2, nuclear receptor-binding SET domain-containing protein; OD, optical density; siRNA, small interfering RNA; PARP, poly (ADP-ribose) polymerase.

NSD2 promoted HCC tumorigenesis in vivo

In addition to in vitro proliferative ability, role of NSD2 on in vivo tumorigenesis were also explored. Mice either subcutaneously injected with NSD2 knockdown stably-expressing cells (HepG2-sh07-NSD2) or control stable cells (HepG2-sh07-NC) were weighted every 2 days. No significant differences in body weight were observed between NSD2 knockdown and control mice (Figure 4A). However, the tumour growth rate was significantly lower in the HepG2-sh07-NSD2 group than in the HepG2-sh07-NC group (Figure 4B-4D). In the HepG2-sh07-NSD2 group, visible tumour formation was observed 4 days after the injection of cells, with only four of the six mice developing tumours by the end of the experiment. In contrast, the HepG2-sh07-NC group exhibited visible tumour formation just 2 days after cell injection, with all six mice developing tumours. Furthermore, the tumour size in the HepG2-sh07-NC group was significantly larger than that in the HepG2-sh07-NSD2 group (Figure 4B-4D). In conclusion, NSD2 has a vital role in HCC in vitro proliferation and in vivo tumorigenesis.

Figure 4 NSD2 promoted HCC cell proliferation in vivo. (A) Statistical analysis of body weight in the HepG2-sh07-NC and HepG2-sh07-NSD2 groups. (B-D) Tumour growth in the HepG2-sh07-NC and HepG2-sh07-NSD2 groups. *, P<0.05. NC, negative control; NSD2, nuclear receptor-binding SET domain-containing protein.

NSD2 enhanced the migration and invasion abilities of HCC cells

Apart from the role of proliferation, cell metastasis had also been implicated in NSD2 high expression cohort (Table 1). Thus, migration and invasion assays were also performed to explore the effect of NSD2 on the in vitro migration and invasion abilities in Bel-7402 and HepG2 cell lines. Wound healing and cell migration assays showed that compared with negative control, siRNA-mediated NSD2 knockdown significantly reduced the migration (Figure 5A-5H) and invasion (Figure 5I-5L) abilities of Bel-7402 and HepG2 cells.

Figure 5 NSD2 promoted migration and invasion in HCC cells. (A-D) Wound-healing assay for the migration of BEL-7402 (A,B) and HepG2 (C,D) cells. (E-H) Transwell assay for the migration of BEL-7402 (E,F) and HepG2 (G,H) cells. (I-L) Matrigel-transwell assay for invasion of BEL-7402 (I,J) and HepG2 (K,L) cells. Migrated (E,G) or invaded (I,K) cells were stained with 0.1% crystal violet for visualization. Magnification: (A,C) ×200; (E,G) ×200; (I,K) ×400. *, P<0.05; **, P<0.01; ***, P<0.001. HCC, hepatocellular carcinoma; NSD2, nuclear receptor-binding SET domain-containing protein; siRNA, small interfering RNA.

NSD2 facilitated the metastasis of HCC cells in vivo

As in vitro migration and invasion assays suggested depletion of NSD2 abolished the HCC cells’ migration and invasion abilities, we next sought to explore the in vivo metastasis manipulated by NSD2 downregulation. Cells stably expressing NSD2 shRNA or negative control were injected in mice via the tail vein. Compared with the HepG2-sh07-NC group, a significant difference in the body weight of mice was observed in the HepG2-sh07-NSD2 group (Figure 6A). Additionally, the HepG2-sh07-NSD2 group exhibited an increased liver weight ratio, whereas the weight ratio of the lungs and trachea decreased. There was no difference in the spleen weight ratio (Figure 6B). Furthermore, the survival of mice with tumour burden was longer in the HepG2-sh07-NSD2 group than in the HepG2-sh07-NC group (Figure 6C). All six mice in the HepG2-SH07-NSD2 group survived, whereas three out of six mice in the HepG2-sh07-NC group died on days 30, 36, and 39. The fluorescence intensity was significantly lower in the HepG2-sh07-NSD2 group than in the HepG2-sh07-NC group, and conspicuous metastases were observed in the lungs of mice in the HepG2-sh07-NC group (Figures 6D,6E,7A). Haematoxylin and eosin (H&E) staining of the lung tissue sections further confirmed this observation (Figure 7B). Moreover, we detected more HepG2 cells in the lungs and livers of the mice in the HepG2-sh07-NSD2 group (Figure 7C,7D). Taken together, our in vitro and in vivo experiments emphasised the pivotal role of NSD2 on cell invasion and metastasis.

Figure 6 NSD2 regulated HCC cell metastasis and invasion in vivo. (A) Statistical analysis of body weight in the HepG2-sh07-NC and HepG2-sh07-NSD2 groups. (B) Statistical analysis of the organ weight/body weight ratios in the HepG2-sh07-NC and HepG2-sh07-NSD2 groups. (C) Survival rates in the HepG2-sh07-NC and HepG2-sh07-NSD2 groups. (D) In vivo imaging revealing the migration and invasion of HCC cells. (E) Metastasis of HCC cells in various organs in the HepG2-sh07-NC and HepG2-sh07-NSD2 groups. *, P<0.05; **, P<0.01. HCC, hepatocellular carcinoma; NC, negative control; NSD2, nuclear receptor-binding SET domain-containing protein.
Figure 7 NSD2 regulated the invasion of HCC cells into the lung. (A) Representative images of lungs of mice. (B) Haematoxylin & eosin staining of the lung tissue. (C,D) Flow cytometry results showing the proportion of HepG2 cells in the lung and liver of mice. Scale bar, 20 µm. *, P<0.05. HCC, hepatocellular carcinoma; NC, negative control; NSD2, nuclear receptor-binding SET domain-containing protein.

NSD2 regulated HCC cell proliferation and migration via the NF-κB signalling pathway

To elucidate the mechanism by which NSD2 was simplicated in HCC cell proliferation, migration, and invasion, we conducted GSEA using the expression profile data from GSE14520. As shown in GSEA dot plot (Figure 8A) and representative GSEA figures (Figure 8B), biological processes related to cell cycle were noticeable, indicating that NSD2 regulates a cluster of genes associated with cell proliferation, cell cycle progression, and chromatin dynamics. Therefore, we conducted additional investigations into the pivotal factors related to cell proliferation and cell cycle progression, which encompassed the NF-κB pathway, epithelial-mesenchymal transition (EMT) markers, and migration-related markers. Our findings demonstrated that NSD2 inhibition significantly decreased IKKα phosphorylation (Figure 8C) and suppressed the expression of EMT marker TWIST1 and migration-related genes such as MMP7, MMP9, and MMP14 (Figure 8D), suggesting that NSD2 promotes HCC cell proliferation, migration and invasion via the NF-κB/MMPs signalling pathway. Notably, we explored the correlation between NSD2 and the NF-κB pathway in TCGA HCC cohort. We found that NSD2 gene expression was strongly correlated with the phosphorylation level of p65, a key subunit in the NF-κB dimer (Figure 8E). These results suggest that NSD2 promotes HCC cell proliferation and migration through the NF-κB signalling pathway.

Figure 8 NSD2 regulates HCC cell proliferation, migration and invasion via NF-κB signalling. (A,B) Dot plot and representative GSEA graphic comparing the differences in patients with high and low NSD2 expression. (C) Western blot analysis showing the phosphorylation levels of IKKα in HepG2 cell lines. (D) Real-time PCR results showing the expression levels of WHSC1, TWIST1, MMP1, MMP2, MMP7, MMP9, and MMP14 upon siRNA-mediated NSD2 knockdown in HepG2 cells. (E) Correlation between NSD2 gene expression (RNA-sequencing data) and NF-κB p65 phosphorylation level (RPPA data) using data from the TCGA HCC cohort. *, P<0.05; **, P<0.01; ***, P<0.001. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GSEA, gene set enrichment analysis; IKKα, inhibitory kappa B kinase α; MMP, matrix metalloproteinase; NF-κB, nuclear factor kappa B; NSD2, nuclear receptor-binding SET domain-containing protein; PCR, polymerase chain reaction; RPPA, reverse-phase protein array; siRNA, small interfering RNA; TCGA, The Cancer Genome Atlas; TWIST1, Twist Family BHLH Transcription Factor 1.

Discussion

The NSD family comprises a class of DNA methyltransferases (DNMTs) that are closely associated with multiple processes, including tumourigenesis, embryonic development, and cell fate determination. NSDs play different roles in various cells by activating multiple signalling pathways (7,18-20). As a member of the methyltransferase family, NSD2 exhibits catalytic activity (21,22). Although previous studies have explored the biological function of NSD2 in cancer, its specific regulatory mechanisms in HCC cell proliferation, migration, and invasion remain unclear. A comprehensive analysis of the HCC data set GSE14520 identified significant associations between elevated NSD2 expression and accelerated tumour growth, severe liver damage, and poor outcomes. These findings suggest that NSD2 could serve as a potential prognostic marker for HCC patients after curative hepatectomy. Bioinformation analysis have also been employed on publicly available HCC datasets, but validation of in vitro and in vivo experiments was also warranted (24). A previous study used IHC to assess the correlations between NSD2 and HCC pathological characteristics and prognosis, as a semi-quantitative method, there were certain limitations because of reliance on visual estimation by the observer (25). Therefore, we used microarray data from a shared dataset, which offers a more objective and precise analysis with a larger sample size and further corroborated the role of NSD2 as a potent prognostic predictor for patients with HCC.

Our findings highlighted that NSD2 inhibition effectively suppressed the proliferation, metastasis, and invasion of HCC cells both in vivo and in vitro. A critical regulatory pathway involved in the cell cycle known as the cell cycle barrier controls cell cycle progression, which ensures that key cell cycle processes, such as DNA replication and chromosome separation are completed before transitioning to the next phase. The loss of the cell cycle barrier increases the instability of the genome, which can eventually lead to the sustained proliferation of cells and tumorigenesis (26). Consistently, GSEA analysis revealed that NSD2 was associated with gene sets related to DNA damage detection points, DNA replication, DNA damage response signal transduction, and DNA replication, underscoring the crucial role of NSD2 in HCC cell proliferation.

NF-κB serves as a hub in signal transduction pathways in eukaryotes that promotes tumorigenesis and cancer development by inducing transcription of multiple target genes related to proliferation, cell cycle, differentiation, migration, invasion and inflammation (27). Notably, activation of NF-κB can resist apoptosis induced by cisplatin in HCC (28,29). NSD1 methylates the subunit RELA/P65 of NF-κB in tumours and plays a regulatory role through non-histone methylation pathways (30). IKKα, a member of the IKK family, is activated by NF-κB-induced kinases and phosphorylates the NF-κB inhibitor P100 (31). Importantly, IKKα catalyses the phosphorylation of silencing mediator of thyroid hormone receptor proteins, leading to the separation of silencing mediator of thyroid hormone receptor proteins and histone acetylase 3 complexes from chromatin and migration from the nucleus into the cytoplasm. This is essential for the expression of various NF-κB-dependent genes (32). In our data, we observed a decrease of IKKα phosphorylation upon NSD2 depletion and a positive correlation between NSD2 and NF-κB p65 protein. Indeed, previous study have suggested NSD2 served as strong activator of NF-κB by directly binding to p65 and p50 of NF-κB in castration-resistant prostate cancer cells (33). Moreover, chromatin immunoprecipitation (ChIP) assay revealed that NSD2 regulated several genes by occupying the promoter region of these genes, such as IL-6, IL-8, that were known as the targets of NF-κB (33). Although we did not perform ChIP assay, this study provided us a possible mechanistic explanation on how NSD2 regulated NF-κB activity and MMP expression.

The metastasis and invasion of cancer cells is a complex multi-stage process involving numerous genes that determine the malignant characteristics of cancer cells (34-36). Our findings elucidated the role of NSD2 in the metastasis and invasion of HCC cells through cytological and animal experiments in vitro and in vivo. TWIST1, as a conserved transcription factor in evolution, promotes cell migration. Additionally, TWIST1 is frequently expressed in various tumours and is involved in tumour angiogenesis and the induction of EMT (37,38). The role of MMPs in the occurrence and development of cancer has been a popular research topic. MMPs have the ability to degrade all protein components in the extracellular matrix, thereby destroying the histological barrier to cancer cell invasion. MMPs are the key proteolytic enzymes involved in the metastasis and invasion of cancer cells (39,40). Based on the results of this study, we speculate that NSD2 may promote the metastasis and invasion of HCC cells by regulating the expression levels of TWIST1, MMP7, MMP9, and MMP14.

Given its critical role in cancer progression, efforts have been made toward inhibiting of NSD2, showing great clinical potential. Among the protein structures of NSD2, two categories of domain, a highly conserved SET domains and two PWWP domains, are druggable by competitive inhibition of binding sites. Inhibitors targeting SET domain can occupy the catalytic binding site and prevent its methyl transferring, thus causing the downregulation of H3k36me2 level (41-44). On the other hand, inhibitors blocking the aromatic cage in the PWWP1 domain interfere with the binding of NSD2 to H3K36me2 without disturbing its intracellular levels (44-47). A potent NSD2 inhibitor KTX-1001 targeting SET domain is currently advancing to phase I clinical trial for patients with relapsed or refractory multiple myeloma (NCT05651932) (6). In addition, NSD2 facilitated multiple lung cancer cell lines proliferation by supporting reticular activating system (RAS)-driven transcription and inhibition of NSD2 combined with MAP kinase kinase (MEK) or bromodomain containing 4 (BRD4) inhibitors induced a cooperative cell growth inhibition (48). Likewise, a dual-inhibition of NSD2 and histone deacetylase 2 (HDAC2) exhibited a strong in vitro and in vivo anti-proliferative ability to liver cancer cell lines, including HepG2 cells (49).

Our study had several limitations. First, the potential role of NSD2 in regulating the tumorigenesis and progression of HCC via epigenetic modifications was not explored. Second, although we identified an association between NSD2 overexpression and NF-κB activation, the precise mechanisms underlying this regulatory effect remain unclear. Finally, to further evaluate the prognostic value of NSD2, a larger cohort of HCC patients is needed to analyse the relationship between NSD2 expression and patient prognosis.


Conclusions

In summary, our research identified the elevated expression of NSD2 in HCC by analyzing the in-house patient samples, publicly available datasets as well as HCC cell lines. Depletion of NSD2 restraint HCC cells from in vitro and in vivo oncogenic phenotypes. Notably, we demonstrated that NSD2 mediated tumorigenesis through NF-κB and MMPs activation. Our findings establish NSD2 as a master regulator driving HCC pathogenesis, suggesting its potential as a prognostic biomarker in cancer intervention.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-799/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-799/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-799/prf

Funding: This work was supported by the National Natural Science Foundation of China (Nos. 82102793 and 81703030), Hubei Provincial Natural Science Foundation of China (No. 2023AFB440), Xiaogan Natural Science Program (No. XGKJ2020010058), and China Postdoctoral Science Foundation (No. 2021M692613).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-799/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Medical Ethics Committee of the Renmin Hospital of Wuhan University (No. WDRY2019-K104). The requirement for informed consent was waived. All animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals with the approval from Medical Ethics Committee of Wuhan University School of Medicine (No. WP20220037).

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Rumgay H, Arnold M, Ferlay J, et al. Global burden of primary liver cancer in 2020 and predictions to 2040. J Hepatol 2022;77:1598-606. [Crossref] [PubMed]
  2. Rahib L, Wehner MR, Matrisian LM, et al. Estimated Projection of US Cancer Incidence and Death to 2040. JAMA Netw Open 2021;4:e214708. [Crossref] [PubMed]
  3. Llovet JM, Kelley RK, Villanueva A, et al. Hepatocellular carcinoma. Nat Rev Dis Primers 2021;7:6. [Crossref] [PubMed]
  4. Toh MR, Wong EYT, Wong SH, et al. Global Epidemiology and Genetics of Hepatocellular Carcinoma. Gastroenterology 2023;164:766-82. [Crossref] [PubMed]
  5. Huang DQ, Mathurin P, Cortez-Pinto H, et al. Global epidemiology of alcohol-associated cirrhosis and HCC: trends, projections and risk factors. Nat Rev Gastroenterol Hepatol 2023;20:37-49. [Crossref] [PubMed]
  6. He L, Cao Y, Sun L. NSD family proteins: Rising stars as therapeutic targets. Cell Insight 2024;3:100151. [Crossref] [PubMed]
  7. Chen D, Chen X, Yang M, et al. H3K36me2 methyltransferase NSD2/WHSC1 promotes triple-negative breast cancer metastasis via activation of ULK1-dependent autophagy. Autophagy 2025;21:1824-42. [Crossref] [PubMed]
  8. Rajagopalan KN, Chen X, Weinberg DN, et al. Depletion of H3K36me2 recapitulates epigenomic and phenotypic changes induced by the H3.3K36M oncohistone mutation. Proc Natl Acad Sci U S A 2021;118:e2021795118. [Crossref] [PubMed]
  9. Lee MK, Park NH, Lee SY, et al. Context-Dependent and Locus-Specific Role of H3K36 Methylation in Transcriptional Regulation. J Mol Biol 2025;437:168796. [Crossref] [PubMed]
  10. Strepkos D, Markouli M, Klonou A, et al. Histone Methyltransferase SETDB1: A Common Denominator of Tumorigenesis with Therapeutic Potential. Cancer Res 2021;81:525-34. [Crossref] [PubMed]
  11. Ren J, Li N, Pei S, et al. Histone methyltransferase WHSC1 loss dampens MHC-I antigen presentation pathway to impair IFN-γ-stimulated antitumor immunity. J Clin Invest 2022;132:e153167. [Crossref] [PubMed]
  12. Zhao S, Allis CD, Wang GG. The language of chromatin modification in human cancers. Nat Rev Cancer 2021;21:413-30. [Crossref] [PubMed]
  13. C Chong PSY. Histone Methyltransferase NSD2 Activates PKCα to Drive Metabolic Reprogramming and Lenalidomide Resistance in Multiple Myeloma. Cancer Res 2023;83:3414-27. [Crossref] [PubMed]
  14. Huang Z, Wu H, Chuai S, et al. NSD2 is recruited through its PHD domain to oncogenic gene loci to drive multiple myeloma. Cancer Res 2013;73:6277-88. [Crossref] [PubMed]
  15. Lu S, Zheng Z, Zhu C. Histone methyltransferase WHSC1 cooperate with YBX1 promote glioblastoma progression via regulating PLK1 expression. Cell Signal 2024;124:111471. [Crossref] [PubMed]
  16. Gao B, Liu X, Li Z, et al. Overexpression of EZH2/NSD2 Histone Methyltransferase Axis Predicts Poor Prognosis and Accelerates Tumor Progression in Triple-Negative Breast Cancer. Front Oncol 2020;10:600514. [Crossref] [PubMed]
  17. Want MY, Tsuji T, Singh PK, et al. WHSC1/NSD2 regulates immune infiltration in prostate cancer. J Immunother Cancer 2021;9:e001374. [Crossref] [PubMed]
  18. Parolia A, Eyunni S, Verma BK, et al. NSD2 is a requisite subunit of the AR/FOXA1 neo-enhanceosome in promoting prostate tumorigenesis. Nat Genet 2024;56:2132-43. [Crossref] [PubMed]
  19. Song D, Hu F, Huang C, et al. Tiam1 methylation by NSD2 promotes Rac1 signaling activation and colon cancer metastasis. Proc Natl Acad Sci U S A 2023;120:e2305684120. [Crossref] [PubMed]
  20. Zhao LH, Li Q, Huang ZJ, et al. Identification of histone methyltransferase NSD2 as an important oncogenic gene in colorectal cancer. Cell Death Dis 2021;12:974. [Crossref] [PubMed]
  21. Jiang M, Qi L, Li L, et al. The caspase-3/GSDME signal pathway as a switch between apoptosis and pyroptosis in cancer. Cell Death Discov 2020;6:112. [Crossref] [PubMed]
  22. Eskandari E, Eaves CJ. Paradoxical roles of caspase-3 in regulating cell survival, proliferation, and tumorigenesis. J Cell Biol 2022;221:e202201159. [Crossref] [PubMed]
  23. Kaur SD, Chellappan DK, Aljabali AA, et al. Recent advances in cancer therapy using PARP inhibitors. Med Oncol 2022;39:241. [Crossref] [PubMed]
  24. Yan J, Zhang MY, Lin J, et al. WHSC1 is involved in DNA damage, cellular senescence and immune response in hepatocellular carcinoma progression. J Cell Mol Med 2023;27:1436-41. [Crossref] [PubMed]
  25. Zhou P, Wu LL, Wu KM, et al. Overexpression of MMSET is correlation with poor prognosis in hepatocellular carcinoma. Pathol Oncol Res 2013;19:303-9. [Crossref] [PubMed]
  26. Zeng J, Hills SA, Ozono E, et al. Cyclin E-induced replicative stress drives p53-dependent whole-genome duplication. Cell 2023;186:528-542.e14. [Crossref] [PubMed]
  27. Yu H, Lin L, Zhang Z, et al. Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study. Signal Transduct Target Ther 2020;5:209. [Crossref] [PubMed]
  28. Gupta R, Kadhim MM, Turki Jalil A, et al. Multifaceted role of NF-κB in hepatocellular carcinoma therapy: Molecular landscape, therapeutic compounds and nanomaterial approaches. Environ Res 2023;228:115767. [Crossref] [PubMed]
  29. Seydi H, Nouri K, Rezaei N, et al. Autophagy orchestrates resistance in hepatocellular carcinoma cells. Biomed Pharmacother 2023;161:114487. [Crossref] [PubMed]
  30. Chen Y, Tang W, Zhu X, et al. Nuclear receptor binding SET domain protein 1 promotes epithelial-mesenchymal transition in paclitaxel-resistant breast cancer cells via regulating nuclear factor kappa B and F-box and leucine-rich repeat protein 11. Bioengineered 2021;12:11506-19. [Crossref] [PubMed]
  31. Li C, Moro S, Shostak K, et al. Molecular mechanism of IKK catalytic dimer docking to NF-κB substrates. Nat Commun 2024;15:7692. [Crossref] [PubMed]
  32. Giffney HE, Cummins EP, Murphy EP, et al. Protein kinase D, ubiquitin and proteasome pathways are involved in adenosine receptor-stimulated NR4A expression in myeloid cells. Biochem Biophys Res Commun 2021;555:19-25. [Crossref] [PubMed]
  33. Yang P, Guo L, Duan ZJ, et al. Histone methyltransferase NSD2/MMSET mediates constitutive NF-κB signaling for cancer cell proliferation, survival, and tumor growth via a feed-forward loop. Mol Cell Biol 2012;32:3121-31. [Crossref] [PubMed]
  34. Gerstberger S, Jiang Q, Ganesh K. Metastasis. Cell 2023;186:1564-79. [Crossref] [PubMed]
  35. Kiri S, Ryba T. Cancer, metastasis, and the epigenome. Mol Cancer 2024;23:154. [Crossref] [PubMed]
  36. Castaneda M, den Hollander P, Kuburich NA, et al. Mechanisms of cancer metastasis. Semin Cancer Biol 2022;87:17-31. [Crossref] [PubMed]
  37. Saitoh M. Transcriptional regulation of EMT transcription factors in cancer. Semin Cancer Biol 2023;97:21-9. [Crossref] [PubMed]
  38. Brabletz S, Schuhwerk H, Brabletz T, et al. Dynamic EMT: a multi-tool for tumor progression. EMBO J 2021;40:e108647. [Crossref] [PubMed]
  39. Tanaka N, Sakamoto T. MT1-MMP as a Key Regulator of Metastasis. Cells 2023;12:2187. [Crossref] [PubMed]
  40. Wang F, Yi J, Chen Y, et al. PRSS2 regulates EMT and metastasis via MMP-9 in gastric cancer. Acta Histochem 2023;125:152071. [Crossref] [PubMed]
  41. Lewis CA, Schmidt C, Beebe L, et al. Characterization of the activity of KTX-1001, a small molecule inhibitor of multiple myeloma SET domain using surface plasmon resonance. J Biol Chem 2025;301:110382. [Crossref] [PubMed]
  42. Wang S, Yang H, Su M, et al. 5-Aminonaphthalene derivatives as selective nonnucleoside nuclear receptor binding SET domain-protein 2 (NSD2) inhibitors for the treatment of multiple myeloma. Eur J Med Chem 2021;222:113592. [Crossref] [PubMed]
  43. Tang H, Yu A, Xing L, et al. Structural Modification and Pharmacological Evaluation of Substituted Quinoline-5,8-diones as Potent NSD2 Inhibitors. J Med Chem 2023;66:1634-51. [Crossref] [PubMed]
  44. Zhang L, Zha X. Recent advances in nuclear receptor-binding SET domain 2 (NSD2) inhibitors: An update and perspectives. Eur J Med Chem 2023;250:115232. [Crossref] [PubMed]
  45. Ferreira de Freitas R, Liu Y, Szewczyk MM, et al. Discovery of Small-Molecule Antagonists of the PWWP Domain of NSD2. J Med Chem 2021;64:1584-92. [Crossref] [PubMed]
  46. Dilworth D, Hanley RP, Ferreira de Freitas R, et al. A chemical probe targeting the PWWP domain alters NSD2 nucleolar localization. Nat Chem Biol 2022;18:56-63. [Crossref] [PubMed]
  47. Li N, Yang H, Liu K, et al. Structure-Based Discovery of a Series of NSD2-PWWP1 Inhibitors. J Med Chem 2022;65:9459-77. [Crossref] [PubMed]
  48. García-Carpizo V, Sarmentero J, Han B, et al. NSD2 contributes to oncogenic RAS-driven transcription in lung cancer cells through long-range epigenetic activation. Sci Rep 2016;6:32952. [Crossref] [PubMed]
  49. Jin X, Wang Y, Chen J, et al. Novel dual-targeting inhibitors of NSD2 and HDAC2 for the treatment of liver cancer: structure-based virtual screening, molecular dynamics simulation, and in vitro and in vivo biological activity evaluations. J Enzyme Inhib Med Chem 2024;39:2289355. [Crossref] [PubMed]
Cite this article as: Xiong M, Ding Q, Wu Y, Jamal M, Zeng X, Lei Y, He H, Xiao D, Zhang Q, Shao L, Huang X, Li X. NSD2 mediates NF-κB and matrix metalloproteinases to drive hepatocellular carcinoma malignant progression. Transl Cancer Res 2025;14(10):6864-6880. doi: 10.21037/tcr-2025-799

Download Citation