ING5-mediated regulation of lung cancer progression via the OIP5-AS1/miR-381-3p/SEC24A axis
Highlight box
Key findings
• This study uncovers a novel long non-coding RNA (lncRNA)-mediated competing endogenous RNA (ceRNA) axis—OIP5-AS1/miR-381-3p/SEC24A—that functionally links epigenetic regulation (via ING5) to non-small cell lung cancer (NSCLC) tumor progression. ING5 over-expression down-regulates OIP5-AS1, elevates miR-381-3p, suppresses SEC24A, and reverses epithelial-mesenchymal transition. These tumor-suppressive effects are fully rescued by forced OIP5-AS1 expression, positioning ING5 as an upstream governor of the ceRNA circuit.
What is known and what is new?
• miR-381-3p is repeatedly down-regulated in multiple cancers and can function as a tumor suppressor. ING5, a member of the ING tumor-suppressor family, restrains NSCLC aggressiveness.
• ING5 transcriptionally represses OIP5-AS1. Combined mutation of both miR-381-3p seed sites in SEC24A 3'UTR almost completely abolishes responsiveness, providing the first quantitative evidence that SEC24A is a direct, dual-site target.
What is the implication, and what should change now?
• OIP5-AS1 and SEC24A from correlative markers to actionable members of a druggable ceRNA network in NSCLC.
• Clinical sequencing panels should simultaneously profile lncRNA, miRNA and mRNA to flag patients with an activated OIP5-AS1/miR-381-3p/SEC24A axis.
Introduction
ING5 encodes a protein featuring a plant homeodomain (PHD)-type zinc finger motif. ING5 facilitates the acetylation of histones H3 and H4 via HBO1 or MOZ/MORF complexes, respectively, and is involved in chromatin remodeling, hence influencing transcriptional control (1). ING5 interacts with p53 and enhances its transcriptional activity (2). ING5 impedes the proliferation, migration, invasion, and tumor formation of certain cancer cells by obstructing the EGFR/PI3K/Akt, IL-6/STAT3, Akt/NF-κB/MMP-9, or IL-6/CXCL12 pathways (3). ING5 can reverse the Warburg effect and decrease the growth of A549 via boosting the phosphorylation of PDHK1 (Y163) (4).
Competing endogenous RNAs (ceRNAs) represent a novel mode of inter-RNA interaction that influences miRNA-mediated gene silencing by binding to miRNAs, hence regulating the expression of target genes (5). This method is crucial in regulating gene expression, particularly in pathological conditions like the genesis and progression of lung cancer.
Long non-coding RNAs (lncRNAs) typically impede miRNA function by “sponging” them. lncRNA OIP5-AS1 is significantly implicated in lung cancer, with its upregulation strongly associated with the disease’s progression. OIP5-AS1 enhances the proliferation of lung cancer by interacting with many miRNAs, including the adsorption of hsa-miR-29b-3p and hsa-miR-34a, which elevates the expression of ZIC5 and PD-L1 (6,7). OIP5-AS1 promotes the invasiveness of lung cancer cells by sequestering for miR-200c-3p and affecting migratory capacity (8). Furthermore, elevated expression of OIP5-AS1 the migratory and invasive capabilities of lung cancer cells. The reduction of OIP5-AS1 inhibits cell proliferation by upregulating the cyclin-dependent kinase inhibitory factor, resulting in a G1 phase blockade in non-small cell lung cancer (NSCLC) (9). OIP5-AS1 is implicated in the control of epithelial-mesenchymal transition (EMT), angiogenesis, and cancer stemness in lung cancer, processes that are intricately linked to tumor invasion and metastasis (10,11).
This study investigated the interaction and functional relationship between lncOIP5-AS1, miR-381-3p, and SEC24A, elucidating the mechanism by which ING5 contributes to anti-oncogenesis in NSCLC via the OIP5-AS1/miR-381-3p/SEC24A axis, thereby offering a potential therapeutic target for lung cancer intervention. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1284/rc).
Methods
Cellular line construction and transfection
Cell lines of NSCLC were acquired from Wuhan Punosai Life Science & Technology Co., Ltd. (Wuhan, China). Cells overexpressing ING5 were generated by a previously documented technique (4). Lentiviruses were generated via a three-plasmid system comprising psPAX2, PMD2g, and PLVX vectors. Lnc OIP5-AS1 knockdown plasmids (shOIP5-AS1-1: GCTGTGATGCTGGGAACTTAG, shOIP5-AS1-2: GCAGGACTATACGTCGATTTG, shOIP5-AS1-3: GCAGAAGGCTGAGTTTCATTT) were transfected in A549 cells. The transfection reagent employed was Lee Kee Bio (EZ, Shanghai, China). Plasmids were transfected, and viral supernatants were collected. Stable transfection of the cell line was accomplished via polybrene. Following a 24-hour viral transfection of the cells, the growth media were substituted with one containing puromycin, therefore establishing a stably transfected cell line for later investigations.
Cells were transfected with the miR-381-3p inhibitor and negative control when the cell density attained 70–80%. A volume of 2.5 µL of 20 µM inhibitor was diluted in serum-free Opti-MEM medium, and 5 µL of Lipo3000 (Invitrogen, L3000015, Carlsbad, CA, USA) was also diluted in serum-free Opti-MEM medium. The Invitrogen L3000015 solution was incubated for 20 minutes and then added to 500 µL of cell-containing medium, and incubated for 6 hours, following which the medium was replenished.
Functional annotation and target gene prediction
Functional annotation of Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) for miR-381-3p was performed with the R package clusterProfiler. The functional annotation of GO encompasses molecular function (MF), biological process (BP), and cellular component (CC). Target genes of miR-381-3p were identified utilizing four databases: TargetScan, miRDB, miRTarBase, and miRWalk.
Protein and RNA expression levels were assessed utilizing the UALCAN database (https://ualcan.path.uab.edu/index.html) (12). Survival analysis and gene prognosis were conducted utilizing the Kaplan-Meier plotter database (https://kmplot.com/analysis/) (13). The correlation of gene expression was examined utilizing the GEPIA2 database (http://gepia2.cancer-pku.cn/#index). Protein expression levels in tissues were evaluated utilizing the Human Protein Atlas database (https://www.proteinatlas.org/). By applying the LncACTdb 3.0 database to determine the connections between miRNAs and lncRNAs (14).
Quantitative real-time polymerase chain reaction (qPCR)
Cell samples were lysed utilizing the M5Universal Plus RNA Kit. The samples underwent centrifugation at 13,000 revolutions per minute. Thereafter, the lysis buffer was introduced, and the mixture was promptly centrifuged. An equivalent volume of 70% ethanol was introduced, and the resultant mixture was subjected to transfer into an adsorbent column (RA) and centrifuged. The waste solution was disposed of. The column was washed with RW1 and RW solutions. RA was detached and centrifuged. RNA underwent reverse transcription to cDNA with the Evo M-MLV Reverse Transcription Kit (AG11705), and amplification was performed according to the protocol supplied by NovoStart® SYBR qPCR SuperMix Plus (Cat. No. E096). Primer sequences are shown in Table 1.
Table 1
| Gene | Primer | Sequence (5'-3') |
|---|---|---|
| Human-SEC24A | Forward | AGCCCTGAAACCACGAGAGGAA |
| Reverse | TGCTGACCAGAACAGTCCAAGG | |
| OIP5-AS1 | Forward | TGTATTAGCCCTGCTCGTT |
| Reverse | TGCAAATCCTGGTCCATC | |
| hsa-miR-381-3p | Forward | AAAGCGAGGTTGCCCTTTGT |
| Reverse | TACTCACAGAGAGCTTGCCC | |
| GAPDH | Forward | ATCAGCAATGCCTCCTGCAC |
| Reverse | CGTCAAAGGTGGAGGAGTGG |
Luciferase Reporter Assay
To examine the interaction between hsa-miR-381-3p and the 3'UTR of SEC24A, a Luciferase Reporter Assay was performed. Both wild-type and mutant versions of the SEC24A 3'UTR were inserted into the psiCHECK-2 vector (Promega, Madison, WI, USA). HEK-293T cells were then transfected with these constructs in combination with hsa-miR-381-3p mimics or inhibitors, using Lipofectamine 2000 as the transfection agent. Forty-eight hours post-transfection, the cells were lysed, and luciferase activity was assessed using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). Measurements of both firefly and renilla luciferase activities were taken, and the ratio of renilla to firefly luciferase was computed to evaluate the impact of hsa-miR-381-3p on SEC24A.
Western blotting
A suitable quantity of cells was digested. Post-lysis, protein quantification was conducted utilizing the BCA technique. Subsequent to SDS-PAGE electrophoresis, the gel was transferred to a PVDF membrane and incubated with 5% milk for 2 hours to block. The primary antibody was incubated overnight, then the secondary antibody was incubated for 1 hour the subsequent day. Luminescence was quantified utilizing the ECL luminescent solution, and imaging was performed with the Bio-Rad ChemiDoc Touch. The study utilized primary antibodies, namely SEC24A (1:1,000, ab262869, Abcam, Cambridge, UK), N-cadherin (1:1,000, ab76011, Abcam), E-cadherin (1:1,000, ab40772, Abcam), vimentin (1:1,000, ab92547, Abcam), and GAPDH (1:5,000, ab9485, Abcam). A secondary antibody tagged with horseradish peroxidase (HRP) was utilized.
Animal experimentation
Four-week-old nude mice were randomly divided into two groups. Tumor cells were enumerated manually, and a 1:1 solution of PBS and matrix was formulated for injection. Each animal was subcutaneously administered 0.1 mL of the combination, ensuring that the tumor cell count was roughly 1×106. The nude mice were placed in a mouse cage for 4 weeks of upbringing. Subsequent to this duration, the mice were euthanized, and the tumors along with samples were procured for subsequent examination.
Colony formation
Cells were injected into 6-well plates at a density of 1,000 cells per well. The cells were incubated in a cell culture environment for approximately 14 days. Subsequent to this duration, the media was eliminated, the cells were rinsed with PBS, and fixed with paraformaldehyde for 20 minutes. Thereafter, the paraformaldehyde was eliminated, and the cells were stained with crystal violet for 15 minutes. The cells were rinsed, and pictures were obtained.
Cell Counting Kit-8 (CCK-8) assay
A volume of 100 µL of cells were dispensed into each well of a 96-well plate and incubated at 37 ℃ in a 5% CO2 cell culture incubator for 24 hours. Subsequent to incubation, 10 µL of CCK-8 solution was introduced to each well, and the cells were further incubated at 37 ℃. The absorbance at 450 nm was measured.
Invasion and migration assay
Diluted Matrigel (Corning, Corning, NY, USA) was introduced into the chamber of the transwell and incubated for three hours. Prior to preparing the cell suspension, the cells underwent serum starvation for 12 hours. The lower chamber of the 24-well plate was filled with 500 µL of medium containing 10% FBS. The transwell was positioned in the 24-well plate, and 200 µL of cell suspension was introduced into each well in the upper chamber. Following 48 hours of incubation in the incubator, fixing and staining were executed. The chambers were fixed with 600 µL of paraformaldehyde for 30 minutes, followed by staining the cells with crystal violet for 10 minutes and capturing photographs.
Wound healing experiment
Cells were digested and seeded in 6-well plates at 70% confluence. Upon achieving 90% confluence, the lid of the 6-well plate was removed in a sterile environment, and incisions were made at the designated locations on the dish. The site of the scratch image acquisition was established utilizing a low magnification objective (10×). Images were obtained at 0 and 48 hours.
Statistical analysis
GraphPad Prism software (version 8.0) was used for analysis. The experiment in the study was repeated three times. Student’s t-test was employed to assess the statistical significance. A P value below 0.05 was deemed statistically significant. A protocol was prepared before the study with registration in Xi’an International Medical Center Hospital.
Ethical statement
The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. All animal experiments were performed under a project license (No. GJYX-KTSB-2023-021) granted by Animal Ethics Committee at Xi’an International Medical Center Hospital, in compliance with institutional guidelines for the care and use of animals.
Results
GO and KEGG pathway enrichment analyses of miR-381-3p
Enhanced expression of miR-381-3p has been documented in the ING5 overexpressing A549. A GO analysis of miR-381-3p was conducted, with annotations provided for its MF, BP, and CC individually (Figure 1A-1C). miR-381-3p was shown to be extensively implicated in RNA binding and gene expression (Figure 1D). In the KEGG pathway enrichment analysis, we identified that miR-381-3p is linked to many RNA regulatory mechanisms, including transcriptional misregulation in cancer. We hypothesized that it may influence mRNA transcription and contribute to tumorigenesis. Subsequently, four databases were employed to identify the target genes of miR-381-3p, yielding 43 target genes common across all databases (Figure 1D).
SEC24A overexpression and poor prognosis in lung adenocarcinoma
Using lung-adenocarcinoma data from The Cancer Genome Atlas (TCGA), we first filtered out samples lacking key clinical annotations. On the remaining cohort, miR-381-3p abundance was significantly higher in normal lung tissue than in tumor tissue (P<0.05; Figure 2A). Consistently, survival analysis performed on the same dataset showed that high miR-381-3p expression was associated with better overall survival (P<0.05; Figure 2B). We evaluated the 43 candidate genes utilizing the UALCAN and Kaplan-Meier plotter databases, revealing that the expression of SEC24A in lung adenocarcinoma surpassed that in normal lung tissues, and the protein expression level of SEC24A in lung adenocarcinomas was likewise elevated (P<0.001, Figure 2C,2D). Elevated expression of SEC24A (212902_at) was correlated with unfavorable prognosis in lung cancer patients during survival analysis [hazard ratio (HR) =1.22, logrank P=0.02, 95% confidence interval (CI): 1.02–1.45, Figure 2E]. Furthermore, we identified a negative connection between the expression of ING5 and SEC24A in lung adenocarcinoma patients (TCGA) using the GEPIA 2 database (R=−0.19, P<0.001, Figure 2F). Additional validation in The Human Protein Atlas database revealed that the expression of SEC24A was markedly elevated in lung adenocarcinoma patients (Figure 2G,2H).
Development of the lncRNA OIP5-AS1/miR-381-3p/SEC24A model
Based on literature showing 833 significantly expressed genes in the ING5 high-expression cohort, miR-381-3p-bound lncRNAs were identified using the LncACTdb 3.0 database. Subsequently, differentially expressed lncRNAs were analyzed in the transcriptome database, employing P<0.05 and |log2(fold change)| ≥2 as the selection criteria. Under the screening criteria, the lncRNA OIP5-AS1 was identified, leading to the construction of a ceRNA model, specifically lncRNA OIP5-AS1/miR-381-3p/SEC24A. The RNA levels of OIP5-AS1 were diminished in the ING5 overexpressing A549 cell line (P=0.003, Figure 3A), whereas miR-381-3p were markedly elevated in the ING5 overexpression in Figure 3B (P<0.001). Additionally, the RNA level of SEC24A was significantly elevated in the control group (P=0.01, Figure 3C). The protein level of SEC24A was markedly reduced in the ING5 overexpression (Figure 3D). We subsequently silenced OIP5-AS1 and determined that the knockdown efficiency was optimal for targets #1 and #2, which were utilized in subsequent experiments (Figure 3E). In the A549 cell line with OIP5-AS1 knockdown, miR-381-3p was markedly elevated (Figure 3F), while the RNA level of SEC24A was dramatically reduced (Figure 3G). Simultaneously, we observed that the protein level of SEC24A was markedly down-regulated in the A549 cell line with OIP5-AS1 knockdown (Figure 3H). In subcutaneous tumor tests using nude mice, we observed that the tumor tissue in the OIP5-AS1 knockdown group was much less than that in the control (Figure 3I).
miR-381-3p interacts with SEC24A
The Targetscan database shows miR-381-3p has two SEC24A binding sites (Figure 4A). In the SEC24A 3'UTR plasmid transfection, the miR-381-3p group significantly differed from blank (P<0.001) and NC (P=0.002) groups, indicating binding to SEC24A’s 3'UTR and impact on fluorescence. The miR-381-3p inhibitor group also significantly differed from blank (P=0.003) and NC inhibitor (P=0.007) groups, suggesting endogenous miR-381-3p in HEK-293T cells inhibits SEC24A activity, with increased activity upon inhibitor addition (Figure 4B). For the mutSEC24A-1 3'UTR transfection, the miR-381-3p group significantly differed from NC (P=0.002), showing influence on mutSEC24A-1’s 3'UTR fluorescence (Figure 4C). In the mutSEC24A-2 3'UTR transfection, a significant difference between miR-381-3p and NC groups (P=0.002) indicated impact on mutSEC24A-2’s 3'UTR fluorescence (Figure 4D). However, in the mutSEC24A-3 transfection, no significant difference was found between miR-381-3p and blank (P=0.14) or NC (P=0.60) groups, suggesting no influence on mutSEC24A-3’s modified fluorescence (Figure 4E). Co-transfection of SEC24A with miR-381-3p resulted in 37% luciferase activity; mutSEC24A had 73% at the initial binding site and 56% at the secondary site. Simultaneous mutation of both binding sites (mutSEC24A-3) restored luciferase activity to 98%, confirming that miR-381-3p primarily targets SEC24A through these two sites, with the first site having greater inhibitory capacity than the second.
OIP5-AS1 sequesters miR-381-3p to upregulate SEC24A
We introduced the miR-381-3p inhibitor into two target locations inside the OIP5-AS1 knockdown to ascertain the role of miR-381-3p. The cloning experiment revealed reduction in the number of clones in the OIP5-AS1 knockdown (Figure 5A). Following the transfection of the miR-381-3p inhibitor, the proliferation of the inhibited tumor cells was markedly elevated (Figure 5B, P=0.003, P=0.005). In the CCK-8 assay, the proliferative capacity of the sh-OIP5-AS1-1 + miR-381-3p inhibitor group was markedly superior to that of the sh-OIP5-AS1-1 group (Figure 5C). Identical results were achieved at the alternative target site. Subsequently, we evaluated the migratory capacity of the aforementioned cells and observed that the migration ability of sh-OIP5-AS1-1 was markedly inferior to that of sh-OIP5-AS1-1 combined with the miR-381-3p inhibitor (Figure 5D,5E, P<0.001), and the migration ability of sh-OIP5-AS1-2 was significantly lower than that of sh-OIP5-AS1-2 combined with the miR-381-3p inhibitor (Figure 5D,5E, P<0.001). We additionally assessed the invasion capability of various cell lines and observed results consistent with those of the migratory ability (Figure 5D,5F). In the wound healing experiment, we observed that the healing capacity of sh-OIP5-AS1-1 was markedly superior to that of sh-OIP5-AS1-1 combined with the miR-381-3p inhibitor, and the cells in the sh-OIP5-AS1-2 group exhibited analogous results (Figure 5G), indicating that the miR-381-3p inhibitor significantly enhances cell motility. The knockdown of OIP5-AS1 diminished the protein expression level of SEC24A, whereas the transfection of the miR-381-3p inhibitor elevated the expression level of SEC24A. In the identification of EMT-associated proteins, the silencing of OIP5-AS1 elevated E-cadherin levels while diminishing N-cadherin and vimentin expression. Conversely, the transfection of the miR-381-3p inhibitor produced an opposite effect (Figure 5H).
ING5 regulates NSCLC progression through OIP5-AS1
Our findings indicate that elevated levels of ING5 suppressed tumor cell proliferation in cloning experiments (Figure 6A,6B, P<0.001), and that the proliferative capacity of cells was reinstated following the overexpression of OIP5-AS1 in ING5-overexpressing A549 cells (Figure 6A,6B, P=0.004). The overexpression of OIP5-AS1 counteracted the inhibitory effect of ING5 on tumor cell proliferation in CCK-8 assay (Figure 6C). Migration experiments revealed that ING5 overexpression impedes the migratory capacity of tumor cells, whereas OIP5-AS1 overexpression counteracts this inhibition (Figure 6D,6E, P=0.001 and P=0.006). We achieved comparable results in the cell invasion assay (Figure 6D,6F). In a later wound healing study, elevated expression of ING5 impeded the motile energetic ability of the cells, while overexpression of OIP5-AS1 yielded the contrary effect (Figure 6G). In the Western blot experiment, we observed diminished SEC24A expression in the ING5 overexpression group, whereas N-cadherin and vimentin levels were reduced and E-cadherin expression was heightened. The outcomes were inverted in the OIP5-AS1 overexpression cohort (Figure 6H).
Discussion
Lung cancer, a predominant cause of cancer-related fatalities globally, is marked by high incidence and fatality rates (15). Lung cancer is the most prevalent malignancy in China for both genders, with 1.06 million new cases and 0.73 million fatalities recorded in 2022, representing 22.0% of all cancer-related morbidity and 28.5% of mortality (16). Early-stage lung cancer is often asymptomatic, resulting in most patients being discovered at advanced stages.
This study clarifies a new regulatory mechanism wherein ING5 inhibits NSCLC advancement via the lncRNA OIP5-AS1/miR-381-3p/SEC24A axis, enhancing our comprehension of ceRNA networks in lung cancer. Our results identify ING5 as a tumor suppressor that regulates a ceRNA-mediated feedback loop to reduce oncogenic SEC24A, offering mechanistic insights into epigenetic and post-transcriptional interactions in NSCLC. Together with the TCGA findings, our in vitro and mouse data suggest that restoring miR-381-3p or silencing OIP5-AS1 might suppress NSCLC progression. Nevertheless, the retrospective nature of TCGA data limits definitive clinical conclusions; prospective tissue collection and interventional studies are required to validate this axis as a therapeutic target. This study highlights the therapeutic potential of targeting ceRNA components in lung cancer, a condition in which dysregulated RNA interactions are becoming acknowledged as significant drivers of malignancy.
ceRNA networks, initially introduced by Salmena et al., are a crucial regulatory framework in cancer biology, wherein RNAs vie for common miRNA binding sites to indirectly influence gene expression (17). In lung cancer, lncRNAs such as OIP5-AS1, MALAT1 (metastasis associated lung adenocarcinoma transcript 1), and HOTAIR (HOX transcript antisense RNA) function as critical ceRNAs that sequester tumor-suppressive miRNAs, consequently facilitating oncogene activation and metastasis (18-20). MALAT1 promotes NSCLC invasion by sequestering miR-125 family members, resulting in the overexpression of Rab25 (Ras-related protein Rab-25) and the induction of EMT (19). Likewise, HOTAIR promotes the advancement of lung adenocarcinoma by sequestering miR-613, hence augmenting NOTCH3 signaling (20). Yu et al. experimentally validated the OIP5-AS1/miR-381-3p interaction using luciferase assays (21). Our research incorporates OIP5-AS1 into the expanding catalog of oncogenic lncRNAs, illustrating its function in counteracting ING5-induced miR-381-3p overexpression to maintain SEC24A expression. These findings correspond with the overarching notion that lncRNA-miRNA-mRNA axes are pivotal to lung cancer development, presenting innovative targets for RNA-based treatments.
ING5, a chromatin remodeler with tumor-suppressive properties, impedes NSCLC advancement by two mechanisms: (I) epigenetic alteration of histone acetylation and p53 activation, and (II) post-transcriptional regulation via the OIP5-AS1/miR-381-3p/SEC24A pathway. The aforementioned method demonstrates a feedback loop in which ING5 inhibits OIP5-AS1, hence releasing miR-381-3p to reduce SEC24A, an essential component of COPII vesicles involved in protein trafficking (22). SEC24A’s oncogenic action in NSCLC parallels its involvement in gastric cancer (23). Our observation that SEC24A knockdown reverses EMT markers substantiates its role in metastatic pathways, presumably through the deregulation of the secretory pathway.
The unfavorable connection between ING5 and SEC24A in NSCLC tissues underscores their potential as prognostic biomarkers. Patients exhibiting low ING5 and high SEC24A expression demonstrated poor survival, aligning with SEC24A’s involvement in other malignancies (23). Focusing on this axis, such as employing antisense oligonucleotides against OIP5-AS1 or utilizing miR-381-3p mimics, may reinstate tumor suppression. The effectiveness of OIP5-AS1 knockdown in inhibiting xenograft tumor growth corresponds with preclinical achievements in targeting oncogenic lncRNAs such as PVT1 and NEAT1 in lung cancer models (24,25).
The therapeutic targeting of ceRNA components is increasingly prominent in lung cancer studies. The lncRNA SNHG1 enhances cisplatin resistance by sequestering miR-330-5p, thereby upregulating MAPK9, and its suppression renders tumors more susceptible to chemotherapy (26). XIST similarly promotes NSCLC proliferation through the miR-449a/EZH2 axis, and the silencing of XIST inhibits tumor development in vivo (27). This study elucidates that the tumor-suppressive effects of ING5 are facilitated by the disruption of ceRNA, indicating that augmenting ING5 activity or inhibiting OIP5-AS1 may enhance the anti-tumor effects of miR-381-3p.
While our data outline a strong ceRNA network in NSCLC, numerous unanswered concerns remain. The regulatory relationship between ING5 and OIP5-AS1 necessitates more examination: does ING5 directly inhibit OIP5-AS1 transcription, or does it operate through intermediary factors? The downstream effectors of SEC24A in NSCLC, especially regarding vesicle-mediated EMT and metastasis, require study. Third, our in vivo model utilized subcutaneous tumors; orthotopic lung cancer models may more accurately replicate tumor-microenvironment interactions.
Conclusions
This study concludes that ING5 functions as a major regulator of a ceRNA network that inhibits NSCLC advancement through the OIP5-AS1/miR-381-3p/SEC24A pathway. Our research connects chromatin remodeling to RNA interactions, underscoring the intricacy of lung cancer development and the potential for therapeutic intervention through ceRNA manipulation. Future endeavors should focus on converting these discoveries into clinical methodologies, such the development of OIP5-AS1-targeted nanotherapeutics or the optimization of miR-381-3p delivery methods.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1284/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1284/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1284/prf
Funding: This work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1284/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. All animal experiments were performed under a project license (No. GJYX-KTSB-2023-021) granted by Animal Ethics Committee at Xi’an International Medical Center Hospital, in compliance with institutional guidelines for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Champagne KS, Kutateladze TG. Structural insight into histone recognition by the ING PHD fingers. Curr Drug Targets 2009;10:432-41. [Crossref] [PubMed]
- Zhang T, Meng J, Liu X, et al. ING5 differentially regulates protein lysine acetylation and promotes p300 autoacetylation. Oncotarget 2018;9:1617-29. [Crossref] [PubMed]
- Zheng HC, Xue H, Jiang HM. The roles of ING5 in cancer: A tumor suppressor. Front Cell Dev Biol 2022;10:1012179. [Crossref] [PubMed]
- Zhang H, Liu X, Li J, et al. ING5 inhibits aerobic glycolysis of lung cancer cells by promoting TIE1-mediated phosphorylation of pyruvate dehydrogenase kinase 1 at Y163. Front Med 2024;18:878-95. [Crossref] [PubMed]
- Gao Y, Takenaka K, Xu SM, et al. Recent advances in investigation of circRNA/lncRNA-miRNA-mRNA networks through RNA sequencing data analysis. Brief Funct Genomics 2025;24:elaf005. [Crossref] [PubMed]
- Liang L, Luo Y, Li D, et al. LncRNA OIP5-AS1 Modulates the Biological Behaviour of Lung Cancer Cells by Regulating the hsa-miR-29b-3p/ZIC5 Axis. J Cell Mol Med 2025;29:e70596. [Crossref] [PubMed]
- Qiao X, Zhao F. Long non-coding RNA Opa interacting protein 5-antisense RNA 1 binds to micorRNA-34a to upregulate oncogenic PD-L1 in non-small cell lung cancer. Bioengineered 2022;13:9264-73. [Crossref] [PubMed]
- Ji X, Zhu R, Gao C, et al. Hypoxia-Derived Exosomes Promote Lung Adenocarcinoma by Regulating HS3ST1-GPC4-Mediated Glycolysis. Cancers (Basel) 2024;16:695. [Crossref] [PubMed]
- Liu Y, Wang Y, Cui L, et al. LncRNA OIP5-AS1 suppresses lung adenocarcinoma progression and modulates macrophage polarization through the miR-429/DOCK4 regulatory axis. Front Pharmacol 2025;16:1569644. [Crossref] [PubMed]
- Li L, Ma Y, Maerkeya K, et al. LncRNA OIP5-AS1 Regulates the Warburg Effect Through miR-124-5p/IDH2/HIF-1α Pathway in Cervical Cancer. Front Cell Dev Biol 2021;9:655018. [Crossref] [PubMed]
- Mao C, Li X. Long noncoding RNA OIP5-AS1 promotes the stemness of lung cancer cells through enhancing Oct4 mRNA stability. Environ Toxicol 2022;37:1104-12. [Crossref] [PubMed]
- Chandrashekar DS, Karthikeyan SK, Korla PK, et al. UALCAN: An update to the integrated cancer data analysis platform. Neoplasia 2022;25:18-27. [Crossref] [PubMed]
- Győrffy B. Transcriptome-level discovery of survival-associated biomarkers and therapy targets in non-small-cell lung cancer. Br J Pharmacol 2024;181:362-74. [Crossref] [PubMed]
- Wang P, Guo Q, Qi Y, et al. LncACTdb 3.0: an updated database of experimentally supported ceRNA interactions and personalized networks contributing to precision medicine. Nucleic Acids Res 2022;50:D183-9. [Crossref] [PubMed]
- Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229-63. [Crossref] [PubMed]
- Han B, Zheng R, Zeng H, et al. Cancer incidence and mortality in China, 2022. J Natl Cancer Cent 2024;4:47-53. [Crossref] [PubMed]
- Salmena L, Poliseno L, Tay Y, et al. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 2011;146:353-8. [Crossref] [PubMed]
- Tay Y, Rinn J, Pandolfi PP. The multilayered complexity of ceRNA crosstalk and competition. Nature 2014;505:344-52. [Crossref] [PubMed]
- Luo J, Ren Q, Liu X, et al. LncRNA MALAT-1 modulates EGFR-TKI resistance in lung adenocarcinoma cells by downregulating miR-125. Discov Oncol 2024;15:379. [Crossref] [PubMed]
- Liu XH, Sun M, Nie FQ, et al. Lnc RNA HOTAIR functions as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in gastric cancer. Mol Cancer 2014;13:92. [Crossref] [PubMed]
- Yu Q, Li Y, Peng S, et al. Exosomal-mediated transfer of OIP5-AS1 enhanced cell chemoresistance to trastuzumab in breast cancer via up-regulating HMGB3 by sponging miR-381-3p. Open Med (Wars) 2021;16:512-25. [Crossref] [PubMed]
- Sharpe LJ, Luu W, Brown AJ. Akt phosphorylates Sec24: new clues into the regulation of ER-to-Golgi trafficking. Traffic 2011;12:19-27. [Crossref] [PubMed]
- Lu M, Wang W, Zhang S, et al. SEC24A stimulates oncogenicity of human gastric cancer cells. Int J Clin Exp Pathol 2018;11:4044-51.
- Wang X, Cheng Z, Dai L, et al. LncRNA PVT1 Facilitates Proliferation, Migration and Invasion of NSCLC Cells via miR-551b/FGFR1 Axis. Onco Targets Ther 2021;14:3555-65. [Crossref] [PubMed]
- Qi L, Liu F, Zhang F, et al. lncRNA NEAT1 competes against let-7a to contribute to non-small cell lung cancer proliferation and metastasis. Biomed Pharmacother 2018;103:1507-15. [Crossref] [PubMed]
- Ge P, Cao L, Zheng M, et al. LncRNA SNHG1 contributes to the cisplatin resistance and progression of NSCLC via miR-330-5p/DCLK1 axis. Exp Mol Pathol 2021;120:104633. [Crossref] [PubMed]
- Zhang YL, Li XB, Hou YX, et al. The lncRNA XIST exhibits oncogenic properties via regulation of miR-449a and Bcl-2 in human non-small cell lung cancer. Acta Pharmacol Sin 2017;38:371-81. [Crossref] [PubMed]

