COL10A1 overexpression potentially contributes to poor outcomes in breast cancer via autophagy and vasculogenic mimicry
Original Article

COL10A1 overexpression potentially contributes to poor outcomes in breast cancer via autophagy and vasculogenic mimicry

Liu Gao1,2,3#, Jingrui Yang4#, Xinru Fan2#, Yu Ling5, Xu Jiang2,6, Xin Jin7, Hui Xu2,6, Yunzhi Ling8, Li Yu1,2,6

1Anhui Provincial Key Laboratory of Tumor Evolution and Intelligent Diagnosis and Treatment, Bengbu Medical University, Bengbu, China; 2Key Laboratory of Cancer Research and Clinical Laboratory Diagnosis, School of Laboratory Medicine, Bengbu Medical University, Bengbu, China; 3Clinical Medicine School, Bengbu Medical University, Bengbu, China; 4Department of Blood Transfusion, the First Hospital of Jiaxing, Jiaxing, China; 5Science in Innovation in Health and Social Well-Being, Hong Kong Baptist University, Hong Kong, China; 6Department of Transfusion, School of Laboratory Medicine, Bengbu Medical University, Bengbu, China; 7Department of Surgical Oncology, the First Affiliated Hospital of Bengbu Medical University, Bengbu, China; 8Department of Anesthesiology, the First Affiliated Hospital of Bengbu Medical University, Bengbu, China

Contributions: (I) Conception and design: L Gao, J Yang, L Yu; (II) Administrative support: X Fan, X Jiang, H Xu, Li Yu, Y Ling; (III) Provision of study materials or patients: L Yu, Y Ling, X Jin; (IV) Collection and assembly of data: L Gao, J Yang, X Fan, Y Ling; (V) Data analysis and interpretation: L Gao, L Yu, Y Ling; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

#These authors contributed equally to this work.

Correspondence to: Li Yu, MS. Anhui Provincial Key Laboratory of Tumor Evolution and Intelligent Diagnosis and Treatment, Bengbu Medical University, No. 2600 Donghai Avenue, Bengbu 233030, China; Key Laboratory of Cancer Research and Clinical Laboratory Diagnosis, School of Laboratory Medicine, Bengbu Medical University, Bengbu 233030, China; Department of Transfusion, School of Laboratory Medicine, Bengbu Medical University, Bengbu 233030, China. Email: 0600049@bbmc.edu.cn; Yunzhi Ling, MD. Department of Anesthesiology, the First Affiliated Hospital of Bengbu Medical University, No. 287 Changhuai Road, Longzihu District, Bengbu 233004, China. Email: 1390270642@qq.com.

Background: Although the in-depth study of breast cancer pathogenesis has led to progress in therapies and improved outcomes in recent decades, new treatment methods are needed, especially for incurable metastatic breast cancer. Studies have proven that collagen X alpha 1 chain (COL10A1) expression is elevated in various malignant tumors, but COL10A1 has not been systematically analyzed in breast cancer. We investigated the effects of COL10A1 on breast cancer development and the mechanisms involved.

Methods: We analyzed COL10A1 expression through the cancer database, and collected serum and tumour tissue specimens from patients with breast cancer to evaluate COL10A1’s expression and correlation with clinicopathology. COL10A1 expression in breast cancer cell lines was assessed at the cellular level, and stable transient cell lines were constructed for autophagy examination in breast cancer cells using immunofluorescence and Western blotting. Tubulation assay and Western blotting were used to detect changes in vasculogenic mimicry (VM). Different experiments evaluated COL10A1’s effects on breast cancer cell proliferation, migration, and invasiveness. A subcutaneous transplantation nude mouse tumor model was constructed, and changes in tumor volume and mass were recorded, while changes in the expression of vascular growth mimetic genes were examined using Western blotting.

Results: Analysis of The Cancer Genome Atlas (TCGA) and Gene Expression Profiling Interactive Analysis (GEPIA) databases revealed COL10A1 upregulation in different breast cancer subtypes. Kaplan-Meier Plotter analysis showed that patients with elevated COL10A1 expression had poorer survival. Clinical tests found that COL10A1 expression in tumor specimens from patients with breast cancer was significantly higher than in controls and was closely associated with clinicopathology features, such as histological grading, tumor-node-metastasis (TNM) stage, and distant lymph node metastasis. Western blot analysis and other experiments revealed that low COL10A1 expression inhibited autophagy and VM in breast cancer cells, which inhibited breast cancer proliferation, apoptosis, migration, and invasion. High COL10A1 expression had opposite effects. Animal experiments showed that tumors from the high COL10A1 expression group were significantly larger than those from the control group.

Conclusions: COL10A1 may be involved in breast cancer cell proliferation, apoptosis, invasion and migration, which are related to autophagy and VM, suggesting that COL10A1 may serve as a novel target for clinical breast cancer therapy.

Keywords: Breast cancer; Collagen X alpha 1 chain (COL10A1); autophagy; angiogenic mimicry


Submitted Oct 02, 2025. Accepted for publication Apr 12, 2026. Published online May 27, 2026.

doi: 10.21037/tcr-2025-aw-2165


Highlight box

Key findings

• Our findings suggest that Collagen X alpha 1 chain (COL10A1) regulation of breast cancer cell proliferation, apoptosis, invasion, and migration may be related to autophagy and vascular mimicry, supporting COL10A1 as a potential novel target for breast cancer therapy.

What is known and what is new?

• By far, COL10A1 is abnormally expressed in multiple solid tumors and is involved in tumor progression; autophagy and vasculogenic mimicry (VM) are key biological processes promoting cancer growth and metastasis, and are potential therapeutic targets for cancer.

• This study is the first to systematically clarify the expression pattern and clinical significance of COL10A1 in breast cancer, and confirm that COL10A1 acts as an oncogene to regulate breast cancer cell malignant behaviors by modulating autophagy and vasculogenic mimicry, providing a new candidate biomarker and therapeutic target for clinical breast cancer prognosis assessment and treatment.

What is the implication, and what should change now?

• Follow-up studies should focus on exploring the specific signaling pathways by which COL10A1 regulates autophagy and VM in breast cancer, and developing specific inhibitors targeting COL10A1 to verify their anti-breast cancer efficacy in preclinical models.


Introduction

Breast cancer is the most prevalent malignancy globally and a leading cause of cancer-related deaths among women. According to the latest Global Cancer Statistics 2023 (1), there were approximately 2.3 million new breast cancer cases and 685,000 deaths worldwide in 2023, with metastatic breast cancer accounting for over 90% of cancer-related deaths. In 2022, approximately 357,200 new female breast cancer cases and 75,000 deaths occurred in China, accounting for 15.59% and 7.94% of total new cancer cases and deaths, respectively (2). With the popularization of large-scale population cancer screening projects, some breast cancer patients can be diagnosed at an early stage and achieve favorable outcomes through surgery combined with adjuvant therapies such as chemotherapy, radiotherapy, and targeted therapy. However, approximately 40% of early breast cancer patients will eventually develop metastatic disease, and the prognosis for metastatic breast cancer is dismal, constituting over 90% of BC-related mortality (3). Therefore, it is of great significance to further elucidate the molecular mechanisms underlying breast cancer progression and identify novel prognostic biomarkers and therapeutic targets.

The collagen X alpha 1 chain (COL10A1), known as a member of the collagen family, encodes a secreted, short-chain collagen and is involved in tissue architecture (4). It is a major interstitial matrix component that typically exists during embryonic skeletal development (5). COL10A1 participates in cell growth, differentiation, apoptosis, migration, endochondral bone formation, and bone marrow formation. The mutation and abnormal expression of COL10A1 are usually related to bone diseases such as osteoarthritis and chondrocyte hypertrophy (6,7). In recent years, plenty of studies have revealed that COL10A1 is highly expressed in multiple solid cancers, including gastric, colorectal, pancreatic adenocarcinoma etc. (7-9). However, the systematic analysis of COL10A1 regulation in breast cancer remains poorly understood.

Autophagy is a process in which cells maintain their survival by degrading and reusing harmful substances and damaged structures within the cell (10,11). The activation of autophagy can provide additional nutrition and energy, thus enhancing the viability of cancer cells and promoting the growth and progression of tumors (12,13). Vasculogenic mimicry (VM) is an indispensable part of tumor development, providing oxygen and nutrients to the tumor. The enhancement of angiogenesis provides a favorable environment for tumor growth and metastasis, while also increasing the invasive ability of tumors (14,15).

Thus, in the present study, we aimed to investigate the potential mechanisms by which COL10A1 regulates tumor progression and its prognostic role in breast cancer. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2165/rc).


Methods

Bioinformatics analysis

We explored COL10A1’s role in breast cancer by analyzing data from the public databases, Gene Expression Profiling Interactive Analysis (GEPIA2; http://gepia2.cancer-pku.cn), The Cancer Genome Atlas (TCGA; https://portal.gdc.cancer.gov) (16) and Genotype-Tissue Expression (GTEx; http://commonfund.nih.gov/GTEx/), for COL10A1 expression in various cancer types and paired normal tissues, as well as in normal vs. breast cancer tissues. Based on COL10A1 expression, survival analysis, and the relationship between COL10A1 and pathological indicators were conducted. Receiver operating characteristic (ROC) curves were predicted for COL10A1, and the relationship between COL10A1 and immune infiltration was also assessed.

Clinical tissue collection

Thirty tumor tissues and paired paracancerous tissues collected from female patients with breast cancer, who had undergone surgery at the First Affiliated Hospital of Bengbu Medical College, underwent real-time quantitative polymerase chain reaction (RT-qPCR) and immunohistochemistry (IHC). The clinicopathological data of the patients were collected, including mass size, histological grading, tumor-node-metastasis (TNM) staging, distant lymph node metastasis, and the expression of estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor-2 (HER-2), and Ki67. The inclusion criteria were: (I) definite breast cancer diagnosis by the department of pathology; (II) no history of chemotherapy, radiotherapy, or targeted therapy; and (III) informed consent from patients and their families. The exclusion criteria were: (I) simultaneously suffering from other cancer types; (II) having a serious condition, e.g., heart, liver, lung, kidney, brain condition, or mental condition; and (III) distant organ metastases. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. This study was approved by the Ethics Committee of Bengbu Medical College, as per the relevant medical ethical requirements (approval No. [2023]239) and informed consent was taken from all individual participants.

Cell culture

BT-549 and MDA-MB-231 cell lines were purchased from Procell Life Science & Technology. MCF-7 and MCF-10A were stored by our research center. All cells were cultured in RPMI-1640 (Gibco, 11875093, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Clark, FB15015, Houston, TX, USA) and 100 U/mL penicillin/streptomycin (Beyotime, C0222, Shanghai, China) at 37 ℃ in a 5% CO2 incubator. We treated all the cell lines with 0.1 µg/mL Mycoplasma Removal Agent (MRA) (MP Biomedicals, 093050041, Shanghai, China) according to the manufacturer’s recommendation to confirm the absence of mycoplasma contamination.

Transduction

The lentiviral vectors HBLV-CMV-COL10A1-3FLAG-ZsGreen-PURO (Lv-COL10A1, containing human COL10A1 CDS, RefSeq: NM_000493.3), HBLV-CMV-empty-ZsGreen-PURO (Lv-NC, empty vector control), HBLV-U6-shCOL10A1-ZsGreen-PURO (Lv-shCOL10A1, targeting sequence: 5'-CCAAGACACAGTTCTTCAT-3'), and HBLV-U6-shNC-ZsGreen-PURO (Lv-shNC, scrambled sequence: 5'-TTCTCCGAACGTGTCACGTAA-3') were designed and synthesized by Hanbio (Shanghai, China). Detailed construct information: For overexpression, the full-length COL10A1 coding sequence (2,148 bp) was inserted into the EcoRI/BamHI sites of pHBLV-CMV-MCS-3FLAG-EF1-ZsGreen-T2A-PURO vector (10,993 bp), generating a C-terminal 3×FLAG-tagged fusion protein. For knockdown, the shRNA oligonucleotides were cloned into the BamHI/EcoRI sites of pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector (8,991 bp). BT-549 and MCF-7 cells were seeded in 24-well plates and cultured to a confluence of about 70–80% before transduction with Lv-NC, Lv-COL10A1, Lv-shNC, and Lv-shCOL10A1 using GP-transfect-Mate (GenePharma, 04009, Shanghai, China) according to the manufacturer’s instructions, and cultured overnight. The amount of virus added was calculated based on the MOI value. The lentiviral transduction was performed at a multiplicity of infection (MOI) of 10 for BT-549 and a MOI of 20 for MCF-7 in this study. The medium was replaced with fresh complete medium on the second day, followed by culture at 37 ℃. After 48 hours, fluorescent expression efficiency was observed under a fluorescence microscope. Stably transduced cells were selected using puromycin (final concentration: l µg/mL, Hanbio, HB-PU-500, shanghai, China). After the cells were fully grown, they were transferred into a culture bottle or dish for further culture.

RT-qPCR

Total RNA was extracted according to the instructions (Vazyme, R401-01, Nanjing, China). All consumables used for RNA extraction were treated to be RNase-free. Samples that were fully lysed with RL were transferred to a purification column and centrifuged at 12,000 r/min for 30 seconds (minimax17, KeCheng Centrifuge, Changsha, China). The flow-through was collected, mixed with ethanol, and then loaded onto a new purification column. After centrifugation, the flow-through was discarded, and RW1 and RW2 were added sequentially. Next, 50 µL of ddH2O (62 ℃) was added to the column and centrifuged for RNA elution. Spectrophotometer (DS-11, DeNoVIX, America) was used to determine RNA concentration and purity. The reverse transcription system (Vazyme, R323-01, Nanjing, China) was prepared according to the instructions, and the obtained cDNA was diluted twice with DEPC water and stored at −80 ℃. RT-qPCR was performed in a reaction volume of 20 µL/well (Vazyme, Q711-02/03, Nanjing, China), including 0.4 µL of forward and reverse primers, 10 µL of 2× AceQ, 2 µL of cDNA, and 7.2 µL of ddH2O using the following program: pre-denaturation at 95 ℃ for five minutes, denaturation at 95 ℃ for 10 seconds, cool down at 1.6 ℃/s, annealing at 60 ℃ for 30 seconds, heat up at 1.6 ℃/s, and extension at 72 ℃ for 15 seconds, for 40 cycles. QuantStudio Design&Nailsis Software (v1.4) was used for analysis. The relative expression level of COL10A1 was calculated using the 2−∆∆Ct method. The primer sequences are shown in Table 1.

Table 1

Sequences of primers used for real-time PCR

Gene Forward (5'-3') Reverse (5'-3')
COL10A1 AAGAATGGCACCCCTGTAATGT ACTCCCTGAAGCCTGATCCA
GAPDH AACGGATTTGGTCGTATTGGG TCGCTCCTGGAAGATGGTGAT

PCR, polymerase chain reaction.

3-(4,5-Dimethyl-2-thiazolyl)-2-5-diphenyl-2H-terazolium bromide (MTT) assay

Transduced cells (1×104 cells/mL) were seeded into 96-well plates (100 µL/well, five wells per group) and incubated for 4 hours to allow cell adhesion. After 0, 24, 48, and 72 hours, MTT (20 µL) was added and mixed well, followed by incubation for four hours. The yellow liquid was then removed, DMSO (200 µL) added, and the plates were wrapped with tin foil and shaked for 10 minutes to dissolve crystals. Optical density was then measured at a wavelength of 450 nm.

Clonal formation assay

Transduced BT-549 and MCF-7 cells were seeded in six-well plates (1,500 cells/well) and incubated for 2–3 weeks with media changes until large colonies were visible. After washing twice with phosphate buffer saline (PBS), they were fixed with 4% paraformaldehyde for 30 minutes, stained with 0.5% crystal violet for 20 minutes, and the colony numbers were counted.

Wound healing assay

Transduced cells were seeded in six-well plates (5×105 cells/well) and inoculated in good condition. Two straight scratches were made in each well using a 10-µL pipette tip, followed by washing with PBS until the scratch area had no floating cells observable under a microscope (Olympus, IX71, Tokyo, Japan). Images (100×) were taken using an inverted microscope at the 0- and 24-hour timepoints. The scratch width was measured using ImageJ. The wound healing rate was determined as follows: (scratch width at 0 hour − scratch width at 24 hours) / scratch width at 0 hour.

Transwell assay

The invasion and migration experiments were conducted similarly, the difference being that the invasion experiment required uniform Matrigel (Nest, 211222, Jiangsu, China) addition to the upper chamber in advance and incubation at 37 ℃ for one hour to solidify the Matrigel. Transduced cells were suspended in serum-free culture medium at a density of 1.5×105 cells/mL, and 100 µL were seeded into the upper Transwell chamber, while 600 µL of culture medium containing 10% fetal bovine serum (FBS) was added to the lower chamber. After incubation at 37 ℃ for 24 hours, the migrated cells (on the lower surface of the membrane) were fixed with paraformaldehyde (40 g/L) for 30 minutes, and stained with crystal violet (1 g/L) for 10 minutes. Migrating and invading cells on the lower surface of the chamber were imaged under a microscope (Olympus, IX71, Japan) and counted in three randomly selected fields for analysis.

Apoptosis analysis

Transduced cells were collected, washed twice with PBS, and resuspended in 400 µL of Annexin V-FITC binding buffer (Bestbio, BB4101, Shanghai, China). After transfer into flow tubes, the cells were incubated with 5 µL Annexin V (Bestbio, BB4101, Shanghai, China) and 5 µL propidium iodide (PI) (Bestbio, BB4101, Shanghai, China). The cell suspension was filtered through a cell strainer to remove cell clumps and incubated on ice in the dark for 30 minutes, followed by apoptosis evaluation using flow cytometry (Cytek, America) within 30 minutes.

Cell cycle assay

Transduced cells were harvested via trypsinization and fixed overnight in precooled 70% ethanol at 4 ℃ in a refrigerator. After washed with PBS, resuspended, and then incubated with 2 µL of RNase A (1 mg/mL) and 50 µL of propidium iodide (100 µg/mL) for 30 minutes at 37 ℃ in the dark. Analysis of cell cycle distribution was performed using a flow cytometer, and the percentage of cells in each phase was determined with FlowJo_V10 software (BD Biosciences).

Immunofluorescence assay

Transduced cells were collected and seeded in confocal dishes. After incubation, cells were fixed with precooled methanol for 20 minutes, permeabilized with 0.3% Triton-100 for 20 minutes, and blocked with bovine serum albumin (BSA) (10 g/L) for one hour. After incubated with rabbit anti-LC3A/B antibody (1:500, Cell Signaling, 4108S, America) at 4 ℃ overnight, then cells were incubated (in the dark, at room temperature) with coraLite594-conjugated goat anti-rabbit IgG (1:500, proteintech, sa00013-4, America) for two hours and subsequently counterstained with 4’,6-diamidino-2’-phenylindole (DAPI) (biosharp, BL105A, Jiangsu, China). Images were captured under a fluorescence microscope (Zeiss, Germany). The quantitatively detected number of fluorescent spots reflects the quantity of autophagosomes (17). Valid fluorescent signals were defined as discrete puncta with intensity 2-fold higher than the background fluorescence (measured using the ImageJ software’s signal-to-noise ratio analysis tool) and localized within the cellular boundaries. Only signals meeting this threshold were counted as specific autophagosome-associated fluorescence.

Matrigel tube formation assay

Add Matrigel to each well in a 24-well plate and incubate at 37 ℃ to solidify the Matrigel to form a gel layer. Add 800 µL of medium containing 2.5×106 breast cancer cells. Tube formation was observed after culturing for 6 hours and the images were captured under an inverted microscope.

Western blot analysis

Tissue samples and cells were lysed using RIPA buffer (Beyotime, P0013B, Shanghai, China) supplemented with a protease inhibitor (Sigma Aldrich, 329-98-6, America), separated using 12% or 7.5% SDS-PAGE gel (Epizyme Biotech, PG112, Shanghai, China) electrophoresis and then transferred onto polyvinylidene fluoride membranes (Immobilon Millipore, IPVH00010, Meck, Germany). The membranes were then blocked with 5 % skimmed milk for one hour and incubated with primary antibodies against COL10A1, P62, Beclin1, LC3A/B, VE-cadherin, LAMC2, MMP2, and β-actin at 4 ℃ overnight. They were then incubated with a HRP-conjugated secondary antibody for two hours at room temperature. The signal was developed using an enhanced chemiluminescence kit (biosharp, BL520A, China). Protein expression was analyzed using Image J, with β-actin serving as the loading control. Relative expression (sample) = normalized value (sample)/average normalized value (control group) (18). All antibodies used for Western blot analysis are summarized in Table 2.

Table 2

All antibodies used for Western blot

Antibody name Source Catalog No. Working dilution
COL10A1 ABclonal, Wuhan, China A18604 1:1,000
P62 Proteintech, Wuhan, China 18420-1-AP 1:1,000
Beclin1 Proteintech, Wuhan, China 11306-1-AP 1:1,000
LC3A/B Proteintech, Wuhan, China 14600-1-AP 1:1,000
VE-cadherin Proteintech, Wuhan, China 27956-1-AP 1:1,000
LAMC2 Proteintech, Wuhan, China 19698-1-AP 1:1,000
MMP2 Proteintech, Wuhan, China 10373-2-AP 1:1,000
β-actin Proteintech, Wuhan, China 66009-1-Ig 1:1,000
HRP-conjugated Goat Anti-Rabbit IgG Proteintech, Wuhan, China SA00001-2 1:5,000

IHC

Paraffin-embedded tissue sections were deparaffinized and rehydrated using graded alcohol. They were then incubated in 3% H2O2 to block endogenous peroxidase activity, followed by antigen retrieval by boiling in sodium citrate (pH 6.0) in a microwave oven. Next, they were blocked with 5% BSA (Bio FROXX, 4240GR025, Einhausen, Germany) at 37 ℃ for 60 minutes and then incubated with primary antibody against COL10A1 (diluted 1:100, Affinity Biologicals, DF 13214, Kitchener, Canada) at 4 ℃ overnight. They were then incubated with secondary antibody (diluted 1:1,000, abcam, ab205718, Cambridge, England) for 30 minutes at room temperature, and the signal was developed using the substrate-chromogen solution DAB (ZSGB-BIO, ZLI-9017, Beijing, China), with counterstaining using hematoxylin (Beyotime, C0107, Shanghai, China). The staining intensity results and percentage of positive tumor cells were evaluated and scored by two pathologists independently (17).

Subcutaneous tumor formation in nude mice

All animal experiments were performed under a project license (approval No. [2023]655) granted by the Ethics Committee of Bengbu Medical College, in accordance with the institutional guidelines for the care and use of animals. Twelve female BALB/ca-nu nude mice (4–5 weeks old, 18–20 g) were purchased from Hefei Qingyuan Biotechnology and fed in SPF grade laboratory animal centers. After numbering nude mice [1–12], a uniform distribution random number was generated using SPSS software. The first 6 mice were included in the control group, and the last 6 mice were included in the COL10A1 overexpression group. Similar studies on breast cancer xenograft models typically use 3–6 mice per group to ensure sufficient statistical power for detecting differences in tumor growth or metastasis. Transduced cells (6×107/mL in 0.2 mL) were subcutaneously injected into the right flank of nude mice, which were continued on normal feeding. When tumors were visible to the naked eye, their volume was monitored and recorded every three days, and a tumor growth curve was plotted. After 21 days, the tumors were removed and weighed. Western blotting was used to examine COL10A1, P62, LC3A/B, VE-cadherin, LAMC2, and MMP2 protein levels in the tumors, while IHC was used to analyze LC3A/B and VE-cadherin expression.

Statistical analysis

All experiments were performed in at least three independent biological replicates. Data were analyzed using GraphPad Prism 8.0 (GraphPad Software, Boston, MA, USA), and presented as mean ± standard deviation (SD). Non-normally distributed data were analyzed using nonparametric analysis and recorded as medians (P25, P75) [M (P25, P75)]. The Mann-Whitney U test is used to compare the distributions of two independent samples and is particularly suitable when the data do not follow a normal distribution. The Student’s t-test is used to compare the means of two independent samples. ROC curves were drawn, and the area under the curve was calculated. *P<0.05 indicates statistically significant differences, with *, **, and *** indicating P<0.05, <0.01, and <0.001, respectively.


Results

Bioinformatic COL10A1 prediction in breast cancer

Bioinformatics analysis on GEPIA revealed that compared with corresponding normal tissues, COL10A1 mRNA expression was higher in many types of solid tumors, such as breast invasive carcinoma, cholangiocarcinoma, esophageal carcinoma, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, pancreatic adenocarcinoma, and stomach adenocarcinoma (Figure 1). We also explored COL10A1 levels in breast cancer tumors vs. normal tissues in the TCGA and TCGA + GTEx databases (Figure 2A,2B), and found that COL10A1 was strongly elevated in paired breast cancer tumors when compared with normal tissues in TCGA (Figure 2C). The relationship between COL10A1 and pathological N-stage, PR, ER, and HER-2 was evaluated. Increased COL10A1 levels were observed in patients with breast cancer positive nodal status (N1–N3) than in those with a negative nodal status. PR, ER, and HER-2 status were positively associated with COL10A1 expression (Figure 2D-2G). Kaplan-Meier plotter analysis of overall survival (OS) and disease-specific survival (DSS) revealed that the COL10A1 levels were significantly negatively correlated with poor prognosis (Figure 2H,2I). Further investigation of COL10A1’s role in breast cancer prognosis using ROC curve analysis revealed that for breast cancer diagnosis, COL10A1’s area under the ROC curve was 0.989 (95% confidence interval: 0.985–0.994, Figure 2J). The results of the differences and correlation between COL10A1 expression and tumor-infiltrating immune cells showed that 20 tumor-infiltrating immune cells correlated significantly with COL10A1 expression. Among them, mast cells, macrophages, and NK cells correlated positively with COL10A1 expression. NK CD56-bright cells, dendritic cell (DC), cytotoxic cells, activated dendritic cell (aDC), plasmacytoid dendritic cell (pDC), and B cells correlated negatively with COL10A1 expression (Figure 2K).

Figure 1 Bar plot of COL10A1 expression profile across different tumor samples and paired normal tissues based on GEPIA database analysis. COL10A1, Collagen X alpha 1 chain; GEPIA, Gene Expression Profiling Interactive Analysis.
Figure 2 Bioinformatic analysis of COL10A1. (A) COL10A1 expression in breast cancer tumors vs. normal tissues in TCGA. (B) COL10A1 expression in breast cancer tumors vs. normal tissues in TCGA + GTEx. (C) COL10A1 expression in paired tumors vs. normal tissues in TCGA. (D-G) The relationship between COL10A1 and pathological N-stage, PR, ER, and HER-2. (H,I) The relationship between COL10A1 and OS and DSS. (J) ROC curve predicted by COL10A1. (K) The relationship between COL10A1 and immune infiltration (vs. control: *P<0.05, **P<0.01, ***P<0.001). AUC, area under the curve; COL10A1, collagen X alpha 1 chain; DSS, disease-specific survival; ER, estrogen receptor; FPR, false positive rate; GTEx, Genotype-Tissue Expression; HER-2, human epidermal growth factor receptor-2; N, node; ns, not significance; OS, overall survival; PR, progesterone receptor; ROC, receiver operating characteristic; TCGA, The Cancer Genome Atlas; TPM, transcripts per million; TPR, true positive rate.

COL10A1 expression is upregulated in breast cancer tissues

RT-qPCR analysis of 30 paired breast cancer tissues and para-carcinoma tissues revealed high COL10A1 expression in breast cancer tissues when compared with corresponding para-carcinoma tissues (Figure 3A). Moreover, we observed a correlation between COL10A1 levels and tumor progression. As shown in Table 3, COL10A1 expression levels were found to be significantly associated with histological grade, TNM stage, and distant lymph node metastasis in breast cancer. Patients with histological Grade III, advanced TNM stage (III–IV), or lymph node metastasis exhibited higher COL10A1 expression compared to those with lower-grade tumors (Grade I–II), early-stage disease (TNM stage I–II), or no lymph node involvement. However, there were no significant differences between COL10A1 expression and age, tumor size, ER, PR, HER-2, and Ki67. COL10A1 expression was further validated using IHC staining (Figure 3B,3C). Scoring COL10A1 levels based on staining intensity showed that the staining score of breast cancer tissues was much higher than in corresponding normal tissues.

Figure 3 COL10A1 expression is upregulated in breast cancer tissues. (A) Quantitative PCR of relative COL10A1 expression in cancer and paracancerous tissues from 30 patients with breast cancer. (B) Representative images of COL10A1 staining in patients with breast cancer (IHC staining). (C) Average IHC COL10A1 staining score analysis. ** and **** indicate P<0.01 and P<0.0001 compared with the paracancerous tissue group. COL10A1, collagen X alpha 1 chain; IHC, immunohistochemistry; PCR, polymerase chain reaction.

Table 3

Relationship between COL10A1 expression and clinical data in breast cancer patients

Clinical parameters n Relative expression of COL10A1 P value
Age (years) 0.13
   ≤60 14 0.8554 (0.0396, 3.1740)
   >60 16 1.0730 (0.2688, 3.8100)
Tumor size (cm) 0.47
   <5 25 0.9615 (0.0758, 3.3730)
   ≥5 5 1.0920 (0.7158, 4.1830)
Histological grading 0.04*
   I–II 18 0.8477 (0.1256, 1.7550)
   III 12 1.9990 (0.3080, 5.5890)
TNM staging 0.0005**
   I–II 12 0.8235 (0.0372, 1.1590)
   III–IV 18 1.4650 (0.2046, 6.0270)
Lymph node metastasis <0.0001**
   Negative 17 0.8235 (0.0431, 1.2790)
   Positive 13 2.9290 (0.7906, 7.6230)
ER 0.06
   Negative 6 0.6258 (0.0415, 1.1140)
   Positive 24 1.1010 (0.1414, 5.3030)
PR 0.57
   Negative 8 0.9449 (0.1591, 2.8530)
   Positive 22 1.0910 (0.1256, 4.7500)
HER-2 0.65
   Negative 8 0.9206 (0.1591, 5.1000)
   Positive 22 1.0150 (0.1073, 3.3730)
Ki-67 0.42
   ≤20% 16 1.0620 (0.1591, 5.3030)
   >20% 14 0.9564 (0.0562, 2.8570)

Data are presented as M (P25, P75) unless otherwise specified. *, P<0.05; **, P<0.01. COL10A1, collagen X alpha 1 chain; ER, estrogen receptor; HER-2, human epidermal growth factor receptor-2; PR, progesterone receptor; TNM, tumor-node-metastasis.

COL10A1 promotes breast cancer cell proliferation, migration and invasion

RT-qPCR analysis (Figure 4A) indicated that COL10A1 was generally elevated in the breast cancer cell lines, MDA-MB-231, BT-549, and MCF-7 when compared with the non-tumorigenic mammary epithelial cell line, MCF-10A. BT-549 and MCF-7 were chosen for further investigation of COL10A1’s biological function. COL10A1 expression was upregulated in BT-549 and MCF-7 cells using a lentiviral vector with the COL10A1 sequence (Lv-COL10A1) and downregulated using a lentiviral vector with COL10A1-targeting shRNA (shCOL10A1). RT-qPCR was used to assess transduction efficiency (Figure 4B,4C).

Figure 4 COL10A1 promotes breast cancer cell proliferation, migration, and invasion. (A) RT-qPCR analysis of COL10A1 expression levels in breast cancer cells and MCF-10A cells. (B,C) The stable low and high COL10A1 expression in BT-549 and MCF-7 cell lines was verified using RT-qPCR. (D-G) MTT assay was used to evaluate BT-549 and MCF-7 cell proliferation after COL10A1 downregulation or overexpression. (H,I) A clonal formation assay was used to assess changes in cell proliferation upon COL10A1 knockdown or overexpression (crystal violet staining, magnification: whole well imaging). (J,K) A wound healing assay was used to evaluate BT-549 and MCF-7 cell healing after COL10A1 knockdown or overexpression (magnification: 100×). (L,M) A Transwell assay was used to assess cell migration and invasion upon COL10A1 knockdown or overexpression (crystal violet staining, magnification: 200×). Each bar represents the mean ± SD of three independent experiments. *, **, and *** indicate P<0.05, <0.01, and <0.001, respectively. COL10A1, collagen X alpha 1 chain; MTT, 3-(4,5-Dimethyl-2-thiazolyl)-2-5-diphenyl-2H-terazolium bromide; OD, optical density; RT-qPCR, real-time quantitative polymerase chain reaction; SD, standard deviation.

MTT and colony-formation assays revealed significantly decreased cell growth in the COL10A1 knockdown group compared with the control group, while increased COL10A1 expression promoted cell proliferation (Figure 4D-4I). Moreover, Transwell and wound healing assays revealed that COL10A1 downregulation markedly inhibited BT-549 and MCF-7 cell migration and invasion. We also found that COL10A1 overexpression significantly increased the invasive and migration ability of BT-549 and MCF-7 cells (Figure 4J-4M). In conclusion, these results indicate that COL10A1 expression promotes breast cancer cell proliferation, migration, and invasion.

COL10A1 promotes breast cancer cell progression through apoptosis and the cell cycle

Apoptosis is a conservative programmed cell death process characterized by cell contraction, chromatin condensation, and phosphatidylserine (PS) externalization (early membrane integrity). Q1 (Annexin V/PI+): necrotic cells; Q2 (Annexin V+/PI+): late apoptotic cells; Q3 (Annexin V+/PI): early apoptotic cells; Q4 (Annexin V/PI): live cells. Total apoptotic rate = Q2 + Q3 (used for group comparison). Flow cytometric analysis of COL10A1’s effects on breast cancer cell apoptosis and cell cycle found that COL10A1 expression is associated with suppressed apoptosis and an increased proportion of S-phase cells (Figure 5).

Figure 5 COL10A1 promotes breast cancer cell progression through apoptosis and the cell cycle. (A,B) The percentage of apoptotic cells was detected using Annexin V/propidium iodide double staining. Q1 (Annexin V/PI+): necrotic cells; Q2 (Annexin V+/PI+): late apoptotic cells; Q3 (Annexin V+/PI): early apoptotic cells;Q4 (Annexin V/PI): live cells. (C,D) Cell cycle distribution in BT-549 and MCF-7 cells. Data are expressed as mean ± SD of three independent experiments. * and ** indicate P<0.05 and P<0.01, respectively; ns, no significance. COL10A1, collagen X alpha 1 chain; SD, standard deviation.

COL10A1 promotes autophagy and VM in breast cancer cells

Immunofluorescence revealed that the number of autophagosomes decreased in the two COL10A1-downregulated breast cancer cell lines, while COL10A1 upregulation promoted autophagy. Autophagosome formation significantly increased after COL10A1 upregulation (Figure 6A). The tube formation ability in downregulated COL10A1 group was significantly decreased. The annular structure was destroyed, and most of them were linear structures that were not completely closed. While tube formation ability of the COL10A1-upregulated group was significantly enhanced. Typical vascular network structures were formed, with a single multi-ring connection (Figure 6B). Western blotting revealed that Beclin1 and LC3A/B expression increased in the COL10A1-upregulated group, while P62 expression was reduced. The opposite effect was observed upon COL10A1 downregulation. Analysis of key VM factors showed that COL10A1 silencing lowered VE-cadherin, LAMC2, and MMP2 expression, while its overexpression exerted the opposite influence (Figure 6C,6D). Collectively, these data suggest that COL10A1 expression is correlated with autophagy and VM in breast cancer cells.

Figure 6 COL10A1 promotes autophagy in breast cancer cells. (A) Immunofluorescence was used to detect the number of autophagosomes in BT-549 and MCF-7 cells after COL10A1 upregulation or downregulation. (B) Tube formation assay in MCF-7 and BT-549 cells with upregulation or downregulation COL10A1 (magnification: 100×). (C,D) Western blot analysis of changes in autophagy-related proteins and key vasculogenic mimicry factors in BT-549 and MCF-7 cells after COL10A1 downregulation or upregulation. Data are presented as mean ± standard deviation from three independent experiments (n=3). *, **, and *** indicate P<0.05, P<0.01, and P<0.001, respectively. COL10A1, collagen X alpha 1 chain.

COL10A1 promotes tumor growth in nude mice

To explore COL10A1’s function in breast cancer cell growth in vivo, stably Lv-COL10A1- and Lv-NC-transduced MCF-7 cells were injected subcutaneously into the right flank of nude mice. Tumor monitoring and measurement for 21 days found that tumor growth was markedly faster in the Lv-COL10A1 group than in the Lv-NC group. Tumor volume and weight were significantly greater in the Lv-COL10A1 group (Figure 7A-7C). Moreover, western blot analysis confirmed that COL10A1 expression was significantly higher in the Lv-COL10A1 group. The expressions of the autophagy-related proteins, LC3A/B and P62, in the Lv-COL10A1 group were increased and decreased, respectively. The expressions of VM-associated proteins, such as VE-cadherin, LAMC2, and MMP2, were higher in the Lv-COL10A1 group when compared with the controls (Figure 7D,7E). IHC validation of autophagy and VM protein expression (Figure 7F) indicated that COL10A1 significantly promoted tumor autophagy, and VM in vivo.

Figure 7 The effects of COL10A1 on tumorigenic ability, autophagy, and vasculogenic mimicry in vivo. (A) Representative image of isolated tumors shows significant growth. (B,C) Subcutaneously transplanted tumor volume and weight measurements (n=6). (D,E) Western blot analysis of autophagy- and vasculogenic mimicry-related proteins in tumor tissue protein samples (data are presented as mean ± standard deviation from three independent experiments). (F) Immunohistochemistry images of LC3A/B and VE-cadherin expression in subcutaneous tumors. *, **, and *** indicate P<0.05, P<0.01, and P<0.001, respectively. COL10A1, collagen X alpha 1 chain.

Discussion

Although diagnostic and therapeutic advances have improved cancer clinical outcomes, the prognosis of patients with breast cancer remains unsatisfactory (1). The annual incidence rate of breast cancer is still increasing at an alarming rate. We will face more serious breast cancer prevention and treatment challenges (19). Studies have shown that tumor microenvironment changes, including extracellular matrix (ECM) remodeling characterized by collagen degradation, deposition, and cross-linking, have a significant impact on tumor recurrence and metastasis (20,21). Excessive ECM deposition promotes tumorigenesis and tumor progression (22). Recent studies have revealed that collagen, an ECM component, greatly contributes to cancer progression (23). COL10A1, a member of the collagen family, is reported to be upregulated in various human tumor tissues (24-26). COL10A1 is overexpressed in the tissues and serum of colorectal cancer. High COL10A1 expression increases colorectal cancer proliferation, migration, and invasion and is an independent colorectal cancer prognosis and OS risk factor (27,28).

A study that analyzed the transcriptional expression profiles of three lung adenocarcinoma types found that COL10A1 mRNA upregulation is associated with poor prognosis. COL10A1 may promote lung adenocarcinoma progression by interacting with DDR2 and regulating the downstream FAK signaling pathway (29).

Our results are consistent with the conclusions of these studies. Public database (GEPIA and TCGA) bioinformatics analysis revealed abnormal COL10A1 expression elevation in breast cancer, which was related to poor patient prognosis. COL10A1 expression levels were found to be significantly associated with histological grade, TNM stage, and distant lymph node metastasis in breast cancer. ROC curve analysis showed that the area under the ROC curve of COL10A1 was 0.989, suggesting that COL10A1 has clinical value for breast cancer risk assessment. The results of the differences and correlation between COL10A1 expression and tumor-infiltrating immune cells showed that 20 tumor-infiltrating immune cells significantly correlated with COL10A1 expression. To gain further insights into the molecular mechanism underlying breast cancer tumorigenesis, we collected clinical tissue samples to verify COL10A1 expression in patients with breast cancer.

Our work demonstrates that COL10A1 is highly expressed in breast cancer tissues relative to their corresponding paracarcinoma tissues, and is closely correlated with advanced histological grade, higher TNM stage, and the presence of distant lymph node metastasis in breast cancer patients. Further COL10A1 expression validation using IHC showed that the breast cancer tissue staining score was much higher compared with corresponding normal tissues. Furthermore, COL10A1 expression was elevated in breast cancer cell lines. MTT, colony formation, Transwell, and wound healing assays proved that COL10A1 promotes breast cancer cell proliferation, migration, and invasion. Flow cytometric apoptosis and cell cycle analysis found that COL10A1 downregulation increased the percentage of apoptotic cells and reduced the percentage of cells in the S phase. However, COL10A1 overexpression had the opposite results. These results confirm that COL10A1 promotes breast cancer cell progression. Therefore, we have sufficient evidence that COL10A1 is a potential breast cancer prognostic biomarker and therapeutic target.

Autophagy plays an important role in tumor cell progression (30). Autophagy inhibits tumor initiation in premalignant lesions. It monitors malignant changes in the body’s cells and self-clears to protect individual development. However, it can protect tumor cells by promoting the degradation of damaged substances inside the cells for reuse and to provide nutrition for tumor cell proliferation (31,32). Thus, autophagy inhibition has been suggested as a therapeutic strategy against advanced cancer (33). LC3, which plays a crucial role in autophagy, is an autophagy marker. LC3, Beclin1, and p62 are frequently used as indicators of autophagic changes. LC3 and Beclin1 generally maintain an opposite trend to P62. Immunofluorescence and Western blot analysis showed that COL10A1 modulates the number of autophagosome-like puncta and the expression of key autophagy-associated proteins in breast cancer cells. We found that COL10A1 downregulation results in decreased LC3A/B and Beclin1, increased P62, and a significant reduction in the number of autophagosomes in the cytoplasm, indicating that COL10A1 knockdown in breast cancer cells led to an autophagy blockade. However this study only observed morphological changes of autophagosome-like puncta and alterations of autophagy-associated protein expression, and the verification of authentic autophagy requires autophagic flux measurement (e.g., mRFP-GFP-LC3 assay), which will be performed as a core follow-up research direction.

VM is a phenomenon in which tumor cells mimic endothelial cells and form vascular channels on their own, allowing the generation of a channel network capable of transporting blood and tumor cells. VM is composed of tumor cells and the ECM, including collagen, laminin, heparin sulfate glycoprotein, and mucopolysaccharides (34,35). As a special source of nutrients and oxygen supply for tumor progression to a more aggressive state, VM has been observed in various human malignant tumors, and is closely associated with tumor proliferation, invasion, metastasis, therapy resistance, and poor patient prognosis (36,37).

VM is reported to be implicated in the initiation and progression of breast cancer (38). In our 2D culture system, we found that COL10A1 significantly affected the cord-like arrangement of breast cancer cells, a morphological feature related to VM. Further analysis of key VM-associated factors revealed that silencing COL10A1 downregulated the expression of VE-cadherin, LAMC2 and MMP2, whereas COL10A1 overexpression exerted the opposite effect. Collectively, these results indicated that COL10A1 modulates the expression of VM-associated proteins and the cord-like morphological arrangement of breast cancer cells in 2D culture, a cellular phenotype closely correlated with breast tumorigenesis and progression. Notably, the 2D culture system employed in this study cannot support the formation and observation of bona fide tubular structures with a continuous wall enclosing a lumen—the definitive hallmark of authentic VM, which requires a 3D culture system. Verification of authentic VM formation, including the detection of typical tubular/lumen structures, will be conducted in our subsequent research using a Matrigel-based 3D culture system. The above findings were further validated by in vivo tumorigenicity assays in nude mice: compared with the NC group, the Lv-COL10A1 group exhibited markedly increased tumor volume and weight, accompanied by upregulated expression of autophagy- and VM-associated proteins in tumor tissues. These in vivo results confirmed that COL10A1 is closely associated with tumor formation as well as the expression of autophagy- and VM-associated proteins in breast cancer.

In summary, in vitro and in vivo evidence suggests that COL10A1 functions as a tumor oncogene that can dramatically promote breast cancer progression. Our work confirmed that COL10A1 modulates the number of autophagosome-like puncta and the expression of key autophagy and VM associated proteins in breast cancer cells, which provided a better explanation of tumor growth, invasion, and metastasis prevention. Therefore, this provides an experimental and theoretical basis for optimizing cancer therapy via COL10A1 targeting for effective tumor proliferation and metastasis inhibition. However, the current study only revealed the association between COL10A1 expression and autophagy/VM in breast cancer, and no additional experimental perturbations (e.g., autophagy/VM pathway inhibitors, rescue experiments, site-directed mutagenesis of COL10A1) were used to verify the direct causal mechanism. These associations need to be further confirmed by more in-depth mechanistic experiments in subsequent studies.


Conclusions

COL10A1 may be involved in breast cancer cell proliferation, apoptosis, invasion and migration, which are related to autophagy and VM, suggesting that COL10A1 may serve as a novel target for clinical breast cancer therapy.


Acknowledgments

We would like to express our deepest gratitude to the technical support of Mr. Cheng Zenong, the Department of Pathology of Bengbu Medical University. The results presented here are in whole or part based upon data generated by the TCGA Research Network: https://www.cancer.gov/tcga.


Footnote

Reporting Checklist: The authors have completed the MADR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2165/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2165/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2165/prf

Funding: This work was supported by the Key Project of Natural Science Foundation of Anhui Provincial Department of Education (China) (No. 2022AH051517), the Key Project of Natural Science Foundation of Anhui Provincial Department of Education (China) (No. 2025AHGXZK31518), Natural Science General Project of Bengbu Medical University (China) (No. 2024byzd048), National College Students’ Innovation and Entrepreneurship Training Program Project (China) (No. 202410367065), and the Graduate Research Innovation Plan of Bengbu Medical University (China) (No. Byycx24032).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-aw-2165/coif). All authors report that this work was supported by the Key Project of Natural Science Foundation of Anhui Provincial Department of Education (China) (No. 2022AH051517), the Key Project of Natural Science Foundation of Anhui Provincial Department of Education (China) (No. 2025AHGXZK31518), Natural Science General Project of Bengbu Medical University (China) (No. 2024byzd048), National College Students’ Innovation and Entrepreneurship Training Program Project (China) (No. 202410367065), and the Graduate Research Innovation Plan of Bengbu Medical University (China) (No. Byycx24032). The authors have no other conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. This study was approved by the Ethics Committee of Bengbu Medical College (approval No. [2023]239) and informed consent was obtained from all individual participants. All animal experiments were performed under a project license (approval No. [2023]655) granted by the Ethics Committee of Bengbu Medical College, in accordance with the institutional guidelines for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Siegel RL, Miller KD, Wagle NS, et al. Cancer statistics, 2023. CA Cancer J Clin 2023;73:17-48. [Crossref] [PubMed]
  2. Sun K, Zhang B, Lei S, et al. Incidence, mortality, and disability-adjusted life years of female breast cancer in China, 2022. Chin Med J (Engl) 2024;137:2429-36. [Crossref] [PubMed]
  3. Herrera-Quintana L, Vázquez-Lorente H, Plaza-Diaz J. Breast Cancer: Extracellular Matrix and Microbiome Interactions. Int J Mol Sci 2024;25:7226. [Crossref] [PubMed]
  4. Wang X, Ma S, Li S, et al. The regulatory effect of CoL10A1 to the intracranial vascular invasion and cell proliferation in breast cancer via EMT pathway. Sci Rep 2025;15:11040. [Crossref] [PubMed]
  5. Yi Q, Zhu G, Zhu W, et al. Oncogenic mechanisms of COL10A1 in cancer and clinical challenges Oncol Rep 2024;52:162. (Review). [Crossref] [PubMed]
  6. Han T, Zhu T, Lu Y, et al. Collagen type X expression and chondrocyte hypertrophic differentiation during OA and OS development. Am J Cancer Res 2024;14:1784-801. [Crossref] [PubMed]
  7. Wu H, Wang S, Li G, et al. Characterization of a novel COL10A1 variant associated with Schmid-type metaphyseal chondrodysplasia and a literature review. Mol Genet Genomic Med 2021;9:e1668. [Crossref] [PubMed]
  8. Xu Q, Zheng J, Su Z, et al. COL10A1 promotes tumorigenesis by modulating CD276 in pancreatic adenocarcinoma. BMC Gastroenterol 2023;23:397. [Crossref] [PubMed]
  9. Zhang M, Jin M, Gao Z, et al. High COL10A1 expression potentially contributes to poor outcomes in gastric cancer with the help of LEF1 and Wnt2. J Clin Lab Anal 2022;36:e24612. [Crossref] [PubMed]
  10. Kim HM, Koo JS. The Role of Autophagy in Breast Cancer Metastasis. Biomedicines 2023;11:618. [Crossref] [PubMed]
  11. Faryal B. Epigenetic Regulation of Autophagy in Breast Cancer: Implications for Biomarker Discovery and Personalized Therapy. Cancer Rep (Hoboken) 2025;8:e70389. [Crossref] [PubMed]
  12. Debnath J, Gammoh N, Ryan KM. Autophagy and autophagy-related pathways in cancer. Nat Rev Mol Cell Biol 2023;24:560-75. [Crossref] [PubMed]
  13. Liu S, Yao S, Yang H, et al. Autophagy: Regulator of cell death. Cell Death Dis 2023;14:648. [Crossref] [PubMed]
  14. Lin X, Long S, Yan C, et al. Therapeutic potential of vasculogenic mimicry in urological tumors. Front Oncol 2023;13:1202656. [Crossref] [PubMed]
  15. Pezzella F, Ribatti D. Vascular co-option and vasculogenic mimicry mediate resistance to antiangiogenic strategies. Cancer Rep (Hoboken) 2022;5:e1318. [Crossref] [PubMed]
  16. Cancer Genome Atlas Network. Comprehensive molecular portraits of human breast tumours. Nature 2012;490:61-70. [Crossref] [PubMed]
  17. Liu Y, Kong X, Yu X, et al. Hepatitis B virus core/capsid protein induces hepatocellular carcinoma progression via long non-coding RNA KCNQ1OT1/miR-335-5p/CDC7 axis. Transl Cancer Res 2025;14:3319-35. [Crossref] [PubMed]
  18. Sun W, Li Y, Xu M, et al. Neochlorogenic acid inhibits gastric cancer cell growth through apoptosis and cell cycle arrest. Transl Cancer Res 2025;14:5297-310. [Crossref] [PubMed]
  19. Xu W, Zhang T, Zhu Z, et al. The association between immune cells and breast cancer: insights from Mendelian randomization and meta-analysis. Int J Surg 2025;111:230-41. [Crossref] [PubMed]
  20. Su H, Karin M. Multifaceted collagen-DDR1 signaling in cancer. Trends Cell Biol 2024;34:406-15. [Crossref] [PubMed]
  21. Jiang D, Wen P, Zhang S, et al. Knowledge mapping of tumor microenvironment for breast cancer: a bibliometric analysis from 2014 to 2023. Front Immunol 2025;16:1550988. [Crossref] [PubMed]
  22. Baker SG, Sauter ER. The Role of the Extracellular Matrix in Cancer Prevention. Cancers (Basel) 2025;17:1491. [Crossref] [PubMed]
  23. Heydari S, Tajik F, Safaei S, et al. The association between tumor-stromal collagen features and the clinical outcomes of patients with breast cancer: a systematic review. Breast Cancer Res 2025;27:69. [Crossref] [PubMed]
  24. Jiang K, Xu LZ, Cheng F, et al. COL10A1 Facilitates Prostate Cancer Progression by Interacting With INHBA to Activate the PI3K/AKT Pathway. J Cell Mol Med 2024;28:e70249. [Crossref] [PubMed]
  25. Wang T, Bao X, Yang F, et al. Plasma COL10A1 Level, a Potential Diagnostic and Prognostic Biomarker for Pancreatic Ductal Adenocarcinoma. Onco Targets Ther 2024;17:949-59. [Crossref] [PubMed]
  26. Wu J, Ouyang P, Huang R, et al. METTL16 Promotes Stability of SYNPO2L mRNA and leading to Cancer Cell Lung Metastasis by Secretion of COL10A1 and attract the Cancer-Associated Fibroblasts. Int J Biol Sci 2024;20:4128-45. [Crossref] [PubMed]
  27. Kahlert UD, Shi W, Strecker M, et al. COL10A1 allows stratification of invasiveness of colon cancer and associates to extracellular matrix and immune cell enrichment in the tumor parenchyma. Front Oncol 2022;12:1007514. [Crossref] [PubMed]
  28. Aiba T, Hijiya N, Akagi T, et al. Overexpression of VSNL1 Enhances Cell Proliferation in Colorectal Carcinogenesis. Pathobiology 2024;91:121-31. [Crossref] [PubMed]
  29. Liang Y, Xia W, Zhang T, et al. Upregulated Collagen COL10A1 Remodels the Extracellular Matrix and Promotes Malignant Progression in Lung Adenocarcinoma. Front Oncol 2020;10:573534. [Crossref] [PubMed]
  30. Yang J, Gao L, Wang Z, et al. Effects of the lncRNA NBR2 on the proliferation and autophagy of breast cancer cells under starvation conditions. Sci Rep 2024;14:22624. [Crossref] [PubMed]
  31. Zhang M, Jin W, Cao L, et al. Prognostic role of tumor microenvironment and immune- and autophagy-related genes in colorectal adenocarcinoma. Transl Cancer Res 2025;14:2835-57. [Crossref] [PubMed]
  32. Jiang X, Xu Y, Yang J, et al. TFAM knockdown undermines SQSTM1 mRNA stability but retards autophagy flux and inhibits tumor cells proliferation under starvation conditions. Cell Biol Int 2023;47:1453-65. [Crossref] [PubMed]
  33. Guo Z, Tian JJ, Wang Y, et al. MiR-155-5p regulates autophagy and apoptosis of glioma cells through RICTOR. Transl Cancer Res 2024;13:5509-21. [Crossref] [PubMed]
  34. Liu S, Kang M, Ren Y, et al. The Interaction Between Vasculogenic Mimicry and the Immune System: Mechanistic Insights and Dual Exploration in Cancer Therapy. Cell Prolif 2025;58:e13814. [Crossref] [PubMed]
  35. Sun X, Cai W, Li H, et al. Endothelial-like cancer-associated fibroblasts facilitate pancreatic cancer metastasis via vasculogenic mimicry and paracrine signalling. Gut 2025;74:1437-51. [Crossref] [PubMed]
  36. Shapkina V, Shindyapin V, Burlov N, et al. Vasculogenic mimicry in non-small cell lung cancer: a systematic review. Front Oncol 2025;15:1481726. [Crossref] [PubMed]
  37. García-Hernández AP, Sánchez-Sánchez G, Carlos-Reyes A, et al. Functional roles of microRNAs in vasculogenic mimicry and resistance to therapy in human cancers: an update. Expert Rev Clin Immunol 2024;20:913-26. [Crossref] [PubMed]
  38. Bermúdez M, Martínez-Barajas MG, Bueno-Urquiza LJ, et al. Role of MicroRNA-204 in Regulating the Hallmarks of Breast Cancer: An Update. Cancers (Basel) 2024;16:2814. [Crossref] [PubMed]
Cite this article as: Gao L, Yang J, Fan X, Ling Y, Jiang X, Jin X, Xu H, Ling Y, Yu L. COL10A1 overexpression potentially contributes to poor outcomes in breast cancer via autophagy and vasculogenic mimicry. Transl Cancer Res 2026;15(5):392. doi: 10.21037/tcr-2025-aw-2165

Download Citation