A network pharmacology and molecular docking approach to investigate the anticancer mechanism of baicalin against melanoma through induction of apoptosis via EGFR-mediated PI3K/AKT pathway
Original Article

A network pharmacology and molecular docking approach to investigate the anticancer mechanism of baicalin against melanoma through induction of apoptosis via EGFR-mediated PI3K/AKT pathway

Zhongshun He1,2,3#, Aiping Huang4#, Jing Lv5, Jing Zhou1,2,3, Wenrong Lou3, Biao Xu1,2, Xuesong Wu6

1Department of , The Affiliated Stomatology Hospital of Kunming Medical University, Kunming, China; 2Yunnan Key Laboratory of Stomatology, Kunming, China; 3Department of Otorhinolaryngology, Kunming Yanan Hospital, Kunming, China; 4Pharmacy Department, Dazhou Integrated Traditional Chinese and Western Medicine Hospital, Dazhou, China; 5Department of Physiology, School of Basic Medicine, Kunming Medical University, Kunming, China; 6Department of Gastrointestinal Surgery, The Second Affiliated Hospital of Kunming Medical University, Kunming, China

Contributions: (I) Conception and design: B Xu, X Wu; (II) Administrative support: ; (III) Provision of study materials or patients: ; (IV) Collection and assembly of data: J Lv, J Zhou, W Lou; (V) Data analysis and interpretation: Z He, A Huang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

#These authors contributed equally to this work.

Correspondence to: Biao Xu, PhD. Department of, The Affiliated Stomatology Hospital of Kunming Medical University, No. 1088 Haiyuan Middle Road, Kunming 650500, China; Yunnan Key Laboratory of Stomatology, Kunming, China. Email: xubiao@kmmu.edu.cn; Xuesong Wu, PhD. Department of Gastrointestinal Surgery, The Second Affiliated Hospital of Kunming Medical University, No. 374 Dianmian Avenue, Kunming 650101, China. Email: kmykdwxs139@163.com.

Background: Malignant melanoma is among the most aggressive and life-threatening forms of skin cancer, and effective therapeutic treatment options remain limited. Thus, there is an urgent need to develop efficient and broadly applicable anti-melanoma drugs. Growing evidence suggests that baicalin (BAI) possesses anti-cancer potential; however, its anti-tumor mechanisms in melanoma cells remain to be fully elucidated.

Methods: A375 melanoma cells were treated with varying concentrations of BAI to assess its effects on cell proliferation, migration, invasion, and apoptosis. Network pharmacology analysis was then employed to predict potential molecular targets of BAI in melanoma treatment. Molecular docking was used to evaluate the binding interactions between BAI and the predicted targets. Finally, in vitro experiments were performed to investigate the regulatory effects of the potential targets on A375 cell functions.

Results: BAI significantly inhibited A375 cell proliferation, invasion, and migration, as well as inducing apoptosis of A375 cells in a dose-dependent manner (all P<0.05). Subsequent network pharmacology analysis identified three potential therapeutic targets of BAI, among which epidermal growth factor receptor (EGFR) exhibited strong binding affinity with BAI. Further in vitro experiments demonstrated that BAI suppressed EGFR-mediated PI3K/AKT pathway activation in a dose-dependent manner. Consistent with previous findings, EGFR overexpression exerted oncogenic effects in melanoma cells by inhibiting apoptosis. Mechanistically, BAI induced apoptosis in melanoma cells by targeting the EGFR-mediated PI3K/AKT signaling pathway.

Conclusions: This study demonstrates that BAI exerted cytotoxic effects on melanoma cells by targeting EGFR and inhibiting the PI3K/AKT pathway, thereby inducing apoptosis. These findings suggest that BAI may serve as a promising therapeutic candidate for the treatment of malignant melanoma.

Keywords: Melanoma; baicalin (BAI); epidermal growth factor receptor (EGFR); network pharmacology; molecular docking; apoptosis


Submitted Dec 12, 2025. Accepted for publication Mar 11, 2026. Published online May 27, 2026.

doi: 10.21037/tcr-2025-1-2777


Highlight box

Key findings

• Baicalin (BAI) inhibits the proliferation, migration, and invasion of melanoma A375 cells and induces apoptosis via suppression of the epidermal growth factor receptor (EGFR)-mediated PI3K/AKT signaling pathway.

What is known and what is new?

• Malignant melanoma is a highly aggressive skin cancer with limited treatment options, and the natural compound BAI has demonstrated broad anticancer potential.

• BAI induces apoptosis in melanoma A375 cells by specifically targeting the EGFR-mediated PI3K/AKT pathway.

What is the implication, and what should change now?

• By selectively inhibiting the oncogenic EGFR/PI3K/AKT axis and promoting apoptosis, BAI represents a promising natural product-derived candidate for melanoma therapy.

• Subsequent research should prioritize in vivo validation of BAI’s efficacy and safety in animal models, and explore its potential in combination with existing therapies or for EGFR-driven melanoma subtypes to accelerate clinical translation.


Introduction

Cutaneous melanoma, derived from transformed melanocytes, is a highly lethal form of skin cancer characterized by early metastasis, rapid progression, poor prognosis, and high mortality (1,2). Studies indicate that its 5-year survival rate is only 29.8% (3,4). Surgical resection remains the primary treatment for melanoma, often supplemented with radiotherapy or chemotherapy as adjuvant therapies (5). However, these pharmacological interventions are frequently associated with low response rates, significant side effects, and a high risk of drug resistance (6-8). Therefore, the development of highly effective and low-toxicity novel drugs or adjuvant agents for melanoma treatment is of critical importance.

Over the past decades, there has been compelling evidence that phytochemicals and their derivatives are a major source of chemotherapeutic agents, attributed to their low toxicity and multi-targeting properties (9,10). Numerous studies have shown that phytochemicals have anticancer potential and can even overcome resistance to chemotherapeutic drugs (11). Baicalin (BAI), also known as 7-glucuronide-5,6-dihydroxyflavone, is the main bioactive flavonoid extracted from the root of the traditional botanical Scutellaria baicalensis Georgi (12). Studies have shown that this compound exhibits significant anticancer activity against various malignant tumors, primarily by inhibiting cancer cell proliferation and migration, and inducing apoptosis, ferroptosis, or autophagy (13-15). For instance, in lung cancer, BAI inactivated the nuclear factor-kappa B (NF-κB) and STAT3 pathway by upregulating SOCS1 expression, thereby inhibiting proliferation both in vitro and in vivo (16). Furthermore, BAI inhibited tumor growth in a lung cancer xenograft model by activating the AMPK/mitochondrial fission pathway and induced apoptosis and autophagy in tumor cells (14). In breast cancer, it suppressed malignant phenotypes such as migration and invasion by modulating the TGF-β signaling pathway (17). BAI also induces ferroptosis in hepatocellular carcinoma HepG2 cells by inhibiting the ROS-mediated PI3K/Akt/FoxO3a signaling pathway (13), or induces ferroptosis in bladder cancer cells by inhibiting ferritin heavy chain 1 (15). Other studies have shown that in melanoma, BAI promoted apoptosis and senescence by inhibiting glucose uptake and metabolism in tumor cells (18). Nevertheless, the precise molecular mechanisms through which BAI exerts its anticancer effects in melanoma remain incompletely elucidated. Owing to its multi-target characteristics, a systematic investigation utilizing network pharmacology approaches is warranted to decipher its comprehensive molecular mechanisms.

This study aimed to investigate the anti-melanoma effects of BAI in vitro and to elucidate its underlying mechanisms. Network pharmacology analysis combined with molecular docking was employed to further explore the molecular mechanisms of BAI. The findings of this research are expected to provide novel therapeutic targets and promising drug candidates for the treatment of melanoma. We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2777/rc).


Methods

Cell culture and treatment

The A375 cell line (Product No. SCSP-533) was obtained from the Cell Bank of the Chinese Academy of Sciences (China). This cell line was derived from the skin tissue of a female patient with melanoma and tested negative for mycoplasma contamination. The cells were cultured in Dulbecco’s modified Eagle medium (DMEM; 10091148; Gibco, USA) supplemented with 10% fetal bovine serum (FBS; 11965092; Gibco) and 100 U/mL penicillin-streptomycin. The cells were maintained in a humidified incubator at 37 ℃ with 5% CO2. To investigate the effects of BAI, cells were treated with 10, 20, or 40 µM BAI (B107324; Aladdin, China) for 24 h. All experiments were performed using low-passage cells (P3–P8) to ensure phenotypic stability.

Cell counting kit-8 (CCK-8) assay

Cell viability was assessed using a CCK-8 kit (C0038; Beyotime, China). A375 cells were seeded in 96-well plates (5,000 cells per well) and treated with or without various concentrations of BAI for 24 h. Subsequently, 10 µL of CCK-8 solution was added to each well, followed by incubation for 1 h. The optical density (OD) at 450 nm was measured using a SpectraMax iD5e microplate reader (Molecular Devices, USA). Cell viability was calculated as follows: cell viability (%) = (OD_experimental group − OD_blank group)/(OD_control group − OD_blank group) × 100%.

Wound healing assay

The migratory capacity of cells was evaluated using the wound healing assay. A375 cells in logarithmic growth phase were seeded in six-well plates at a density of 5×105 cells per well, cultured in a 37 ℃, 5% CO2 cell culture incubator (BPH-9042; Yiheng, China). When the cell confluence reached 90%, a straight scratch was created in the monolayer using a 10 µL pipette tip, and the detached cells were removed by washing with phosphate-buffered saline (PBS). The cells were then cultured in medium supplemented with 1% FBS. Images of the wound area were captured at 0 and 24 h after scratching using a microscope (IXplore Standard; OLYMPUS, Japan). The extent of cell migration was quantified by measuring the wound width with ImageJ software. The migration rate was calculated as follows: migration rate (%) = (initial scratch area − final scratch area)/initial scratch area × 100%.

Transwell assay

Cell invasion was assessed using the Transwell assay. Matrigel (354248; Corning Inc., Corning, NY, USA) was mixed with serum-free medium at a ratio of 1:5, and 100 µL of the mixture was added to the upper chamber of the six-well Transwell insert (FTW064-12Ins; Beyotime), followed by incubation at 37 ℃ to allow gelation. After the Matrigel solidified, cells treated with or without BAI were resuspended and seeded into the upper chamber at a density of 5×105 cells per well. The lower chamber was filled with 500 µL of medium containing 20% FBS. After 24 h of incubation, the cells were fixed with 4% paraformaldehyde for 20 min, then stained with 0.1% crystal violet (IC0600; Solarbio, China) for 20 min. Non-invasive cells on the upper surface of the membrane were gently removed with a moist cotton swab. Finally, images were captured from three randomly selected fields using a microscope (IXplore Standard; OLYMPUS), and cell numbers were quantified using ImageJ software.

Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay

Apoptosis was detected using the TUNEL assay. Cells were fixed with 4% paraformaldehyde (P0099; Beyotime) for 20 min, washed with PBS, and then permeabilized with 0.3% Triton X-100 solution (X100-5ML; Merck, Germany). Subsequently, the TUNEL assay was performed using a TUNEL kit (T2130; Servicebio, China). Briefly, 50 µL of equilibration buffer was added to each sample and incubated at room temperature for 10 min. Then, 50 µL of TdT reaction buffer was applied to each sample and incubated for 60 min protected from light. After washing with PBS, the slides were mounted with an anti-fade mounting medium (P0126; Beyotime). Finally, images were captured using a microscope (IXplore Standard; OLYMPUS).

Flow cytometry

The apoptosis rate was detected using flow cytometry. A375 cells in logarithmic growth phase were seeded into 60 mm culture dishes at a density of 2×105 cells per dish. After treatment with various concentrations of BAI for 24 h, cells were collected. The apoptosis rate was determined using the Annexin V fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis kit (40302ES50; Yeasen, China). Specifically, the collected cells were washed with PBS and centrifuged, then resuspended in 300 µL of ice-cold 1× binding buffer, and stained with 5 µL of Annexin V-FITC and 10 µL of PI staining solution for 15 min in the dark. The samples were analyzed using a flow cytometer (Bideco, China).

Acquisition of BAI targets and melanoma disease targets

The SwissTargetPrediction (http://www.swisstargetprediction.ch) and Pharmapper database (https://www.lilab-ecust.cn/pharmmapper/) were used to predict the targets of BAI. Genes associated with melanoma disease were retrieved from the GeneCards (https://www.genecards.org/) database. In these databases, melanoma-related genes were found by searching for “melanoma” and selecting “Homo sapiens” as the species.

Ingredient-target network construction

A Venn diagram (https://bioinformatics.psb.ugent.be/webtools/Venn/) was used to visualize intersecting targets between BAI targets and melanoma targets. The active ingredient-target visualization network was constructed using Cytoscape 3.10.1 (https://cytoscape.org/).

Protein-protein interaction (PPI) network construction

The intersecting targets were imported into STRING 11.5, requiring a minimum network interaction score of 0.9. The PPI network was visualized and evaluated using Cytoscape 3.10.1.

Enrichment analysis

Gene Ontology (GO) enrichment analysis of the potential target genes was performed using the ClueGO plugin in Cytoscape (3.10.1). The top 10 most significantly enriched GO terms were selected for visualization in the figures; if fewer than 10 terms were enriched, all were displayed. Subsequently, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of the targets was conducted using R packages.

Molecular docking

The chemical structure of BAI (molecule number MOL002935) was obtained from TCMSP (http://tcmspnw.com/). The protein structures of EGFR, EZH2, and IL2 were obtained from RCSB PDB (http://www.rcsb.org/pdb/). Interactions of baicalein with EGFR, EZH2, and IL2 were explored using AutoDock Tools 1.5.6 software. Molecular docking results were visualized using PyMOL 2.3.2 software.

Lentiviral infection

The short hairpin RNA (shRNA) targeting EGFR was cloned into the pLVX-shRNA1 vector, while the EGFR overexpression sequence was inserted into the pLVX-IRES-puro vector. oe-negative control (NC) and sh-NC were used as negative controls. All lentiviral constructs were generated by Chongqing BioMedicine Biotechnology Co., Ltd. (Chongqing, China). For transfection, A375 cells were seeded in culture dishes (5×106 cells). For each construct (oe-NC, oe-EGFR, sh-NC, sh-EGFR), 10 µg of plasmid was diluted in 490 µL Opti-MEM (Gibco), gently mixed, and then combined with 30 µL transfection reagent Max (A50516, Gibco). The mixture was added dropwise to the cell culture, and the dishes were gently rocked in a cross pattern to ensure even distribution before being returned to the incubator. After 48 h of incubation, the cells were harvested for subsequent analysis.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted using TRIzon reagent (CW0580S; Cwbio, China), and the concentration and purity of the extract were detected by NanoDrop. Total RNA was converted into complementary DNA (cDNA) using Goldenstar™ RT6 cDNA Synthesis Kit Ver.2 (TSK302M; Tsingke, China). RT-qPCR was performed according to 2× T5 Fast qPCR Mix (SYBR Green I) (TSE202; Tsingke), and the reaction conditions were as follows: 95 ℃ 30 s; 95 ℃ 5 s. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference, and gene expression was calculated by the 2−ΔΔCt method. All the primers of the genes are displayed in Table 1.

Table 1

Primer sequences

Gene name Sequences
EGFR F: TTGCCGCAAAGTGTGTAACG
R: GAGATCGCCACTGATGGAGG
PI3K F: AGATCGCTCTGGCCTCATTG
R: AGCCAGTTCAGAAGGGCATC
AKT F: GCTGAGATTGTGTCAGCCCT
R: CGACCGCACATCATCTCGTA
BCL-XL F: GCCACTTACCTGAATGACCACC
R: AACCAGCGGTTGAAGCGTTCCT
GAPDH F: AATGGGCAGCCGTTAGGAAA
R: GCGCCCAATACGACCAAATC

EGFR, epidermal growth factor receptor; F, forward; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; R, reverse.

Western blot analysis

Total protein was extracted from cells using radioimmunoprecipitation assay (RIPA) lysis buffer (P0013B, Beyotime). The protein samples were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skim milk and subsequently incubated with horseradish peroxidase (HRP)-conjugated primary and secondary antibodies. After washing with Tris-buffered saline with Tween 20 (TBST), the protein signals were detected using an enhanced chemiluminescence (ECL) kit (34096, Thermo, USA) and quantified by densitometric analysis. Cleaved caspase-3 was purchased from Affinity (AF7022, China; 1:1,000), while all other antibodies were obtained from Abclonal (China), including PI3K (A27717; 1:2,500), AKT (A17909; 1:1,000), p-AKT (AP0637; 1:1,000), BCL-XL (A0209; 1:1,000), GAPDH (A19056), and HRP-conjugated goat anti-rabbit IgG (H+L) (AS014; 1:1,000).

Statistical analysis

Statistical analysis of the experimental data was performed using GraphPad Prism 10 software. All experiments were repeated three times. Data are expressed as mean ± standard deviation (SD). Data from multiple groups were analyzed by one-way analysis of variance (ANOVA). P<0.05 was considered statistically significant.


Results

BAI induced apoptosis and suppressed cell proliferation and migration in melanoma cells

To investigate the role of BAI in melanoma, A375 cells were treated with various concentrations of BAI for 24 h. The results showed that BAI reduced the viability of A375 cells in a dose-dependent manner (Figure 1A). Wound healing and Transwell assays were used to evaluate cell migration and invasion capabilities. Compared to the control group, medium- and high-dose BAI treatments significantly inhibited cell migration and invasion (P<0.01; Figure 1B,1C). Additionally, BAI treatment increased the number of TUNEL-positive cells and induced apoptosis in a dose-dependent manner (Figure 1D). In summary, these results demonstrate that BAI exerts anti-tumor effects in melanoma by inhibiting the proliferation and migration of A375 cells, as well as inducing apoptosis.

Figure 1 BAI induced apoptosis and suppressed cell proliferation and migration in melanoma cells. A375 cells were treated with 10, 20, or 40 µM BAI for 24 h. (A) CCK-8 was employed to analyze cell proliferation. (B) Wound healing assays were employed to probe cell migration rates. (C) Transwells were utilized to probe the amount of cell invasion. (D) TUNEL staining assay was used to assess the apoptosis rate. Scale bar =50 µM. Data are presented as mean ± SD. *, P<0.05, **, P<0.01, ***, P<0.001 vs. control; ns represents no statistical significance. BAI, baicalin; CCK-8, cell counting kit-8; DAPI, 4’,6-diamidino-2-phenylindole; SD, standard deviation; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling.

Exploring potential targets of BAI in melanoma treatment based on network pharmacology and molecular docking

To investigate the mechanisms underlying the anti-melanoma effects of BAI, we employed a network pharmacology and molecular docking approach to screen for potential targets, as shown in the flowchart in Figure 2A. First, potential targets of BAI (100 in total) were predicted using the SwissTargetPrediction and PharmaMapper databases, while melanoma-related genes (229 in total) were retrieved from the GeneCards database. Venn diagram analysis identified three overlapping genes (IL2, EZH2, and EGFR) between BAI targets and melanoma-associated genes (Figure 2B), which were defined as potential therapeutic targets of BAI for melanoma treatment. The compound-target interaction network is presented in Figure 2C. The detailed information of the predicted targets is available in Figures S1,S2. To further explore the functional roles of these overlapping targets, GO and KEGG enrichment analyses were performed. GO analysis revealed that these genes were primarily enriched in cancer-related biological processes such as “positive regulation of cell growth”, “regulation of cell population proliferation”, “positive regulation of kinase activity”, and so on (Figure 2D). KEGG pathway analysis indicated significant enrichment in oncogenic signaling pathways, including the “JAK-STAT signaling pathway” and “PI3K-AKT signaling pathway” (Figure 2E).

Figure 2 Exploring potential targets of BAI in melanoma treatment based on network pharmacology and molecular docking. (A) Flowchart for exploring the potential targets of BAI in melanoma treatment based on network pharmacology and molecular docking. (B) Venn diagram between BAI therapeutic targets and melanoma disease targets. (C) Ingredient-target gene network. Blue color represents the drug targets, and red color represents the drug components. (D) Bubble plots for GO enrichment analysis of potential targets. (E) Bubble plots for KEGG enrichment analysis of potential targets. (F) The overall docking structures of EGFR, EZH2, and IL2 with BAI were analyzed, and the corresponding binding energies were evaluated. BAI, baicalin; EGFR, epidermal growth factor receptor; FDR, false discovery rate; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

To identify the key residues mediating the interaction between BAI and the three potential target proteins (IL2, EZH2, and EGFR), molecular docking analysis was performed. The results demonstrated that BAI exhibited relatively high binding affinities for EGFR and EZH2, with docking binding energies of −8.9 kcal/mol and −9.0 kcal/mol, respectively; while its binding affinity for IL2 was relatively weaker, at −6.8 kcal/mol (Figure 2F). Studies have shown that EGFR plays a critical role in melanoma progression. Its overexpression is closely associated with drug resistance in melanoma (19,20). Furthermore, inhibitors targeting EGFR can effectively suppress the proliferation and invasion of Mucosal melanoma by downregulating the PI3K/AKT and MEK/ERK1/2 signaling pathways (21). In addition, inhibition of the EGFR/STAT3 signaling pathway has been shown to promote apoptosis in melanoma cells (22). Based on the significant binding affinity of BAI for EGFR and its key regulatory role in melanoma, we selected EGFR as the core target for subsequent experimental validation.

BAI suppressed EGFR-mediated PI3K/AKT signaling pathway

Based on the molecular docking results, we validated the effect of BAI on EGFR/PI3K/AKT signaling. The results showed that BAI treatment downregulated EGFR, PI3K, and BCL-XL expression at both protein and messenger RNA (mRNA) levels in a dose-dependent manner (Figure 3A,3B). Furthermore, BAI increased the protein expression of the apoptosis marker, cleaved caspase-3 (Figure 3B). These findings demonstrate that BAI inhibits the EGFR-mediated PI3K/AKT signaling pathway.

Figure 3 BAI suppressed EGFR-mediated PI3K/AKT signaling pathway. A375 cells were treated with 10, 20, or 40 µM BAI for 24 h. (A) The mRNA expression of EGFR, PI3K, AKT, and BCL-XL was detected by RT-qPCR. (B) The protein expression of EGFR, PI3K, AKT, p-AKT, BCL-XL, and cleaved caspase-3 was detected by Western blot. Data are presented as mean ± SD. *, P<0.05, **, P<0.01, ***P<0.001 vs. control; ns represents no statistical significance. BAI, baicalin; EGFR, epidermal growth factor receptor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; mRNA, messenger RNA; RT-qPCR, reverse transcription quantitative polymerase chain reaction; SD, standard deviation.

Subsequently, we investigated the oncogenic role of EGFR in melanoma. CCK-8 assays revealed that, compared to the oe-NC or sh-NC groups, oe-EGFR significantly enhanced cell viability (P<0.01), whereas sh-EGFR reduced it (P<0.01; Figure S1A). Furthermore, flow cytometry and TUNEL staining consistently demonstrated that EGFR knockdown increased the proportion of apoptotic A375 cells (Figure S1B,S1C). Mechanistic analysis showed that EGFR knockdown downregulated the expression of EGFR, PI3K, and BCL-XL at both the protein and mRNA levels (Figure S2). Additionally, knockdown of EGFR increased the expression of the apoptotic marker cleaved caspase-3 (Figure S2B). These findings indicate that EGFR plays an oncogenic role in melanoma by promoting PI3K/AKT pathway activation and inhibiting apoptosis. Therefore, we hypothesized that BAI exerts its anti-tumor effects by targeting EGFR.

BAI induced apoptosis in human melanoma A375 cells by targeting the EGFR gene

Network pharmacology analysis predicted EGFR as a potential target of BAI, and EGFR has been previously established as an oncoprotein. We therefore hypothesized that BAI induces apoptosis in melanoma cells by targeting EGFR. To test this, A375 cells were co-treated with BAI and an oe-EGFR. The results showed that EGFR overexpression reduced cellular apoptosis, whereas concurrent BAI treatment counteracted the anti-apoptotic effect induced by EGFR overexpression (Figure 4A,4B). qPCR and Western blot analyses indicated that EGFR overexpression upregulated the expression of EGFR, PI3K, and BCL-XL, while downregulating cleaved caspase-3 (Figure 4C,4D). These effects were partially reversed by BAI (Figure 4C,4D). In conclusion, these results confirm that BAI induces apoptosis in melanoma cells primarily through targeting EGFR.

Figure 4 BAI induced apoptosis in human melanoma A375 cells by targeting the EGFR gene. A375 cells were treated with 40 µM BAI or transfected with EGFR lentiviral vectors. (A) CCK-8 was employed to analyze cell apoptosis rates. (B) Flow cytometry was used to detect apoptosis rates. (C) The mRNA expression of EGFR, PI3K, AKT, and BCL-XL was detected by RT-qPCR. (D) The protein expression of EGFR, PI3K, AKT, p-AKT, BCL-XL, and cleaved caspase-3 was detected by Western blot. Data are presented as mean ± SD. *, P<0.05, **, P<0.01 vs. oe-NC; ##, P<0.01 vs. oe-EGFR; ns represents no statistical significance. BAI, baicalin; CCK-8, cell counting kit-8; EGFR, epidermal growth factor receptor; FITC, fluorescein isothiocyanate-height; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; mRNA, messenger RNA; NC, negative control; PE-H, phycoerythrin-height; RT-qPCR, reverse transcription quantitative polymerase chain reaction; SD, standard deviation.

Discussion

Melanoma represents the most lethal form of skin cancer, with persistently high mortality rates among patients diagnosed at advanced stages (23). The development of novel therapeutic strategies and/or highly effective drugs remains a critical and urgent clinical need (24). Notably, compared to synthetic compounds, monomers derived from traditional Chinese medicine (TCM) represent a valuable resource for discovering new anticancer agents (25). These compounds exhibit higher bioactivity and greater structural diversity, playing an essential role in the treatment of melanoma (26,27). In this study, we demonstrated the anticancer efficacy of BAI against melanoma and used network pharmacology and molecular docking techniques to explore its potential molecular mechanisms. These findings suggest that BAI holds promise as a candidate drug for future melanoma therapy.

Scutellaria baicalensis Georgi is a major TCM herb widely used in the treatment of various diseases (28). BAI is one of its active constituents. Accumulating evidence has demonstrated that BAI exerts potent anti-tumor effects in multiple cancers, including lung, breast, and gastric cancers (29-31). In the present study, we found that BAI inhibited the proliferation, migration, and invasion of melanoma A375 cells in a dose-dependent manner, consistent with previous reports indicating that BAI exerts its anti-cancer effects by suppressing abnormal proliferation and migration of cancer cells (32). Programmed cell death, or apoptosis, is a key mechanism through which melanoma cells can undergo self-destruction (33). However, apoptosis deficiency is commonly observed in melanoma and other tumors (34,35). Cells with impaired apoptosis acquire enhanced migratory and invasive properties both in vitro and in vivo (36). Therefore, inducing apoptosis in cancer cells is a key anti-cancer strategy. Notably, our study also revealed that BAI induced apoptosis in A375 cells in a dose-dependent manner. This pro-apoptotic effect may further contribute to the suppression of migratory phenotypes. Based on these findings, we further investigated the mechanisms through which BAI promotes apoptosis.

In this study, we employed network pharmacology to investigate the anti-cancer mechanisms of BAI and identified three potential therapeutic targets for melanoma: IL2, EZH2, and EGFR. Molecular docking analysis revealed that BAI binds tightly to all three targets. Among them, EGFR is well-known for its significant oncogenic role. As a member of the EGFR family, EGFR plays a crucial role in maintaining normal epithelial tissue function. The EGFR signaling pathway regulates cell proliferation, growth, survival, and differentiation (37). Abnormal expression of the EGFR gene leads to protein overexpression, which contributes to the development of various cancers (38). In melanoma, activation of the EGFR pathway promoted cancer cell proliferation, enhanced glycolysis, and inhibited apoptosis (22). Consistent with these findings, our study demonstrated that knockdown of EGFR suppressed cell viability and induced apoptosis in melanoma cells. Furthermore, we confirmed that EGFR activated the PI3K/AKT pathway, thereby regulating the expression of apoptosis-related proteins: EGFR overexpression inhibited the expression of the pro-apoptotic protein cleaved caspase-3, while promoting the expression of the anti-apoptotic protein BCL-XL. Taken together, these results suggest that EGFR may drive tumor progression in melanoma through the PI3K/AKT-mediated apoptotic pathway. Previous studies have reported that BAI could target EGFR expression (39), a finding corroborated by our experimental results. Furthermore, we demonstrated that overexpression of EGFR reversed the anti-cancer effects of BAI. These results demonstrate that the anti-cancer effects of BAI are mediated through the regulation of the EGFR-dependent PI3K/AKT pathway.

This study has several limitations that suggest directions for future research. First, although we demonstrated that BAI induces apoptosis in melanoma cells by targeting EGFR in vitro, the precise mechanism by which BAI engages EGFR within tumor tissues remains to be elucidated. Second, given the multi-target nature of BAI, the mechanisms through which it modulates other potential targets warrant further in-depth investigation.

The findings of this study demonstrated that BAI inhibited the proliferation, migration, and invasion of melanoma cells in a dose-dependent manner and exerted cytotoxic effects by inducing apoptosis. Mechanistically, BAI promoted apoptosis through targeting the EGFR-mediated PI3K/AKT pathway. Therefore, BAI exhibits potent anti-melanoma activity and represents a promising targeted therapeutic candidate for the treatment of melanoma.


Conclusions

This study demonstrates that BAI effectively inhibits the proliferation, migration, and invasion of melanoma A375 cells while inducing apoptosis by targeting EGFR and suppressing the PI3K/AKT signaling pathway. The findings not only reveal the specific molecular mechanism underlying BAI’s anti-melanoma activity but also provide experimental evidence and a candidate compound for developing natural product-based targeted therapeutic strategies.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2777/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2777/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2777/prf

Funding: This work was supported in part by the Project of the Department of Science and Technology of Yunnan Province (No. 202105AE160004), the Yunnan Provincial Department of Science and Technology-Kunming Medical University Applied Fundamental Research Joint Special Fund Project (No. 202401AY070001-350), and the Yunnan Provincial Department of Science and Technology-Kunming Medical University Applied Fundamental Research Joint Special Fund Project (No. 202101AY070001-140).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2777/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Long GV, Swetter SM, Menzies AM, et al. Cutaneous melanoma. Lancet 2023;402:485-502. [Crossref] [PubMed]
  2. Tímár J, Ladányi A. Molecular Pathology of Skin Melanoma: Epidemiology, Differential Diagnostics, Prognosis and Therapy Prediction. Int J Mol Sci 2022;23:5384. [Crossref] [PubMed]
  3. Huang AC, Zappasodi R. A decade of checkpoint blockade immunotherapy in melanoma: understanding the molecular basis for immune sensitivity and resistance. Nat Immunol 2022;23:660-70. [Crossref] [PubMed]
  4. Li K, Zang X, Meng X, et al. Targeted delivery of quercetin by biotinylated mixed micelles for non-small cell lung cancer treatment. Drug Deliv 2022;29:970-85. [Crossref] [PubMed]
  5. Seedor RS, Orloff M. Treatment of Metastatic Melanoma in the Elderly. Curr Oncol Rep 2022;24:825-33. [Crossref] [PubMed]
  6. Gorry C, McCullagh L, O’Donnell H, et al. Neoadjuvant treatment for stage III and IV cutaneous melanoma. Cochrane Database Syst Rev 2023;1:CD012974. [Crossref] [PubMed]
  7. Tyagi A, Wu SY, Watabe K. Metabolism in the progression and metastasis of brain tumors. Cancer Lett 2022;539:215713. [Crossref] [PubMed]
  8. Yao L, Krasnick BA, Bi Y, et al. Treatment resistance to melanoma therapeutics on a single cell level. Sci Rep 2024;14:21915. [Crossref] [PubMed]
  9. Roskoski R Jr. Properties of FDA-approved small molecule protein kinase inhibitors: A 2024 update. Pharmacol Res 2024;200:107059. [Crossref] [PubMed]
  10. Kumar A, P N, Kumar M, et al. Major Phytochemicals: Recent Advances in Health Benefits and Extraction Method. Molecules 2023;28:887. [Crossref] [PubMed]
  11. Lekhak N, Bhattarai HK. Phytochemicals in Cancer Chemoprevention: Preclinical and Clinical Studies. Cancer Control 2024;31:10732748241302902. [Crossref] [PubMed]
  12. Huang T, Liu Y, Zhang C. Pharmacokinetics and Bioavailability Enhancement of Baicalin: A Review. Eur J Drug Metab Pharmacokinet 2019;44:159-68. [Crossref] [PubMed]
  13. Zhou JQ, Li HJ, Zeng YH, et al. Baicalin induces ferroptosis in HepG2 cells by inhibiting ROS-mediated PI3K/Akt/FoxO3a signaling pathway. Zhongguo Zhong Yao Za Zhi 2024;49:1327-34. [Crossref] [PubMed]
  14. Deng X, Liu J, Liu L, et al. Drp1-mediated mitochondrial fission contributes to baicalein-induced apoptosis and autophagy in lung cancer via activation of AMPK signaling pathway. Int J Biol Sci 2020;16:1403-16. [Crossref] [PubMed]
  15. Kong N, Chen X, Feng J, et al. Baicalin induces ferroptosis in bladder cancer cells by downregulating FTH1. Acta Pharm Sin B 2021;11:4045-54. [Crossref] [PubMed]
  16. Guo L, Yue M, Ma C, et al. Baicalin reduces inflammation to inhibit lung cancer via targeting SOCS1/NF-κB/STAT3 axis. Heliyon 2024;10:e29361. [Crossref] [PubMed]
  17. Li J, Liu H, Lin Q, et al. Baicalin suppresses the migration and invasion of breast cancer cells via the TGF-β/lncRNA-MALAT1/miR-200c signaling pathway. Medicine (Baltimore) 2022;101:e29328. [Crossref] [PubMed]
  18. Huang L, Peng B, Nayak Y, et al. Corrigendum: Baicalein and Baicalin Promote Melanoma Apoptosis and Senescence via Metabolic Inhibition. Front Cell Dev Biol 2022;10:876000. [Crossref] [PubMed]
  19. Wang M, Cao Y, Ren C, et al. PTRF Confers Melanoma-Acquired Drug Resistance Through the Upregulation of EGFR. Cell Prolif 2026;59:e70086. [Crossref] [PubMed]
  20. Pastwińska J, Karaś K, Karwaciak I, et al. Targeting EGFR in melanoma - The sea of possibilities to overcome drug resistance. Biochim Biophys Acta Rev Cancer 2022;1877:188754. [Crossref] [PubMed]
  21. Simiczyjew A, Wądzyńska J, Kot M, et al. Combinations of EGFR and MET inhibitors reduce proliferation and invasiveness of mucosal melanoma cells. J Cell Mol Med 2023;27:2995-3008. [Crossref] [PubMed]
  22. Zhong Z, Zhong H. KIF22 promotes the proliferation and glycolysis of melanoma by activating EGFR/STAT3 signaling. Clinics (Sao Paulo) 2023;78:100307. [Crossref] [PubMed]
  23. Bobos M. Histopathologic classification and prognostic factors of melanoma: a 2021 update. Ital J Dermatol Venerol 2021;156:300-21. [Crossref] [PubMed]
  24. Li C, Kuai L, Cui R, et al. Melanogenesis and the Targeted Therapy of Melanoma. Biomolecules 2022;12:1874. [Crossref] [PubMed]
  25. Miao K, Liu W, Xu J, et al. Harnessing the power of traditional Chinese medicine monomers and compound prescriptions to boost cancer immunotherapy. Front Immunol 2023;14:1277243. [Crossref] [PubMed]
  26. Wang Q, Zhou X, Yang L, et al. The Natural Compound Notopterol Binds and Targets JAK2/3 to Ameliorate Inflammation and Arthritis. Cell Rep 2020;32:108158. [Crossref] [PubMed]
  27. Liu J, Jiang R, Zhou J, et al. Salicylic acid in ginseng root alleviates skin hyperpigmentation disorders by inhibiting melanogenesis and melanosome transport. Eur J Pharmacol 2021;910:174458. [Crossref] [PubMed]
  28. Zhao T, Tang H, Xie L, et al. Scutellaria baicalensis Georgi. (Lamiaceae): a review of its traditional uses, botany, phytochemistry, pharmacology and toxicology. J Pharm Pharmacol 2019;71:1353-69.
  29. Yuan J, Khan SU, Yan J, et al. Baicalin enhances the efficacy of 5-Fluorouracil in gastric cancer by promoting ROS-mediated ferroptosis. Biomed Pharmacother 2023;164:114986. [Crossref] [PubMed]
  30. Jia Q, Zhou Y, Song L, et al. Baicalin reduces chronic stress-induced breast cancer metastasis via directly targeting β2-adrenergic receptor. J Pharm Anal 2024;14:100934. [Crossref] [PubMed]
  31. Dong X, Liu X, Lin D, et al. Baicalin induces cell death of non-small cell lung cancer cells via MCOLN3-mediated lysosomal dysfunction and autophagy blockage. Phytomedicine 2024;133:155872. [Crossref] [PubMed]
  32. Capó X, Kumar R, Mishra AP, et al. Baicalein and baicalin in cancer therapy: Multifaceted mechanisms, preclinical evidence, and translational challenges. Semin Oncol 2025;52:152377. [Crossref] [PubMed]
  33. Piskorz WM, Krętowski R, Cechowska-Pasko M. Marizomib Promotes Senescence or Long-Term Apoptosis in Melanoma Cancer Cells. Molecules 2024;29:5652. [Crossref] [PubMed]
  34. Avola R, Graziano ACE, Madrid A, et al. Pholiotic acid promotes apoptosis in human metastatic melanoma cells. Chem Biol Interact 2024;390:110894. [Crossref] [PubMed]
  35. Lee BS, Kang SU, Huang M, et al. OTUB1 knockdown promotes apoptosis in melanoma cells by upregulating TRAIL expression. BMB Rep 2021;54:608-13. [Crossref] [PubMed]
  36. Berthenet K, Castillo Ferrer C, Fanfone D, et al. Failed Apoptosis Enhances Melanoma Cancer Cell Aggressiveness. Cell Rep 2020;31:107731. [Crossref] [PubMed]
  37. Zubair T, Bandyopadhyay D. Small Molecule EGFR Inhibitors as Anti-Cancer Agents: Discovery, Mechanisms of Action, and Opportunities. Int J Mol Sci 2023;24:2651. [Crossref] [PubMed]
  38. Levantini E, Maroni G, Del Re M, et al. EGFR signaling pathway as therapeutic target in human cancers. Semin Cancer Biol 2022;85:253-75. [Crossref] [PubMed]
  39. Lu Q, Liu X, Tian J, et al. Baicalin Alleviates ADAM17/EGFR Axis-Induced Peritonitis in Weaned Piglets Infected by Glaesserella parasuis. Animals (Basel) 2025;15:2457. [Crossref] [PubMed]
Cite this article as: He Z, Huang A, Lv J, Zhou J, Lou W, Xu B, Wu X. A network pharmacology and molecular docking approach to investigate the anticancer mechanism of baicalin against melanoma through induction of apoptosis via EGFR-mediated PI3K/AKT pathway. Transl Cancer Res 2026;15(5):378. doi: 10.21037/tcr-2025-1-2777

Download Citation