Metaxins regulate cancer stem cell-like properties in H1299 cells
Highlight box
Key findings
• MTX1 and MTX2 promote lung cancer cell proliferation, epithelial-mesenchymal transition (EMT), and stemness through ALDH1 activation.
• Methylation levels of the MTX1 promoter in normal fibroblasts compared with those in lung cancer H1299 cells, suggesting that MTX1 expression is transcriptionally regulated. Their interdependent regulation indicates a cooperative mechanism driving cancer aggressiveness.
What is known and what is new?
• Metaxins are mitochondrial outer membrane proteins essential for protein trafficking and cellular homeostasis.
• Metaxins modulate ALDH1 to regulate EMT and cancer stem cell (CSC)-like properties in lung cancer.
What is the implication, and what should change now?
• Targeting MTX1 and MTX2 may provide new therapeutic strategies for lung cancer by disrupting EMT and CSC-associated resistance.
Introduction
Background
Lung cancer is the leading cause of cancer-related mortality worldwide, with a rapidly increasing incidence rate (1). Among lung cancer subtypes, non-small cell lung cancer (NSCLC) comprises 80% of lung cancers, with lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) being the predominant histological forms (2,3). The potential to induce cancer cell death of conventional anticancer strategies, such as chemotherapy using natural compounds, has been investigated. Despite advances in prevention, diagnosis, surgery, chemotherapy, targeted radiotherapy, and hormonal therapies, high costs and severe side effects remain significant challenges in lung cancer treatment (4,5).
Metaxins (MTX1 and MTX2) are ubiquitously expressed proteins in the outer mitochondrial membrane where they constitute the mitochondrial sorting and assembly machinery, facilitating β-barrel protein integration (6-9). Both types regulate mitochondrial trafficking in human induced pluripotent stem cell-derived neurons, suggesting that the functions of MTX1 and MTX2 in this process are evolutionarily conserved (10). Moreover, MTX2 deficiency results in reduced MTX1 expression and severe mitochondrial dysfunction, network fragmentation, and impaired oxidative phosphorylation in patient-derived fibroblasts (11). Although the role of MTX2 in cancer is not fully understood, MTX2 expression is downregulated in A549 LUAD cells because of promoter hypermethylation, which also correlates with tumor aggressiveness (12).
Cancer stem cells (CSCs) contribute to tumor malignancy, metastasis, and resistance to therapy (13,14). Specific markers associated with the characteristic features of CSCs and tumor malignancy have been identified, such as aldehyde dehydrogenase 1 (ALDH1), a single polypeptide enzyme, and cluster of differentiation (CD) proteins such as CD44 and CD133, which are cell surface receptor glycoproteins (15-17). The cytosolic enzyme ALDH1, which is also found in mitochondria, is encoded by the aldehyde dehydrogenase gene family; ALDH1 is widely used as a CSC marker and plays a key role in ethanol-derived acetaldehyde metabolism (18,19). Abundant amounts of ALDH1 are associated with chemoresistance, enhanced proliferation, and tumorigenicity, whereas low ALDH1 expression can sensitize cancer cells to therapy (20-22). Furthermore, high ALDH1 activity drives the epithelial-mesenchymal transition (EMT), which enhances the ability of cancer cells to detach from a primary tumor and spread to distant organs (23,24). These findings underscore the critical roles of ALDH enzymes in CSC biology and therapeutic response. Despite the known significance of ALDH1 in CSCs and MTX proteins in cancer, their roles remain unclear. This study aimed to elucidate the roles of metaxins to help devise novel strategies in the treatment of lung cancer. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2341/rc).
Methods
Cell culture and transfection of small interfering (si)RNA
Human lung fibroblast MRC5 (RRID:CV0440) and cancer H1299 (RRID:CV0060) cells were obtained from the Korean Cell Line Bank (KCLB, Seoul, Korea). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) or RPMI-1640 (Hyclone; Cytiva, Marlborough, MA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Sigma-Aldrich Corp., St. Louis MO, USA), with 1% penicillin/streptomycin (Hyclone) at 37 ℃ in a humidified 5% CO2 atmosphere. H1299 cells were transfected with siRNA targeting MTX1 (sc-88250) and MTX2 (sc-95035) using Lipofectamine RNAi MAX reagent with Opti-MEM medium (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, USA) at a final concentration of 20 nM according to the manufacturer’s instructions. Control siRNA-A (sc-37007) was used as the negative control. Cells were incubated at 37 ℃ for at least 48 h after transfection. Gene expression and protein levels in transfected cells were assessed by reverse transcription polymerase chain reaction (RT-PCR) and western blotting.
Pyrosequencing (PSQ) analysis
Genomic DNA (up to 20 ng) was bisulfite-converted and amplified by PCR using Hot/Start Taq polymerase with specific biotinylated primers. The PCR conditions comprised initial denaturation at 95 ℃ for 15 min, followed by 45 cycles of 95 ℃ for 40 s, 55 ℃ for 40 s, and 72 ℃ for 40 s, with a final extension at 72 ℃ for 10 min. The PCR products were verified by 3% agarose gel electrophoresis. Single-stranded DNA templates were prepared using streptavidin Sepharose beads according to the PSQ 96 protocol. Sequencing was performed on a PyroMark ID system with Pyro Gold reagents, and methylation levels were determined as the average % across three cytosine-phosphate-guanine (CpG) sites as previously described (25,26). For statistical analysis, differences in methylation levels across positions and between cell lines were analyzed using two-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons test to determine pairwise significance. Statistical significance was set at P<0.05 and indicated with an asterisk in the corresponding figures as follows: **, P<0.01; ***, P<0.001; ns, not significant.
Construction of MTX1 and MTX2 overexpression vector
Total RNA was isolated from H1299 cells using TRIzol reagent (10296028; Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized using a kit (Intron Biotechnology, Gyungki-do, Korea). The resultant cDNA was amplified by RT-PCR using the following forward (F) and reverse (R) 5'–3' primers:
MTX1: (F) CTTGTTCTTTTTGCAGGATCCATGGCGGCGCCCATGG (BamHI);
MTX1: (R) GGCTCGAGAGGCCTTGAATTCTCATTCCTCTTCATCCTCCTCAGCC (EcoRI);
MTX2: (F) CTTGTTCTTTTTGCAGGATCCATGTCTCTAGTGGCGGAAGCC (BamHI);
MTX2: (R) GGCTCGAGAGGCCTTGAATTCCTATGACAGCCTGCCTTTACCAC (EcoRI).
The MTX1 (988bp) and MTX2 (824bp) cDNA were cloned into the mammalian expression pCS2+ vector (Invitrogen). An empty pCS2+ vector was used as the vector control (VC). Plasmid DNA was purified using a commercial endotoxin-free preparation kit, and DNA concentration and purity were assessed using the QIAxpert system (QIAGEN, Hilden, Germany), confirming an A260/280 ratio. For overexpression, cells were seeded in 100-mm dishes and transfected at approximately 70–80% confluency. A total of 4 µg plasmid DNA was diluted in 200 µL Opti-MEM reduced-serum medium and mixed with 20 µL Lipofectamine 3000 (L3000015; Thermo Fisher Scientific, USA). After 15–20 min incubation at room temperature to allow complex formation, the DNA-lipid complexes were added dropwise to cells maintained in antibiotic-free medium. The culture medium was replaced with fresh complete medium 6 h post-transfection to minimize cytotoxicity. Cells were incubated at 37 ℃ in a humidified incubator with 5% for 48 h. Overexpression efficiency was confirmed by immunoblotting before functional assays.
RT-PCR and gel electrophoresis
Total RNA from 1×106 cultured cells was extracted using the TRIZOL reagent (15596026; Invitrogen, San Diego, USA). Then RNA was reversely transcribed and synthesized to cDNA using Reverse transcriptase (Invitrogen). The PCR conditions were as follows: denaturation at 94 ℃ for 5 min, followed by 30 cycles at 94 ℃ for 1 min, 58 ℃ for 1 min, and 72 ℃ for 1 min 30 s, and final extension at 72 ℃ for 10 min. The amplicons were analyzed by electrophoresis on 1% agarose gels (Intron Biotechnology), then photographed under ultraviolet light. Gene-specific primers (Table 1) were used in triplicate reactions with master mix (Takara Bio, Kusatsu, Japan), with β-actin serving as the endogenous control.
Table 1
| Primer name | Sequence |
|---|---|
| MTX1-fw | TGATCTGTCAGCTCGGCAAG |
| MTX1-rv | GTAGCTGAAGACGAAGGCGT |
| MTX2-fw | GCTACAGTAGGGGAGATCACT |
| MTX2-rv | GAAGAAATACGGTTGTGTTCCC |
| N-cad-fw | ACTTGCCAGAAAACTCCAGG |
| N-cad-rv | TGGTGTATGGGGTTGATCCT |
| E-cad-fw | TGGATAGAGAACGCATTGCC |
| E-cad-rv | AAAATCCAAGCCCGTGGTG |
| Vimentin-fw | GAGAACTTTGCCGTTGAAGC |
| Vimentin-rv | TCTGCTGGTATATGAGTGCTG |
| Zeb1-fw | CGGCGCAATAACGTTACAAA |
| Zeb1-rv | AAAGGTGTAACTGCACAGGG |
| Snail-fw | GGGACTGTGAGTAATGGCTG |
| Snail-rv | CCCACTCCTCTATGACACCA |
| ALDH1A1-fw | TCCTTGGAATTTCCCGTTGG |
| ALDH1A1-rv | ATGCGGCTATACAACACTGG |
| CD44-fw | TCATACCAGCCATCCAATGC |
| CD44-rv | CGTGTGTGGGTAATGAGAGG |
| Sox2-fw | CAAGATGCACAACTCGGAGA |
| Sox2-rv | TTCATGTGCGCGTAACTGTC |
| Oct4-fw | TGGGATATACACAGGCCGAT |
| Oct4-rv | GTGACAGAGACAGGGGGAAA |
| β-actin-fw | CTTCGCGGGCGACGAT |
| β-actin-rv | CCACATAGGAATCCTTCTGA |
fw, forward; RT-PCR, reverse transcription polymerase chain reaction; rv, reverse.
Cell proliferation and colony-forming assay
We seeded 5×103 cells per well into 96-well plates. For each condition, three technical replicate wells were prepared. After 48 h of incubation, the medium was replaced with 100 µL of fresh RPMI-1640 medium with 10 µL of Cell Counting Kit-8 (CCK-8) solution (CK04; Dojindo, Tokyo, Japan) at 37 ℃ for 3 h. Cell morphology was captured using an inverted light microscope at ×100 magnification. All experiments were independently repeated three times. The 48 h absorbance values were normalized to the corresponding control group (siCTL or VC), and relative cell proliferation was calculated. The optical density was measured at 450 nm using a Spectramax i3x (Molecular Devices, San Jose, CA, USA). H1299 cells were seeded at a density of 1×103 in 35 mm dishes and were cultured for 7 d until macroscopic colonies formed. The cells were washed and stained using 0.1% crystal violet (V5265; Sigma-Aldrich) for 30 min; subsequently, the colonies were visualized and counted. A colony was defined as a cluster containing ≥50 cells.
Migration/invasion and wound healing assay
Cell migration and invasion were assessed using Transwell chambers (8-µm pores, BD Biosciences, San Jose, CA, USA). The H1299 cells (2×104) in serum-free medium were seeded in the upper chamber, and medium containing 10% FBS was placed in the lower chamber. The upper chambers were coated with Matrigel for invasion assays. After incubation, migratory and invasive cells were stained with crystal violet and visualized under a light microscope.
For wound healing assays, H1299 cells were grown to >90% confluence in 6-well plates, then scratched with a pipette tip to assay wound healing. The cells were then incubated in a medium containing 10% FBS for 18 and 24 h. Wound closure was monitored using a CKX53 inverted phase contrast microscope (Olympus, Tokyo, Japan), and migration was quantified by measuring the distance between wound edges at numerous sites.
Tumor sphere-forming assay
Cells (3×103/mL) were seeded in ultra-low attachment 6-well plates (Corning Inc., Corning, NY, USA) in serum-free DMEM/F12 supplemented with B27 (1:50), 20 ng/mL EGF, and 20 ng/mL βFGF. Every 3 days, 500 µL of fresh medium was added. AggreWell 400 (STEMCELL, #34415) microwell plates were pretreated and washed with anti-adhesion solution (STEMCELL, #07010) for 5 min at 37 ℃. Then, H1299 cells were seeded at 1×105 cells/well and centrifuged at 100 ×g for 3 min at room temperature to capture cells inside the microwells with stem cell-permissive medium. Tumor spheres were photographed after 10 days by inverted phase contrast microscopy; n=10 spheroids per group per experiment, and the experiment was independently performed three times.
Western blotting
We used primary antibodies specific for MTX1 (CS-47961; Cell Signaling Technology, Beverly, MA, USA); MTX2 (ab272607) and ALDH1A1 (ab52492; both from Abcam, Cambridge, UK); CD44 (sc-7297), Sox2 (sc-365823), Oct3/4 (sc-5279), and β-actin (sc-47778; Santa Cruz Biotechnology, Dallas, TX, USA). Cells were lysed in radioimmunoprecipitation assay buffer supplemented with Halt Protease and Phosphatase Inhibitor Cocktail (both from Thermo Fisher Scientific, Inc.). Protein concentrations were measured using Pierce BCA Protein Assay Kits (Thermo Fisher Scientific, Inc.). In brief, proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto polyvinylidene fluoride membranes. Non-specific binding on the membranes was blocked using 5% nonfat dried milk for 1 h at room temperature and incubated with the indicated primary antibodies overnight at 4 ℃, followed by secondary antibodies for 1 h at room temperature. The protein bands were visualized with ECL detection reagents (Thermo Fisher Scientific Inc.; Figure S1).
Flow cytometric analysis of ALDH activity and apoptosis
The enzymatic activity of ALDH was measured using flow cytometry using Aldefluor kits (StemCell Tech., Durham, NC, USA) according to the manufacturer’s instructions. Diethylamino-benzyaldehyde (DEAB), a specific ALDH inhibitor, was used as the negative control. The cells were collected and stained for 20 min at room temperature. Cells with ALDH activity emitted more fluorescence than those with enzyme activity inhibited by DEAB. Suppressed H1299 cells with siMTX1 and siMTX2 were double stained using Annexin V/propidium iodide (PI) apoptosis detection kits (556547; BD Biosciences) according to manufacturer’s instructions. Apoptosis and ALDH activity were determined using an Accuri C6 Plus flow cytometer (BD Biosciences).
Kaplan-Meier plotter
We used a published genetic information system to obtain Kaplan-Meier survival values (kmplot.com/analysis). This system is based on mRNA gene chip data derived from tissues of patients with lung cancer. The gene symbols were MTX1 and MTX2. All conditions were set for all patients with lung cancer.
Statistical analysis
The results were expressed as the mean ± standard error of the mean. All experiments were conducted with technical triplicate per condition within each experiment and independently repeated three times (n=3). For experiments involving more than two groups, one-way ANOVA followed by Tukey’s multiple comparison test was applied. Data are presented as mean ± standard deviation (SD) from three independent experiments using GraphPad Prism 10.3. Statistical significance was set at P<0.05 and indicated with an asterisk in the corresponding figures as follows: *, P<0.05; **, P<0.01; ***, P<0.001.
Results
Prognostic implications of MTX1 and MTX2 expression in lung cancer
The expressions of MTX1 and MTX2 were elevated in LUAD and LUSC compared with normal lung tissues (Figure 1A). These findings were consistent with those of previous studies that emphasized the prognostic relevance of MTX1 and MTX2 expression profiles (12). Analysis of patient-derived data further correlated MTX2 expression with survival outcomes (Figure 1B). The expressions of MTX1 and MTX2 in LUAD tumors (n=483 and 486, respectively) and normal (n=347 and 338, respectively) samples from The Cancer Genome Atlas (TCGA) database were analyzed using the Gene Expression Profiling Interactive Analysis (GEPIA) tool. Kaplan-Meier analysis revealed significantly poorer survival among patients with elevated MTX1 or MTX2 expression levels than in those with decreased expression levels (P<0.004 and <0.001, respectively). Collectively, these results suggest that MTX1 and MTX2 play key roles in lung cancer progression and might contribute to tumor aggressiveness and therapeutic responses.
Methylation of the MTX1 promoter region in MRC5 and H1299 cells
MTX1 and MTX2 expressions in H1299 lung cancer and MRC5 lung fibroblast cells were evaluated using RT-PCR and western blotting to determine differences in gene expression between cancerous and normal cells. MTX1 and MTX2 expressions were elevated in H1299 cells compared to MRC5 cells (Figure 2A). We assessed epigenetic modifications on MTX expression by analyzing the methylation profile of MTX1 using the bisulfite PSQ method. The primer sequences were designed using a PSQ assay design program (Biotage AB, Uppsala, Sweden) (Figure 2B). Primer design was challenging because of the high density of repetitive sequences within the MTX2 gene. Although we attempted to target the most upstream region of the promoter, the design was not successfully amplified. Consequently, only changes in the MTX1 expression levels were assessed. We selected three CpG sites at positions 1–3 (Figure 2C) and prepared bisulfite-modified gDNA using the EZ DNA Methylation-Gold Kit. The Y sequence (in boxes) shows methylated sites in the cell lines at positions 1–3 (Figure 2C). After PCR amplification, the methylation ratio (%) was calculated as the average degree of methylation at the three CpG sites identified during PSQ. At individual CpG sites, methylation levels in normal MRC5 fibroblasts were 52.8%, 84.9%, and 80.0%, respectively, whereas those in H1299 lung cancer cells were 26.9%, 86.8%, and 49.5%, respectively. Overall, the average methylation level across all CpG sites was ≥72.6% in MRC5 cells and approximately 54.4% in H1299 cells (Figure 2C), indicating higher methylation in normal cells compared with cancer cells.
Differences between proliferative behavior in H1299 cells
We next determined whether MTX1 and MTX2 are involved in the regulation of cell growth and proliferation. MTX1 and MTX2 expressions were suppressed in H1299 cells by transfection with MTX1- and MTX2-specific siRNAs (siMTX1 and siMTX2, respectively). In contrast, MTX1 and MTX2 were overexpressed by transfecting H1299 cells with the pCS2+MTX1 and pCS2+MTX2 expression vectors, respectively (Figure S2). The levels of MTX1 and MTX2 in the transfected cells were analyzed using CCK-8 and colony-forming assays. Silencing MTX1 or MTX2 obviously reduced the density of transfected cells compared with control cells. In contrast, overexpressed MTX1 or MTX2 increased the confluence of transfected cells compared with the VC (Figure 3A). Consistent with these findings, quantitative CCK-8 assays revealed that the proliferation of transfected cells was significantly suppressed by MTX1- or MTX2-knockdown compared with control siRNA. Conversely, overexpressed MTX1 or MTX2 promoted cell proliferation, with notable increases at 48 h (Figure 3B). Results of the colony-forming assay (Figure 3C) revealed that decreased and overexpressed MTX1 or MTX2 expressions significantly inhibited and increased the growth of H1299 cells, respectively. We assessed the effects of MTX1 and MTX2 knockdown on apoptosis by specifically staining apoptotic cells using Annexin V/PI. The average ratio (%) of dead and late apoptotic cells increased after suppressing MTX1 (8.9%) and MTX2 (7.2%) expression in H1299 cells compared with control cells (Figure 3D). These results indicated that the proliferative behavior of H1299 adenocarcinoma cells is partially due to the regulation of MTX1 and MTX2 expression after the hypomethylation of the promoter regions of these genes in cancer cells compared with normal cells.
Migration and invasion on regulated MTX expression in H1299
To determine whether MTX1 and MTX2 regulate EMT in lung cancer cells, we knocked down or overexpressed these genes in H1299 cells. The migration and invasion abilities were significantly reduced by their knockdown and were enhanced in cells overexpressing MTX1 and MTX2 (Figure 4A).
The expression of the EMT markers, including N-cadherin, E-cadherin, vimentin, zinc finger E-box binding homeobox 1, and Snail was altered in response to MTX1 or MTX2 modulation (Figure 4B). These findings indicated that MTX1 and MTX2 regulate the EMT process. The wound closure was delayed in MTX1 or MTX2 silenced cells, whereas wound healing area accelerated in overexpressing MTX1 or MTX2 compared with that in cells transfected with the pCS2+ empty vector (Figure 4C). Therefore, these results suggest that MTX1 and MTX2 expression contribute to the expression of EMT-related markers in H1299 cells.
Cellular stemness on regulated MTX expression in H1299
Previous studies have reported that MTX2 expression promotes metastatic potential in lung cancer cells, including A549 cells (12), although the precise roles of MTX1 and MTX2 in tumorigenesis remain incompletely understood. Based on these observations, we investigated whether MTX1 and MTX2 contribute to CSC-related properties in H1299 lung cancer cells. To evaluate stemness-associated phenotypes, we performed sphere formation assays in cells subjected to MTX1 or MTX2 knockdown or overexpression. Silencing MTX1 or MTX2 significantly reduced the sphere-forming capacity of H1299 cells compared with control cells (Figure 5A). In contrast, overexpression of MTX1 or MTX2 increased both spheroid size and number relative to VCs (Figure 5A), suggesting a positive association between MTX expression and self-renewal potential. We next assessed ALDH activity, a functional marker of CSCs. ALDH1 levels were significantly decreased in MTX1- or MTX2-silenced cells compared with controls (Figure 5B), whereas overexpression of either gene increased ALDH1 expression. Consistently, RT-PCR and western blot analyses demonstrated that representative CSC-associated markers—including ALDH1, CD44, SOX2, and OCT3/4—were markedly downregulated following MTX1 or MTX2 knockdown and upregulated upon overexpression (Figure 5C,5D).
Collectively, these findings indicate that MTX1 and MTX2 positively regulate CSC-related phenotypes in H1299 lung cancer cells. Considering that MTX1 expression is elevated in cancer cells and associated with promoter hypomethylation, these results raise the possibility that epigenetic modulation of MTX expression may contribute to the maintenance of stemness characteristics. However, further mechanistic studies will be required to define the direct molecular pathways linking MTX expression to CSC regulation.
Discussion
Recent findings have indicated that MTX2 is involved in tumor progression, functioning as a component of the LUAD cell proliferation machinery and inhibiting apoptosis; these findings suggest that MTX2 is involved in cellular stress responses and mitochondrial function (12,27,28). Herein, we showed that suppressed or overexpressed MTX1 and MTX2 mitochondrial proteins in lung cancer cells impaired proliferation, EMT, and CSC-related features such as ALDH1 activity and spheroid formation. These findings suggest that MTX1 and MTX2 are not only mitochondrial structural components but also functionally contribute to tumor aggressiveness. Suppressing MTX1 or MTX2 expression in H1299 cells increased the number of dead and late apoptotic cells compared with control cells. Therefore, MTX1 and MTX2 might be associated with the proliferation of lung cancer cells and resistance to therapy. We analyzed the methylation of MTX1 and MTX2 promoters by PSQ MRC5 and H1299 cells. Analysis of the MTX1 promoter revealed distinct differences in methylation between MRC5 and H1299 cells, providing novel insights into the potential regulatory roles of MTX1. However, methylation of the MTX2 promoter could not be analyzed owing to technical challenges. The high density of repetitive sequences within the MTX2 promoter complicated primer design and caused sequencing failure.
These challenges persisted even when the upstream promoter, which had fewer repetitive elements, was the target region. Nevertheless, considering the functional and structural similarities between MTX1 and MTX2, we speculate that their methylation patterns are comparable. Such epigenetic regulation could be closely linked to altered gene expression patterns and maintenance of stemness in lung cancer cells compared with that in control cells. Such methylation-associated changes in MTX2 expression suggest that alterations are associated with differences between CpG methylation levels in MRC5 and H1299 cells.
MTX1 or MTX2 knockdown in H1299 cells using siRNAs resulted in decreased corresponding gene expression. In contrast, either MTX1 or MTX2 overexpression in H1299 cells concomitantly upregulated both genes, suggesting that they have a coordinated mechanism of action. Recessive MTX2-null mutations mimic the phenotypic effects of MTX1 and MTX2 double knockout, resulting in the absence of MTX2 protein and destabilized MTX1 on the outer mitochondrial membrane, whereas MTX1 cDNA levels remain unchanged. This finding indicates that MTX1 stability is compromised at the post-translational level owing to MTX2 loss (11). MTX1 deficiency, a major determinant of apoptosis resistance in cells derived from patients, triggers a cascade of detrimental downstream effects that are more pronounced than those of MTX2 deficiency (29). Collectively, these findings suggest that MTX1 or MTX2 overexpression affects both gene and protein expression in cells, emphasizing the interdependent regulation of these genes.
Notably, ALDH1 is a popular marker for CSC identification and isolation. Indeed, few ALDH1⁺ lung cancer cells are sufficient to initiate tumor formation in transplanted athymic nude mice, whereas ALDH1⁻ cells do not initiate tumor formation (30,31). These findings support the notion that ALDH1-enforced cells possess tumor-initiating capability and enhanced tumorigenicity, consistent with their CSC-like properties (32). Moreover, clinical evidence indicates that patients with cancer harboring ALDH1⁺ tumors show decreased overall survival, likely due to the intrinsic resistance of ALDH1⁺ CSCs to chemotherapy and radiotherapy (33,34).
Despite the clear results provided by this study, several limitations should be acknowledged. Our findings are primarily based on in vitro experiments performed in MRC-5 and H1299 cell lines. Although these models provide useful insight into the functional role of MTX1 and MTX2, the generalizability of our findings to other NSCLC subtypes remains to be further validated. Future studies using additional cell lines, patient-derived samples, and in vivo models will be necessary to confirm the broader clinical relevance of MTX1/2 in NSCLC. Although functional assays demonstrated that MTX1/2 influence migration, invasion, and CSC-associated phenotypes, the precise molecular mechanisms underlying these effects remain to be fully elucidated. In particular, whether MTX proteins directly interact with specific transcription factors or regulate CSC properties through defined signaling pathways warrants further investigation. These mechanistic studies are currently ongoing. While detailed cytoskeletal analyses were not performed in the present study, EMT-associated morphological changes and consistent alterations in canonical EMT marker expression were clearly observed. Moreover, although wound-healing assays can be influenced by both migration and proliferation, our conclusions are not based on this assay alone. The concordant results obtained across these independent functional and molecular assessments strengthen the conclusion that MTX1/2 modulation genuinely affects migratory and EMT-associated phenotypes. Nevertheless, additional in vivo validation studies will further substantiate the biological significance of MTX1/2 in tumor progression. Notably, given that MTX1 and MTX2 are known to regulate mitochondrial protein transport and integrity, it is plausible that they may contribute to sustaining CSC survival and plasticity through ALDH-associated pathways. The involvement of MTX1/2 in maintaining mitochondrial homeostasis may influence metabolic reprogramming and stress response pathways, thereby potentially conferring therapeutic resistance in CSC populations.
Conclusions
To the best of our knowledge, this is the first study to report that MTX1 and MTX2 modulate ALDH1 expression and thus influence EMT and stemness in lung cancer cells. These results suggest a hitherto unknown link between mitochondrial protein regulation and CSC-associated malignancy and provide insights into the development of novel strategies for lung cancer therapy. Future studies should investigate the potential crosstalk between the roles of MTX1 and MTX2 and ALDH activity in mitochondria. In particular, downstream signaling networks linking mitochondrial dynamics to stemness-associated transcriptional programs and resistance to therapy should be focused.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2341/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2341/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2341/prf
Funding: This research was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2341/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Kerdidani D, Chouvardas P, Arjo AR, et al. Wnt1 silences chemokine genes in dendritic cells and induces adaptive immune resistance in lung adenocarcinoma. Nat Commun 2019;10:1405. [Crossref] [PubMed]
- Hendriks LEL, Remon J, Faivre-Finn C, et al. Non-small-cell lung cancer. Nat Rev Dis Primers 2024;10:71. [Crossref] [PubMed]
- Kratzer TB, Bandi P, Freedman ND, et al. Lung cancer statistics, 2023. Cancer 2024;130:1330-48. [Crossref] [PubMed]
- Zappa C, Mousa SA. Non-small cell lung cancer: current treatment and future advances. Transl Lung Cancer Res 2016;5:288-300. [Crossref] [PubMed]
- Noguchi M, Morikawa A, Kawasaki M, et al. Small adenocarcinoma of the lung. Histologic characteristics and prognosis. Cancer 1995;75:2844-52. [Crossref] [PubMed]
- Höhr AI, Straub SP, Warscheid B, et al. Assembly of β-barrel proteins in the mitochondrial outer membrane. Biochim Biophys Acta 2015;1853:74-88. [Crossref] [PubMed]
- Abdul KM, Terada K, Yano M, et al. Functional analysis of human metaxin in mitochondrial protein import in cultured cells and its relationship with the Tom complex. Biochem Biophys Res Commun 2000;276:1028-34. [Crossref] [PubMed]
- Armstrong LC, Saenz AJ, Bornstein P. Metaxin 1 interacts with metaxin 2, a novel related protein associated with the mammalian mitochondrial outer membrane. J Cell Biochem 1999;74:11-22. [Crossref] [PubMed]
- Armstrong LC, Komiya T, Bergman BE, et al. Metaxin is a component of a preprotein import complex in the outer membrane of the mammalian mitochondrion. J Biol Chem 1997;272:6510-8. [Crossref] [PubMed]
- Zhao Y, Song E, Wang W, et al. Metaxins are core components of mitochondrial transport adaptor complexes. Nat Commun 2021;12:83. [Crossref] [PubMed]
- Elouej S, Harhouri K, Le Mao M, et al. Loss of MTX2 causes mandibuloacral dysplasia and links mitochondrial dysfunction to altered nuclear morphology. Nat Commun 2020;11:4589. [Crossref] [PubMed]
- Kumar S, Wu CC, Wulandari FS, et al. Integration of multi-omics and single-cell transcriptome reveals mitochondrial outer membrane protein-2 (MTX-2) as a prognostic biomarker and characterizes ubiquinone metabolism in lung adenocarcinoma. J Cancer 2025;16:2401-20. [Crossref] [PubMed]
- Eramo A, Lotti F, Sette G, et al. Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ 2008;15:504-14. [Crossref] [PubMed]
- Alamgeer M, Peacock CD, Matsui W, et al. Cancer stem cells in lung cancer: Evidence and controversies. Respirology 2013;18:757-64. [Crossref] [PubMed]
- Lundin A, Driscoll B. Lung cancer stem cells: progress and prospects. Cancer Lett 2013;338:89-93. [Crossref] [PubMed]
- Kodama H, Murata S, Ishida M, et al. Prognostic impact of CD44-positive cancer stem-like cells at the invasive front of gastric cancer. Br J Cancer 2017;116:186-94. [Crossref] [PubMed]
- Qu H, Li R, Liu Z, et al. Prognostic value of cancer stem cell marker CD133 expression in non-small cell lung cancer: a systematic review. Int J Clin Exp Pathol 2013;6:2644-50. [PubMed]
- Jiang F, Qiu Q, Khanna A, et al. Aldehyde dehydrogenase 1 is a tumor stem cell-associated marker in lung cancer. Mol Cancer Res 2009;7:330-8. [Crossref] [PubMed]
- Miyata T, Yoshimatsu T, So T, et al. Cancer stem cell markers in lung cancer. Personalized Medicine Universe 2015;4:40-5. [Crossref]
- Lee JH, Kim JY, Kim SY, et al. APBB1 reinforces cancer stem cell and epithelial-to-mesenchymal transition by regulating the IGF1R signaling pathway in non-small-cell lung cancer cells. Biochem Biophys Res Commun 2017;482:35-42. [Crossref] [PubMed]
- Yue H, Hu Z, Hu R, et al. ALDH1A1 in Cancers: Bidirectional Function, Drug Resistance, and Regulatory Mechanism. Front Oncol 2022;12:918778. [Crossref] [PubMed]
- Luo Y, Dallaglio K, Chen Y, et al. ALDH1A isozymes are markers of human melanoma stem cells and potential therapeutic targets. Stem Cells 2012;30:2100-13. [Crossref] [PubMed]
- Vieira V, Campos LH, Jesus LH, et al. Overexpression of ALDH1 and EMT marker profile are linked with unfavorable outcome in head and neck cancer. Med Oral Patol Oral Cir Bucal 2020;25:e752-61. [Crossref] [PubMed]
- Li Y, Chen T, Zhu J, et al. High ALDH activity defines ovarian cancer stem-like cells with enhanced invasiveness and EMT progress which are responsible for tumor invasion. Biochem Biophys Res Commun 2018;495:1081-8. [Crossref] [PubMed]
- Tost J, Gut IG. DNA methylation analysis by pyrosequencing. Nat Protoc 2007;2:2265-75. [Crossref] [PubMed]
- Kim IG, Lee JH, Kim SY, et al. Fibulin-3 negatively regulates ALDH1 via c-MET suppression and increases γ-radiation-induced sensitivity in some pancreatic cancer cell lines. Biochem Biophys Res Commun 2014;454:369-75. [Crossref] [PubMed]
- Cartron PF, Petit E, Bellot G, et al. Metaxins 1 and 2, two proteins of the mitochondrial protein sorting and assembly machinery, are essential for Bak activation during TNF alpha triggered apoptosis. Cell Signal 2014;26:1928-34. [Crossref] [PubMed]
- Li L, Yu S, Hu Q, et al. Genome-scale CRISPRa screening identifies MTX1 as a contributor for sorafenib resistance in hepatocellular carcinoma by augmenting autophagy. Int J Biol Sci 2021;17:3133-44. [Crossref] [PubMed]
- Petit E, Cartron PF, Oliver L, et al. The phosphorylation of Metaxin 1 controls Bak activation during TNFα induced cell death. Cell Signal 2017;30:171-8. [Crossref] [PubMed]
- Kim IG, Kim SY, Choi SI, et al. Fibulin-3-mediated inhibition of epithelial-to-mesenchymal transition and self-renewal of ALDH+ lung cancer stem cells through IGF1R signaling. Oncogene 2014;33:3908-17. [Crossref] [PubMed]
- Lee JH, Choi SI, Kim RK, et al. Tescalcin/c-Src/IGF1Rβ-mediated STAT3 activation enhances cancer stemness and radioresistant properties through ALDH1. Sci Rep 2018;8:10711. [Crossref] [PubMed]
- Rebollido-Rios R, Venton G, Sánchez-Redondo S, et al. Dual disruption of aldehyde dehydrogenases 1 and 3 promotes functional changes in the glutathione redox system and enhances chemosensitivity in nonsmall cell lung cancer. Oncogene 2020;39:2756-71. [Crossref] [PubMed]
- Wei D, Peng JJ, Gao H, et al. ALDH1 Expression and the Prognosis of Lung Cancer: A Systematic Review and Meta-Analysis. Heart Lung Circ 2015;24:780-8. [Crossref] [PubMed]
- Oria VO, Bronsert P, Thomsen AR, et al. Proteome Profiling of Primary Pancreatic Ductal Adenocarcinomas Undergoing Additive Chemoradiation Link ALDH1A1 to Early Local Recurrence and Chemoradiation Resistance. Transl Oncol 2018;11:1307-22. [Crossref] [PubMed]

