Methylation-regulated tumor suppressor gene HOXB4 inhibits human lung adenocarcinoma A549 cell invasion and metastasis through the RAP1 signaling pathway
Highlight box
Key findings
• Homeobox B4 (HOXB4) was significantly downregulated in lung adenocarcinoma (LUAD) tissue. Overexpression of HOXB4 could inhibit the proliferation, migration, and invasion abilities of LUAD cells by altering the RAP1 signaling pathway.
What is known and what is new?
• HOXB4 is a hypermethylated gene in lung cancer tissues, and its DNA methylation level is associated with the prognosis and early diagnosis of lung cancer patients.
• The expression level of HOXB4 is downregulated in LUAD cell lines. Overexpression of HOXB4 reduces the in vitro viability of LUAD cells and inhibit epithelial-mesenchymal transition in LUAD cells by regulating the RAP1 signaling pathway.
What is the implication, and what should change now?
• HOXB4 had a tumor suppressor role in LUAD, the hypermethylation of HOXB4 can predict lung adenocarcinoma and be associated with a poorer prognosis. HOXB4 may be an important marker of patient early diagnosis and prognosis.
Introduction
Lung cancer remains the leading cause of cancer morbidity and mortality, with almost 2.5 million new cases and over 1.8 million deaths worldwide in 2022 (1). There are various types of lung cancers, such as non-small cell lung cancer (NSCLC) which accounts for approximately 85% of all lung cancers. Lung adenocarcinoma (LUAD) is the most common histological subtype of NSCLC, accounting for approximately 40–45% of all cases (2,3). Currently, LUAD treatments mainly include surgical resection, chemotherapy, radiation therapy and immunotherapy. Despite advances in these treatments, the prognoses of patients with LUAD remain unsatisfactory, mainly owing to cancer progression and metastasis, as well as the lack of effective therapeutic targets (4,5). Therefore, it is urgent to identify effective biomarkers and therapeutic targets for LUAD.
The homeobox (HOX) genes, a subgroup of transcription factors containing a highly conserved homeodomain, play pivotal roles in stem cell self-renewal and tumorigenesis (6). Homeobox B4 (HOXB4) is a positive regulator involved in the self-renewal of hematopoietic stem cells (7) and is considered to be either an oncogene or tumor suppressor gene, depending on the specific type of cancer (8). It has been reported that elevated HOXB4 expression promotes ovarian cancer progression through encodes for the dehydrodolichyl diphosphate synthase subunit (DHDDS) and is associated with drug resistance (9,10). In colorectal cancer tissues, HOXB4 mRNA and protein levels are significantly elevated, and correlate with advanced pathological stage and poor survival outcomes (11). However, HOXB4 attenuates the tumorigenesis of cervical cancer cells by decreasing the activity of the Wnt/β-catenin signaling pathway (12), and inhibits breast cancer cell migration by targeting STARD13 (13). In hepatocellular carcinoma, HOXB4 functions as a tumor suppressor by negatively regulating the METTL7B/TKT axis. Downregulation of HOXB4 correlates with poor prognosis, while its overexpression suppresses proliferation, metastasis, and epithelial-mesenchymal transition (EMT) via downregulating mesenchymal markers (N-cadherin, Vimentin) and upregulating epithelial markers (E-cadherin) (14). In addition, some studies have focused on epigenetic alterations involving hypermethylation of the HOXB4 promoter in cancers, including LUADs (15-17), and it has recently been reported that identification of DNA methylation biomarkers, which includes HOXB4, provides the potential for early detection of lung cancers (18-20). Although these studies demonstrate that HOXB4 is involved in LUAD, its contribution to LUAD remains largely unknown.
In the present study, we therefore aimed to systematically determine the prognostic value, diagnostic value, and biological function of HOXB4 in LUAD through approaches including bioinformatics and experimental studies. We also sought to identify its molecular mechanisms of action. Our findings could provide novel insights into the treatment and diagnosis of LUAD. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-226/rc).
Methods
Cell culture and clinical specimens
The human LUAD cell line A549 was sourced from either the American Type Culture Collection (ATCC, Manassas, VA, USA) or collaborative partners. Cells were propagated in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, under standard conditions (37 ℃, 5% CO2). Primary tumor tissues, adjacent non-tumor tissues, and normal lung specimens were procured from the Department of Cardiothoracic Surgery at The First Affiliated Hospital of Chongqing Medical University (Chongqing, China; patient characteristics in Table 1). This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The ethical approval for this study was obtained from the Clinical Trials Ethics Committee of The First Affiliated Hospital of Chongqing Medical University (Chongqing, China) (No. 2024-167-01). Written informed consent was taken from all the participants.
Table 1
| Clinicopathological features | Number (n=40) |
|---|---|
| Gender | |
| Male | 28 |
| Female | 12 |
| Age, years | |
| <60 | 11 |
| 60–69 | 23 |
| ≥70 | 6 |
| Phase | |
| I | 24 |
| II | 12 |
| III | 4 |
| IV | 0 |
LUAD, lung adenocarcinoma.
Analyses using online databases
Pan-cancer expression of HOXB4 was analyzed using the TIMER2 database (http://timer.cistrome.org/). The UALCAN (http://ualcan.path.uab.edu/) was used to analyze the expression and methylation levels of HOXB4 in normal and LUAD tissues as well as the relationship between HOXB4 DNA methylation and the clinical characteristics of LUAD patients. Then, we used MethMarkerDB (https://methmarkerdb.hzau.edu.cn/) to analyze the correlation between HOXB4 DNA methylation and patient survival in LUAD. Gene expression data were obtained from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/) and GSE37745 which was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). Analysis was performed using R (version: 4.3.3) to obtain the most relevant genes of HOXB4 and uploaded to the Database for Annotation, Visualization, and Integrated Discovery (DAVID 2021). Finally, enrichment results were obtained from Gene Ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. The top five results in ascending order of P value (P<0.05) were displayed in this study and mapped with the online web platform Sangerbox (http://www.sangerbox.com/tool).
RNA isolation and quantitative polymerase chain reaction (qPCR) assays
Total RNA was isolated from cells and tissues using TRIzol® (Molecular Research Center, Cincinnati, OH, USA) per manufacturer’s protocol. Quantitative PCR employed SYBR® Green Master Mix (Thermo Fisher Scientific, Hong Kong, China) on an HT7500 system (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the endogenous control. Validated primers (e.g., HOXB4-F: 5'-CGTGAGCACGGTAAACCCC-3' and HOXB4-R: 5'-CGAGCGGATCTTGGTGTTG-3') were designed and validated for amplification efficiency. All primer sequences are listed in Table 2.
Table 2
| Primer | Sequence (5'-3') |
|---|---|
| RAP1A-F | GAAGAACGGCCAAGGTTTTGC |
| RAP1A-R | CCGTGTCCTTAACCCGTAAAATC |
| RAP1B-F | AGCAAGACAATGGAACAACTGT |
| RAP1B-R | TGCCGCACTAGGTCATAAAAG |
| RAPGEF3-F | GACCGGAAGTACCACCTTAGG |
| RAPGEF3-R | AGATTCCCACAACTTGGCTCC |
| RAPGEF4-F | CATGTGGCAAGTCCTGTTAGAA |
| RAPGEF4-R | CTCCTCCTCAGTAGGCAAAGG |
| RAP1GAP-F | GAGGAGGACTACATTCCATACCC |
| RAP1GAP-R | GCTGGTGATTTCGTGGTTGG |
| HOXB4-F | CGTGAGCACGGTAAACCCC |
| HOXB4-R | CGAGCGGATCTTGGTGTTG |
| GAPDH-F | GGAGTCAACGGATTTGGT |
| GAPDH-R | GTGATGGGATTTCCATTGAT |
PCR, polymerase chain reaction.
Construction of vector- and HOXB4-expressing stable cell lines
A HOXB4-expressing stable cell line was generated. First, a HOXB4-expressing plasmid was constructed by inserting HOXB4 full-length gene with a flag into pcDNA3.1(+) framework. The recombinant plasmid was sequenced. Next, pcDNA3.1 and HOXB4-containing plasmid (4 µg) were transfected into A549 cell line using Lipofectamine 2000 (Invitrogen, Carlsbad, USA). After transfection, cells were cultured in non-selective medium for 48 h before switching to selection medium containing 400 µg/mL G418 (Invitrogen/Gibco). After 14 days, individual colonies were isolated and cultured. Concurrently, DNase I-treated total RNA from transfected cells was used to confirm HOXB4 expression in stable cells via reverse transcription qPCR (RT-qPCR) and Western blotting.
Cell Counting Kit-8 (CCK-8) assay
Post-transfection with HOXB4 or control (pcDNA3.1) plasmids, A549 cells were plated at 2,000 cells/well in 96-well plates. Cell proliferation was assessed using the CCK-8 assay at 0, 24, 48, and 72 h. At each time point, 10 µL CCK-8 solution mixed with 100 µL DMEM complete medium was added per well. Plates were incubated for 2 h at 37 ℃ before measuring absorbance at 450 nm using a microplate reader. Three independent replicates were performed.
Cell migration and invasion assays
Cell migration and invasion were assessed via Transwell chambers (6.5 mm inserts, 8 µm pores). For invasion assays specifically, the membrane was coated with Matrigel (BD Biosciences, San Jose, CA, USA). This coating models the extracellular matrix barrier that invasive cells must degrade, distinguishing invasion from simple migration measured on uncoated membranes. Excess stain was washed off with PBS after 24 h fixation and staining, and cells in the upper chamber were wiped off pictured and tallied below microscope.
Flow cytometric analysis of cell cycle and apoptosis
To evaluate the cell cycle, cells were digested with trypsin and fixed with ice-cold 70% ethanol, treated with 5 mg/mL RNase A (Sigma, St. Louis, MO, USA), and stained with propidium iodide (PI). To analyze apoptosis, double staining was performed with annexin V-fluorescein isothiocyanate and PI. Data were analyzed using CellQuest™ Pro (BD Biosciences). All experiments were performed in triplicate.
Western blot
Cells underwent lysis using a protein extraction reagent (Thermo Scientific, Rockford, IL, USA) supplemented with the protease inhibitor phenylmethanesulfonyl fluoride (PMSF) and a phosphatase inhibitor cocktail (Sigma). Subsequently, proteins within the resultant lysates (50 µg total protein per sample) were separated via sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were then electrophoretically transferred onto polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA). Following transfer, the membranes were subjected to incubation with specific primary antibodies sourced from Santa Cruz Biotechnology (Santa Cruz, CA, USA), targeting the following proteins: HOXB4 (sc-271083), RAP1; (sc-53434), RAP1GAP (sc-166586), E-cadherin (sc-8426), N-cadherin (sc-59987), Vimentin (sc-373717), and GAPDH (sc-32233). Finally, protein bands were detected and visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA).
Statistical analysis
Statistical analyses and the production of graphs were performed with GraphPad Prism 9.1.0 (GraphPad Software, Inc., San Diego, CA, USA). All data are representative of three independent experiments and using Student t-test, or one-way analysis of variance with post hoc test. For all tests, data were considered significant at P<0.05.
Results
HOXB4 is a downregulated and hypermethylated gene in LUAD
Previously, we performed genome profiling using an 850K array and RNA sequencing in NSCLC tissue samples. Next, related heat and volcano maps were constructed (Figure 1A,1B). Hypermethylation of HOXB4 in NSCLC was also identified and verified.
To understand the function of HOXB4, we first examined this gene in the TIMER2 database to initially determine the presence of HOXB4 mRNA in human malignancies. We identified HOXB4 expression in 36 carcinomas, which showed a significant decrease in expression in LUAD, when compared with normal tissues (Figure 1C). Additionally, we found that HOXB4 expression was lower in LUAD tissues than in normal lung tissues found in the UALCAN database (Figure 1D). Moreover, the HOXB4 promoter CpG island was highly methylated, when compared with normal tissues (Figure 1E). Furthermore, analysis revealed a significant negative correlation between mRNA levels and methylation levels of HOXB4 (Pearson’s r: −0.505, P=8.7e−33; Figure 1F) in the MethMarkerDB database. We also determined the expression of HOXB4 mRNA using RT-PCR in 40 paired samples of human LUAD tissues and their surgical margins, which showed that HOXB4 expression was downregulated in primary LUAD tissues, when compared with their corresponding adjacent tissues (P=0.02; Figure 1G). Taken together, these results indicated that promoter cytosine-phosphate-guanine (CpG) island hypermethylation of HOXB4 was the underlying mechanism of its downregulation in LUADs, suggesting that HOXB4 could play a significant regulatory role in the development of LUAD.
HOXB4 methylation and its clinical relevance in LUADs
We then identified relationships between clinicopathological parameters and HOXB4 DNA methylation in LUAD patients using the online UALCAN database, which showed that the degree of HOXB4 methylation was positively correlated with tumor stage (Figure 2A). Moreover, the HOXB4 methylation level was significantly higher in Asians than in other races (Figure 2B). We also determined the distribution of differentially methylated regions around the HOXB4 gene in LUADs (Figure 2C), and further analyzed the association of HOXB4 DNA methylation with survival and prediction of tumors in LUAD patients using the MethMarkerDB database. The results confirmed that the high methylation levels of HOXB4 were associated with poor survival in LUADs (P=0.03; Figure 2D) and that its methylation level predicted the occurrence of LUADs [area under the curve (AUC): 0.974; 95% confidence interval: 0.94–1.00; Figure 2E].
Together, these results suggested that hypermethylation of HOXB4 was a risk factor for poor prognoses of LUAD patients, indicating that the presence of methylated HOXB4 could be used as a biomarker for LUAD prediction and prognosis.
HOXB4 overexpression inhibited LUAD cell proliferation, migration, and invasion
To test the possibility that HOXB4 may be a potential tumor suppressor gene in LUADs, we transfected a pcDNA3.1-Flag-HOXB4 expressing plasmid into the A549 LUAD cell line, resulting in high levels of expression. Restoration of HOXB4 expression after stable transfection was verified using RT-qPCR (Figure 3A). The tumor growth suppressive effects of HOXB4 protein on A549 (P<0.05) were confirmed using a CCK-8 assay (Figure 3B). As previously mentioned, metastasis is usually the main reason for unsatisfactory treatment outcomes and poor prognoses of LUAD patients. Thus, we evaluated the effect of HOXB4 protein on LUAD metastasis. Transwell assays were conducted to determine the effects of HOXB4 on cell migration and invasion, which showed that HOXB4 overexpression in A549 cells resulted in significant reductions in cell migration and invasion (Figure 3C,3D).
HOXB4 overexpression increased LUAD cell apoptosis and promoted cell cycle arrest
We then assessed whether HOXB4 affected cell apoptosis and cell cycle distribution of LUAD cells, using flow cytometry analysis. After transient transfection of a HOXB4 overexpression plasmid into A549 cells for 48 h, the cells were collected for detection of cell apoptosis and cell cycle distribution. The results showed that HOXB4 overexpression in A549 cells significantly increased cell apoptosis (Figure 4A,4B) and caused more cells to arrest in the G0/G1 phase (Figure 4C,4D). Taken together, the results showed that HOXB4 may be a tumor suppressor gene in LUAD, where it regulated proliferation, invasion, apoptosis, and the cell cycle.
Enrichment analysis of the HOXB4 gene in LUAD
To identify biological functions related to HOXB4, the genes most related to HOXB4 were screened using Pearson’s correlation analyses (|R| >0.5, P<0.05) in the TCGA and GEO databases, with the analyses based on the abovementioned gene sets. In the TCGA database, biological processes most related to HOXB4 included anterior/posterior pattern specification, embryonic skeletal system morphogenesis, and proximal/distal pattern formation (Figure 5A). Moreover, the cellular components most related to HOXB4 were chromatin (Figure 5B). The molecular functions involved RNA polymerase II transcription factor activity (Figure 5C). The HOXB4-related biological processes, cellular components, molecular functions in the GSE37745 database were similar to those in TCGA (Figure 5D-5F). Furthermore, analyses of both databases identified that the most related signaling pathway with HOXB4 is the Rap1 signaling pathway, including proteoglycans in cancer and axon guidance (Figure 5G,5H).
HOXB4 inhibited the EMT in LUAD cells by regulating the RAP1 signaling pathway
We selected A549 cells for the determination of downstream mechanisms, and found that the protein expression of the RAP1GAP and the E-cadherin epithelial marker was significantly elevated in the HOXB4 overexpression group, whereas protein expressions of the RAP1 and N-cadherin、vimentin mesenchymal markers were significantly reduced (Figure 6A,6B). In addition, RT-qPCR was performed to identify key genes of the RAP1 signaling pathway, which showed that overexpression of HOXB4 repressed the transcription of RAP1A/B and RAPGEF3/4 and increased RAP1GAP transcript levels in A549 cells (Figure 6C). Together, these findings suggested that HOXB4 regulated LUAD development by the EMT and through its involvement in the repression of the RAP1 signaling pathway (Figure 6D).
Discussion
HOXB4 plays an important role in cancer proliferation, metastasis and angiogenesis (9,10,12,13,21-28). Our results showed that HOXB4 expression was downregulated and hypermethylated in LUAD tissues, while HOXB4 DNA methylation was associated with the prognosis and early diagnosis of LUAD. Overexpression of HOXB4 inhibited cell proliferation, migration, and invasion, and facilitated apoptosis in LUAD cells in vitro, while increasing cell cycle arrest. KEGG pathway analysis suggested that HOXB4-related genes were mainly clustered in the RAP1 pathway in LUAD patients. Together, our results suggested that HOXB4 inhibited malignant progression of LUAD cells by regulating the RAP1 signaling pathway to suppress the EMT in LUAD cells.
We also found that expression of HOXB4 was significantly reduced in LUAD tissues and cells. By altering the expression of HOXB4 in A549 cells, we found that high expression of HOXB4 significantly inhibited migration and invasion, as well as suppressed cell proliferation, and blocked the cell cycle transition from the G0/G1 to the S phases. Previous studies have reported that HOXB4 is frequently downregulated in cervical cancer cells, thereby promoting cell proliferation and tumorigenesis (12). In addition, Zhou et al. also reported that HOXB4 expression was downregulated in breast cancer cells, where it inhibited breast cancer cell migration in a STARD13-dependent manner (13). It has also been suggested that HOXB4 has anti-tumor effects in cancer, which is consistent with our findings. We therefore hypothesize that down-regulation of HOXB4 expression may act as an oncogenic gene effect in LUAD. We also showed that the methylation of HOXB4 DNA was significantly elevated in LUAD and negatively correlated with its expression level. Furthermore, DNA methylation of HOXB4 was negatively correlated with the prognosis of LUAD, and predicted the occurrence of LUAD (17). In recent years, accumulating evidence has demonstrated that DNA methylation markers play critical roles in the early diagnosis, therapeutic management, and prognostic evaluation of LUAD. Recent study has revealed that plasma-based detection of SHOX2 and RASSF1A methylation exhibits robust diagnostic performance for early-stage LUAD, achieving 61.11% sensitivity and an AUC of 0.806, thereby serving as a viable alternative to invasive bronchoalveolar lavage fluid (BALF) analysis (29). For prognostic evaluation, genome-wide methylation profiling via enzymatic methyl sequencing (EM-seq) delineates distinct epigenetic signatures in early LUAD. Prognostically significant markers such as ANLN and S100A16, coupled with a six-gene methylation-expression risk stratification model (log-rank P<0.0001), effectively categorize patients into high- and low-risk subgroups, guiding adjuvant therapy decisions (30). In the realm of therapeutic monitoring, tumor methylated fraction (TMeF) dynamics in circulating tumor DNA (ctDNA) correlate with pathological stage, histologic aggressiveness, and lymphovascular invasion, reflecting tumor-derived DNA shedding (31). These findings indicate that methylation markers play an important role in the diagnosis, treatment, and prognosis of LUAD. Notably, it has reported that seven differentially methylated genes, including HOXB4 in plasma, could be used for noninvasive differentiation between lung and non-lung cancers (19). In addition, Li et al. (20) developed a DNA methylation test using BALF samples containing the HOXB4 gene, for the diagnosis of malignant lung nodules, which is consistent with our findings, and suggested that the methylation of HOXB4 could be used to predict the progression of LUAD.
The EMT is important during tumor metastasis, because epithelial cells lose adhesion and gain invasive and metastatic capabilities (32-36). Cancer cells undergoing the EMT exhibit morphological changes and molecular alterations such as decreased expressions of epithelial markers, including E-cadherin, ZO-1, and occludin, and increased expressions of mesenchymal markers, including N-cadherin, vimentin, fibroblast-specific protein 1, and fibronectin (37). Previous study has reported that overexpression of HOXB4 promotes EMT-related metastasis in ovarian cancer (9). In addition, HOXB4 is an EMT-related gene, whose methylation has predictive value in lung cancer, and can be used as a marker for treatment options (17). Our western blot results showed that HOXB4 protein overexpression up-regulated expression of the E-cadherin epithelial marker, and down-regulated expressions of the N-cadherin and vimentin mesenchymal markers, which inhibited LUAD cell migration and invasion.
Although the role of HOXB4 in LUAD progression has been investigated, the specific mechanism by which HOXB4 regulates LUAD remains unclear. Further KEGG enrichment analyses revealed that HOXB4-related genes were mainly clustered in the RAP1 signaling pathway, suggesting that the effect of HOXB4 on LUAD may be mediated by the RAP1 signaling pathway. RAP1, a member of the ras-like family of small guanosine triphosphate (GTP)-binding proteins, which has two isoforms, Rap1A and Rap1B, binds GTP or guanosine diphosphate (GDP) (38,39). RAP1 activity is positively regulated by guanine nucleotide exchange factors (GEFs) and negatively regulated by GTPase-activating proteins (GAPs) (40). Studies have reported that RAP1 expression is significantly upregulated in lung cancer, while downregulation of RAP1 expression reduces migration and invasion in NSCLC cell lines (41). In addition, overexpression of SOX9 in LUAD significantly activates the RAP1 signaling pathway and promotes cell invasion and migration (42). Zhang et al. reported that silencing of CD147 inhibits proliferation, migration, and invasion of LUAD cells by blocking the Rap1 signaling pathway (43). Most importantly, Morsi et al. find that HOXB4 is a transcription factor that directly binds to two conserved sites within the 3’UTR of the Rap1 gene, suppressing its expression by inhibiting transcription. Overall, HOXB4 may exert inhibitory effects in LUAD via the RAP1 signaling pathway, which plays an important role in LUAD development (44). In the present study, after overexpression of HOXB4 in LUAD cells, the expression levels of genes related to the RAP1 signaling pathway changed with changes in HOXB4 expression. Importantly, transcriptions of RAP1A(B) and RAPGEF3(4) were negatively correlated with HOXB4 expression, while the transcription of RAP1GAP also significantly increased with increasing HOXB4 expression, at the same time, western blot results showed that overexpression of HOXB4 protein upregulated RAP1GAP expression and downregulated RAP1 expression. It was therefore possible that increased expression of HOXB4 may have inhibited the EMT in LUAD cells, by suppressing the RAP1 pathway, thus acting as a tumor suppressor.
The present study only investigated invasion and migration in one type of cell. Therefore, a more rigorous approach using multiple mutant cell systems and in vivo experiments should be conducted in future studies. Furthermore, in studies of the molecular mechanism of the tumor suppressor function of HOXB4, more studies will be needed to find more direct evidence of HOXB4 involvement in the RAP1 signaling pathway.
Conclusions
In conclusion, the present study provided evidence that HOXB4 had a tumor suppressor role in LUAD, and that hypermethylation of HOXB4 can predict LUAD and be associated with a poorer prognosis, which regulated the EMT in LUAD through the RAP1 signaling pathway. Based on these findings, we suggest that HOXB4 may be a target for the diagnosis and treatment of LUAD.
Acknowledgments
The authors are most grateful to all participants in this study.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-226/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-226/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-226/prf
Funding: This work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-226/coif). All authors report the funding from Chongqing Nature Science Foundation (Nos. 2024NSCQ-MSX1843 and 2024NSCQ-MSX217). The authors have no other conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The ethical approval for this study was obtained from the Clinical Trials Ethics Committee of The First Affiliated Hospital of Chongqing Medical University (Chongqing, China) (No. 2024-167-01). Written informed consent was taken from all the participants.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229-63. [Crossref] [PubMed]
- Thai AA, Solomon BJ, Sequist LV, et al. Lung cancer. Lancet 2021;398:535-54. [Crossref] [PubMed]
- Bade BC, Dela Cruz CS. Lung Cancer 2020: Epidemiology, Etiology, and Prevention. Clin Chest Med 2020;41:1-24. [Crossref] [PubMed]
- Miller KD, Nogueira L, Devasia T, et al. Cancer treatment and survivorship statistics, 2022. CA Cancer J Clin 2022;72:409-36. [Crossref] [PubMed]
- Allemani C, Matsuda T, Di Carlo V, et al. Global surveillance of trends in cancer survival 2000-14 (CONCORD-3): analysis of individual records for 37 513 025 patients diagnosed with one of 18 cancers from 322 population-based registries in 71 countries. Lancet 2018;391:1023-75. [Crossref] [PubMed]
- Bhatlekar S, Fields JZ, Boman BM. Role of HOX Genes in Stem Cell Differentiation and Cancer. Stem Cells Int 2018;2018:3569493. [Crossref] [PubMed]
- Antonchuk J, Sauvageau G, Humphries RK. HOXB4-induced expansion of adult hematopoietic stem cells ex vivo. Cell 2002;109:39-45. [Crossref] [PubMed]
- Shah N, Sukumar S. The Hox genes and their roles in oncogenesis. Nat Rev Cancer 2010;10:361-71. [Crossref] [PubMed]
- Li N, Gou JH, Xiong J, et al. HOXB4 promotes the malignant progression of ovarian cancer via DHDDS. BMC Cancer 2020;20:222. [Crossref] [PubMed]
- Li Y, Sun J, Gao S, et al. HOXB4 knockdown enhances the cytotoxic effect of paclitaxel and cisplatin by downregulating ABC transporters in ovarian cancer cells. Gene 2018;663:9-16. [Crossref] [PubMed]
- Wang L, Jin H, Zeng Y, et al. HOXB4 Mis-Regulation Induced by Microcystin-LR and Correlated With Immune Infiltration Is Unfavorable to Colorectal Cancer Prognosis. Front Oncol 2022;12:803493. [Crossref] [PubMed]
- Lei D, Yang WT, Zheng PS. HOXB4 inhibits the proliferation and tumorigenesis of cervical cancer cells by downregulating the activity of Wnt/β-catenin signaling pathway. Cell Death Dis 2021;12:105. [Crossref] [PubMed]
- Zhou G, Liu X, Xiong B, et al. Homeobox B4 inhibits breast cancer cell migration by directly binding to StAR-related lipid transfer domain protein 13. Oncol Lett 2017;14:4625-32. [Crossref] [PubMed]
- Guo E, Li L, Yang J, et al. HOXB4/METTL7B cascade mediates malignant phenotypes of hepatocellular carcinoma through TKT m6A modification. Biol Direct 2025;20:26. [Crossref] [PubMed]
- Benezeder T, Tiran V, Treitler AAN, et al. Multigene methylation analysis of enriched circulating tumor cells associates with poor progression-free survival in metastatic breast cancer patients. Oncotarget 2017;8:92483-96. [Crossref] [PubMed]
- Rodríguez-Rodero S, Fernández AF, Fernández-Morera JL, et al. DNA methylation signatures identify biologically distinct thyroid cancer subtypes. J Clin Endocrinol Metab 2013;98:2811-21. [Crossref] [PubMed]
- Lin SH, Wang J, Saintigny P, et al. Genes suppressed by DNA methylation in non-small cell lung cancer reveal the epigenetics of epithelial-mesenchymal transition. BMC Genomics 2014;15:1079. [Crossref] [PubMed]
- Daugaard I, Dominguez D, Kjeldsen TE, et al. Identification and validation of candidate epigenetic biomarkers in lung adenocarcinoma. Sci Rep 2016;6:35807. [Crossref] [PubMed]
- Hu S, Tao J, Peng M, et al. Accurate detection of early-stage lung cancer using a panel of circulating cell-free DNA methylation biomarkers. Biomark Res 2023;11:45. [Crossref] [PubMed]
- Li L, Ye Z, Yang S, et al. Diagnosis of pulmonary nodules by DNA methylation analysis in bronchoalveolar lavage fluids. Clin Epigenetics 2021;13:185. [Crossref] [PubMed]
- Dumas PY, Mansier O, Prouzet-Mauleon V, et al. MiR-10a and HOXB4 are overexpressed in atypical myeloproliferative neoplasms. BMC Cancer 2018;18:1098. [Crossref] [PubMed]
- Bonfim-Silva R, Ferreira Melo FU, Thomé CH, et al. Functional analysis of HOXA10 and HOXB4 in human medulloblastoma cell lines. Int J Oncol 2017;51:1929-40. [Crossref] [PubMed]
- Wang H, Jia XH, Chen JR, et al. HOXB4 knockdown reverses multidrug resistance of human myelogenous leukemia K562/ADM cells by downregulating P-gp, MRP1 and BCRP expression via PI3K/Akt signaling pathway. Int J Oncol 2016;49:2529-37. [Crossref] [PubMed]
- Li L, Zhao CT, Cui BL, et al. Expression of HOXB4, PRDM16 and HOXA9 in Patients with Acute Myeloid Leukemia and Its Clinical Significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2016;24:326-31. [Crossref] [PubMed]
- Nanbakhsh A, Pochon C, Amsellem S, et al. Enhanced cytotoxic activity of ex vivo-differentiated human natural killer cells in the presence of HOXB4. J Immunother 2014;37:278-82. [Crossref] [PubMed]
- Qiao Y, Zhao CT, Liu ZZ, et al. Construction of lentivirus vector containing human homeobox gene HOXB4 and its expression in human umbilical cord mesenchymal stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2012;20:703-9.
- Park SW, Won KJ, Lee YS, et al. Increased HoxB4 Inhibits Apoptotic Cell Death in Pro-B Cells. Korean J Physiol Pharmacol 2012;16:265-71. [Crossref] [PubMed]
- Forrester LM, Jackson M. Mechanism of action of HOXB4 on the hematopoietic differentiation of embryonic stem cells. Stem Cells 2012;30:379-85. [Crossref] [PubMed]
- Jin Y, Lu R, Liu F, et al. DNA methylation analysis in plasma for early diagnosis in lung adenocarcinoma. Medicine (Baltimore) 2024;103:e38867. [Crossref] [PubMed]
- Gan J, Huang M, Wang W, et al. Novel genome-wide DNA methylation profiling reveals distinct epigenetic landscape, prognostic model and cellular composition of early-stage lung adenocarcinoma. J Transl Med 2024;22:428. [Crossref] [PubMed]
- Driussi A, Lamaze FC, Kordahi M, et al. Clinicopathological Predictors of the Presence of Blood Circulating Tumor DNA in Early-Stage Non-Small Cell Lung Cancers. Mod Pathol 2025;38:100744. [Crossref] [PubMed]
- Yang S, Liu Y, Li MY, et al. FOXP3 promotes tumor growth and metastasis by activating Wnt/β-catenin signaling pathway and EMT in non-small cell lung cancer. Mol Cancer 2017;16:124. [Crossref] [PubMed]
- Kim BN, Ahn DH, Kang N, et al. TGF-β induced EMT and stemness characteristics are associated with epigenetic regulation in lung cancer. Sci Rep 2020;10:10597. [Crossref] [PubMed]
- Yuan X, Wu H, Han N, et al. Notch signaling and EMT in non-small cell lung cancer: biological significance and therapeutic application. J Hematol Oncol 2014;7:87. [Crossref] [PubMed]
- Huang J, Zheng Y, Zheng X, et al. PRMT5 Promotes EMT Through Regulating Akt Activity in Human Lung Cancer. Cell Transplant 2021;30:9636897211001772. [Crossref] [PubMed]
- Ding NH, Zhang L, Xiao Z, et al. NEK4 kinase regulates EMT to promote lung cancer metastasis. J Cell Mol Med 2018;22:5877-87. [Crossref] [PubMed]
- Mittal V. Epithelial Mesenchymal Transition in Tumor Metastasis. Annu Rev Pathol 2018;13:395-412. [Crossref] [PubMed]
- Zhang YL, Wang RC, Cheng K, et al. Roles of Rap1 signaling in tumor cell migration and invasion. Cancer Biol Med 2017;14:90-9. [Crossref] [PubMed]
- Nussinov R, Jang H, Zhang M, et al. The Mystery of Rap1 Suppression of Oncogenic Ras. Trends Cancer 2020;6:369-79. [Crossref] [PubMed]
- Looi CK, Hii LW, Ngai SC, et al. The Role of Ras-Associated Protein 1 (Rap1) in Cancer: Bad Actor or Good Player? Biomedicines 2020;8:334. [Crossref] [PubMed]
- Lu J, Zhou L, Wu B, et al. MiR-501-3p functions as a tumor suppressor in non-small cell lung cancer by downregulating RAP1A. Exp Cell Res 2020;387:111752. [Crossref] [PubMed]
- Yang JF, Liao Q, Lu CL. SOX9 promotes the invasion and migration of lung adenocarcinoma cells by activating the RAP1 signaling pathway. BMC Pulm Med 2023;23:421. [Crossref] [PubMed]
- Zhang N, Liu Z, Lai X, et al. Silencing of CD147 inhibits cell proliferation, migration, invasion, lipid metabolism dysregulation and promotes apoptosis in lung adenocarcinoma via blocking the Rap1 signaling pathway. Respir Res 2023;24:253. [Crossref] [PubMed]
- Morsi El-Kadi AS. The small GTPase Rap1 is an immediate downstream target for Hoxb4 transcriptional regulation. Mech Dev 2002;113:131-9. [Crossref] [PubMed]

