Immune-driven induction of miR-501-5p by IL-17A enhances colorectal cancer progression
Original Article

Immune-driven induction of miR-501-5p by IL-17A enhances colorectal cancer progression

Yi Zhang1,2#, Ping Wang1#, Junchao Zhang1, Wenxin Shen2, Dandan Ma1, Chonghao Yang2, Bin Feng1, Hongbin Liu3, Yingnan Huang2, Haibin Wu1, Haohao Huang2,3

1Department of General Surgery, General Hospital of Central Theater Command of Chinese PLA Graduate Joint Training Base, School of Medicine, University of Science and Technology, Wuhan, China; 2Hubei University of Medicine, Shiyan, China; 3Department of Neurosurgery, General Hospital of Central Theater Command of Chinese PLA Graduate Joint Training Base, School of Medicine, University of Science and Technology, Wuhan, China

Contributions: (I) Conception and design: H Huang, Y Zhang, H Wu, P Wang; (II) Administrative support: Y Zhang, H Huang, P Wang; (III) Provision of study materials or patients: J Zhang, W Shen, D Ma; (IV) Collection and assembly of data: C Yang, B Feng H Liu, Y Huang; (V) Data analysis and interpretation: H Huang, Y Zhang, H Wu, P Wang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

#These authors contributed equally to this work.

Correspondence to: Haohao Huang, PhD. Department of Neurosurgery, General Hospital of Central Theater Command of Chinese PLA Graduate Joint Training Base, School of Medicine, University of Science and Technology, No. 627, Wuluo Road, Wuchang District, Wuhan 430070, China; Hubei University of Medicine, Shiyan 442000, China. Email: hhhpyt1991@hotmail.com; Haibin Wu, PhD. Department of General Surgery, General Hospital of Central Theater Command of Chinese PLA Graduate Joint Training Base, School of Medicine, University of Science and Technology, No. 627, Wuluo Road, Wuchang District, Wuhan 430070, China. Email: whb152144@163.com163.com.

Background: Colorectal cancer (CRC) patients are more susceptible to infections due to immune dysregulation. The interleukin-17A (IL-17A) signaling pathway plays a critical role in both immune defense and cancer metastasis. This study aimed to identify novel microRNAs (miRNAs) involved in IL-17A-mediated CRC progression.

Methods: RNA sequencing (RNA-seq) was used to analyze gene expression in stimulated peripheral blood mononuclear cells (PBMCs) and HCT116 cells cultured with their conditioned media (CM). Candidate miRNAs involved in IL-17A or transforming growth factor-β (TGF-β)-driven CRC progression were evaluated by reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR), western blotting, and wound healing assays. Prognostic relevance was assessed in The Cancer Genome Atlas colon adenocarcinoma (TCGA-COAD) cohort via Cox regression and Kaplan-Meier survival analysis.

Results: IL-17 signaling emerged as one of the most significantly enriched pathways following immune stimulation. Both IL-17A and TGF-β upregulated the epithelial-mesenchymal transition (EMT) marker vimentin and promoted CRC cell migration. Among the five candidate miRNAs identified, miR-501-5p was markedly induced by IL-17A and TGF-β. Functional assays revealed that either transient overexpression or inhibition of miR-501-5p significantly altered CRC cell migration in response to IL-17A. Notably, elevated miR-501 expression was associated with more than a twofold increased risk of death in stage IV CRC patients from the TCGA-COAD cohort.

Conclusions: IL-17 signaling may drive CRC progression and poor clinical outcomes in part through the induction of miR-501-5p, underscoring its potential role in immune-related cancer metastasis and as a prognostic biomarker.

Keywords: Interleukin 17A (IL-17A); transforming growth factor-β (TGF-β); colorectal cancer (CRC); microRNA (miRNA); miR-501-5p


Submitted Dec 22, 2025. Accepted for publication Mar 16, 2026. Published online May 27, 2026.

doi: 10.21037/tcr-2025-1-2843


Highlight box

Key findings

• miR-501-5p is induced by interleukin 17A (IL-17A) and transforming growth factor-β (TGF-β) and functionally contributes to IL-17A-driven colorectal cancer (CRC) cell migration. Elevated miR-501-5p expression is associated with increased mortality risk in patients with advanced CRC.

What is known and what is new?

• The IL-17 signaling pathway plays a critical role in immune regulation and cancer metastasis.

• miR-501-5p is identified as an IL-17A- and TGF-β-responsive microRNA that mediates IL-17A-driven CRC cell migration and is associated with poor survival outcomes in advanced CRC.

What are the implications, and what should change now?

• miR-501-5p may serve as a prognostic biomarker for advanced CRC and highlights an immune-driven regulatory pathway that could be explored for therapeutic intervention.


Introduction

Patients with cancer are at significantly increased risk of acquiring and dying from infectious disease and sepsis compared to the general population (1,2). Increasing evidence suggests that bacterial infections can alter tumor growth and trigger cancer metastasis (3). In sepsis-then-cancer models, accelerated tumor growth has been observed in post septic mice (4). Sepsis has also been associated with an increased risk of a wide array of tumors, including colon cancer (1,5).

Colorectal cancer (CRC) is one of the leading causes of cancer-related death worldwide, with metastasis remaining as the primary cause of mortality in CRC patients (6). Increasing evidence indicates that bacterial infections not only contribute to carcinogenesis of primary CRC but also promote metastatic progression by influencing the microenvironment at both primary and secondary tumor sites (7). During bacterial infections, both pro-inflammatory and anti-inflammatory responses result in the release of a wide range of inflammatory mediators (8,9).

The cytokine network serves as a bridge between the inflammatory environment and cancer cells, thereby influencing the development of malignant tumors. Interleukin-17A (IL-17A, also known as IL-17) is a pro-inflammatory cytokine primarily associated with innate immunity (10), which plays a crucial role in various diseases, including cancer and sepsis (11). Transforming growth factor-β (TGF-β), generally considered as a potential anti-inflammatory cytokine, is produced by macrophages and acts on T-cells in a paracrine manner. Both cytokines have been shown to play important roles in the progression of CRC (12,13).

MicroRNAs (miRNAs) are non-coding RNA which regulate various biological processes by targeting specific messenger RNAs (mRNAs) for gene silencing (14). An increasing number of human miRNAs have been shown to exhibit crucial antimicrobial roles by targeting host genes involved in the progression of bacterial or viral infections (15). Additionally, the contributions of miRNAs in tumor progression and metastasis within the tumor microenvironment have been extensively demonstrated (16).

In this study, we aimed to identify novel miRNAs induced by pro-inflammatory or anti-inflammatory factors during immune stimulation and to investigate their roles in CRC progression. Using RNA sequencing, we analyzed gene expression in stimulated peripheral blood mononuclear cells (PBMCs) and in colon cancer cells cultured with their conditioned media (CM), revealing IL-17 signaling as one of the most significantly enriched pathways. We further identified novel miRNAs regulated by IL-17A and examined their potential functions in CRC progression, including their effects on epithelial-mesenchymal transition (EMT) (17) and expression of glycogen synthase kinase 3 beta (GSK3β), a key regulator in bacterial infection and sepsis, has also been implicated in EMT regulation (18). We present this article in accordance with the MDAR reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2843/rc).


Methods

Cell cultures and treatments

Human colon cancer cell line HCT116 [American Type Culture Collection (ATCC), CCL-247], derived from the colon of a male patient with colon cancer, was cultured in McCoy’s 5A complete medium supplemented with 10% fetal bovine serum (FBS) at 37 ℃ in a 5% CO2 incubator. Active recombinant human IL-17A/CTLA-8 (Cytotoxic T-Lymphocyte-Associated Antigen 8) (#RP00212, ABclonal, Woburn, USA) and mature TGF-β1 proteins (#RP01458, ABclonal, USA), were used according to manufacturer’s instructions. The cells were incubated with either a solvent control or the recombinant proteins in the appropriate medium for the indicated duration.

PBMCs were isolated from human whole blood using Ficoll-Paque Plus (Merck, Darmstadt, Germany) density gradient centrifugation. Cells were cultured in RPMI 1640 medium (HyClone, Logan, USA) supplemented with 10% FBS.

Phytohemagglutinin (PHA)-stimulated PBMCs were used as a functional platform to assess T-cell responsiveness, reflecting immune alterations relevant to the “sepsis-then-cancer” concept. PBMCs were stimulated with 1 µg/mL PHA (Merck, Germany) for 24 h, followed by total RNA extraction. CM from untreated or PHA-stimulated PBMCs were collected and subsequently applied to HCT116 cells to evaluate their biological effects.

RNA sequencing (RNA-Seq)

Global gene expression changes in PBMCs following PHA stimulation and in HCT116 cells cultured with PBMC-derived CM were analyzed by RNA sequencing (RNA-Seq). Total RNA from control and treated cells was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), and RNA integrity was assessed with Nanodrop spectrophotometer and Agilent Bioanalyzer. RNA samples were fragmented and reverse-transcribed into cDNA using the NEBNext Ultra II RNA Library Prep Kit, followed by adapter ligation and library construction. Sequencing was performed on the Illumina NovaSeq™ 6000 Sequencing System to generate raw FASTQ files.

Bioinformatics analysis included quality control with sequencing quality control tool (FastQC), read alignment to the human reference genome (hg38) using spliced aligner for RNA-seq reads (HISAT2), and gene-level quantification with featureCounts. Differentially expressed genes were identified using differential expression analysis package (DESeq2), and subsequent functional enrichment analyses were conducted using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway databases.

Western blotting

Total protein was extracted from cells treated with solvent negative control (NC), IL-17, or TGF-β using radioimmunoprecipitation assay (RIPA) buffer (Beyotime Biotech Inc., Shanghai, China). The protein lysates were then mixed with sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer and separated by SDS-PAGE under reducing conditions, followed by transfer onto Immobilon®-P polyvinylidene difluoride (PVDF) membranes (Merck, Germany). After incubation with primary antibodies, the membranes were washed and subsequently incubated with peroxidase-conjugated secondary antibodies (1:2,000; anti-mouse IgG, Servicebio, Wuhan, China; anti-rabbit IgG, #GB23303, Servicebio). The signals were detected via enhanced chemiluminescence (ECL) (Solarbio, Beijing, China) and visualized with the ChemiScope 4300 Pro imaging system (Clinx Science Instruments Co., Shanghai, China).

The primary antibodies used included anti-beta tubulin antibody (mouse mAb, #GB15140, Servicebio, Wuhan, China), anti-actin monoclonal antibody (mouse mAb, #GB15001, Servicebio), anti- glycogen synthase kinase 3 beta (GAPDH) monoclonal antibody (mouse mAb, #GB12002, Servicebio), anti-vimentin (Rabbit mAb, #5741T, Cell Signaling, Danvers, USA), GSK-3β (Rabbit mAb, #12456T, Cell Signaling), and anti-E-Cadherin (Rabbit mAb #3195, Cell Signaling).

Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR)

Total RNA was extracted from the treated cells using Ultrapure RNA Kit (#CW0597S, Cwbio, Beijing, China) according to the manufacturer’s instructions. The required amounts of total RNA were reverse transcribed into cDNA, and quantitative PCR was performed using TransStart® Top Green qPCR SuperMix (TransGen Biotech Co., Beijing, China) and LightCycler 96 System (Roche, Basel, Switzerland). GAPDH mRNA and U6 snRNA were used as internal control for mRNA and miRNA analysis, respectively. The primer sequences are listed in Table 1.

Table 1

The sequences of specific primers

Targets Primer sequence (5' to 3')
Vimentin TACATCGACAAGGTGCGCTT (forward)
TCGTTGGTTAGCTGGTCCAC (reverse)
GSK3β GACTAAGGTCTTCCGACCCC (forward)
CTGCTGTGGCATTTGTGGG (reverse)
E-cadherin AAAACAGCAAAGGGCTTGGA (forward)
GCAGTGTCTCTCCAAATCCGATA (reverse)
miRNA-6733-5P GGCCGGTGGGAAAGACAAACT (forward)
miRNA-6739-5P CCACGGAGTGGGAAAGAGAAAGA (forward)
miRNA-149-3P GCGAGGGAGGGACGGG (forward)
miRNA-8077 ACACTCAGGCTGAGTGGGGTT (forward)
miRNA-501-5p AGCGCCTAATCCTTTGTCCCTG (forward)

Wound healing assay

The wound-healing assay (in vitro scratch assay) was performed in accordance with the methodology described in a previous study (19). Briefly, HCT116 cells were cultured in McCoy’s 5A complete medium supplemented with 10% FBS. After reaching approximately 90% confluence, a straight scratch was created using a scraper. After removal of debris and detached cells, the remaining cells were cultured in medium containing 2% FBS with solvent control, indicated amounts of recombinant IL-17A or TGF-β for 24 hours. Images of the wounds at 16 and 24 hours were captured using optical microscope, and the wound closure rates were analyzed with ImageJ software.

MiRNA mimics and inhibitors transfection

The miR-501-5p mimics, inhibitors, and corresponding controls were designed and synthesized by GENERAL BIOL (Anhui, China). HCT116 cells were transfected with 100 nM of control oligonucleotides (NC), miR-501-5p mimics, or miR-501-5p inhibitors using Lipofectamine 2000 (Invitrogen, Carlsbad, USA) following the manufacturer’s instructions. Twenty-four hours post-transfection, the cells were subjected to a wound-healing assay in the presence of IL-17A.

Statistical analysis

Comparison between two groups was performed using two-tailed paired Student’s t-test. Statistical significance was defined as P<0.05, with significant levels denoted as follows: P<0.05 (*), P<0.01 (**), borderline significant (bs), and not significant (ns). The prognostic relevance of hsa-miR-501 expression was evaluated in 482 tumor samples from TCGA-COAD cohort (https://portal.gdc.cancer.gov/) using multivariate Cox proportional hazards regression. Kaplan-Meier survival curves were generated and compared using the log-rank test. All statistical analyses were performed using SPSS software (version 17.0; SPSS Inc., USA).


Results

Gene expression profiles of stimulated PBMCs and colon cancer cells cultured with CM

To investigate the impact of immune activation on colon cancer cells, we first conducted differential gene expression (DGE) analysis using RNA-seq data from PHA-stimulated PBMCs compared with untreated controls. As anticipated, the volcano plot and over-representation analysis (ORA) of KEGG pathways, revealed numerous candidate genes and significant enrichment of immune-related pathways, including cytokine-cytokine receptor interaction, complement and coagulation cascades, TNF signaling, chemokine signaling, and the IL-17 signaling pathway (Figure 1).

Figure 1 Differential gene expression and pathway enrichment analysis of PHA-stimulated PBMCs. (A) Volcano plot exhibiting DEGs between PHA-stimulated PBMC [PHA (+) PBMCs] and unstimulated controls [PHA (–) PBMCs]. Significantly upregulated and downregulated genes were defined as those with |log2 FC| ≥1 and adjusted P<0.05. Red dots represent significant DEGs, whereas grey dots indicate genes without significant changes. Genes with P<0.05 but |log2 FC| <1 or |log2 FC| ≥1 but P>0.05, are plotted in blue and green, respectively. (B) ORA of enriched KEGG pathways among DEGs. Top significantly enriched pathways are listed with corresponding P values and q-values. (C) Dot plot visualization of enriched KEGG pathways, with dot size representing the number of DEGs involved in each pathway and color indicating the adjusted P value. Immune-associated pathways, including cytokine-cytokine receptor interaction, chemokine signaling, TNF signaling, and IL-17 signaling, emerged as the most highly enriched functional categories. DEGs, differentially expressed genes; FC, fold change; IL-17, interleukin-17; KEGG, Kyoto Encyclopedia of Genes and Genomes; ORA, over-representation analysis; PBMCs, peripheral blood mononuclear cells; PHA, phytohemagglutinin; TNF, tumor necrosis factor.

To further evaluate the global effects of immune cell stimulation on human colon cancer cells, HCT116 cells were cultured with CM derived from either unstimulated or PHA-stimulated PBMCs for 24 hours, followed by DGE analysis. Several genes involved in the IL-17 signaling pathway were significantly upregulated in HCT116 cells treated with CM from stimulated PBMCs, compared with the control CM (Figure 2A,2B). Gene Set Enrichment Analysis (GSEA) further confirmed IL-17 signaling pathway as one of the most significantly enriched pathways upon immune stimulation (Figure 2C,2D).

Figure 2 Transcriptomic changes and pathway enrichment in HCT116 cells exposed to CM from PHA-stimulated PBMCs. (A) Volcano plot of DEGs in HCT116 cells cultured with CM derived from PHA-stimulated PBMCs [PHA (+)] compared with CM from unstimulated PBMCs [PHA (–)]. Significantly upregulated and downregulated genes were defined as those with |log2 FC| ≥1 and adjusted P<0.05. Red dots represent significant DEGs, whereas grey dots indicate genes without significant changes. Genes with P<0.05 but |log2 FC| <1 or |log2 FC| ≥1 but P>0.05, are plotted in blue and green, respectively. (B) KEGG pathway map illustrating enrichment of the IL-17 signaling pathway. Red and green boxes represent upregulated and downregulated genes, respectively. (C) GSEA of KEGG pathways in HCT116 cells treated with PHA (+) versus PHA (–) PBMC CM. The top enriched pathways are listed with corresponding P values and q-values. (D) Dot plot visualization of enriched KEGG pathways, with dot size indicating the number of DEGs involved in each pathway and color representing the adjusted P value. Pathways central to immune regulation e.g., IL-17, NF-κB, TNF signaling were significantly enriched. CM, conditioned media; DEG, differentially expressed gene; FC, fold change; GSEA, gene set enrichment analysis; IL-17, interleukin-17; KEGG, Kyoto Encyclopedia of Genes and Genomes; NOD, nucleotide-binding oligomerization domain; PBMC, peripheral blood mononuclear cell; PHA, phytohemagglutinin; TNF, tumor necrosis factor.

Expression of EMT markers in response to IL-17A and TGF-β treatments

To evaluate the effect of IL-17A on EMT, the expression levels of E-cadherin, vimentin, and GSK3β were measured. As expected, both IL-17A and TGF-β significantly upregulated vimentin mRNA expression, whereas E-cadherin mRNA expression remained unchanged (Figure 3A,3B). TGF-β also induced a mild increase in GSK3β mRNA expression (Figure 3C). At the protein level, increased vimentin expression was observed, whereas E-cadherin and GSK3β expression showed no obvious change (Figure 3D). These results support that both IL-17A and TGF-β promote EMT in this CRC cell model.

Figure 3 Expression of vimentin, E-cadherin, and GSK3β under IL-17A or TGF-β stimulation in CRC cells. HCT116 cells were either untreated or treated with recombinant IL-17A (25 ng/mL) or recombinant TGF-β (20 ng/mL) for 48 hours. The mRNA expression levels of vimentin (A), E-cadherin (B), and GSK3β (C) were analyzed by RT-qPCR using GAPDH as an internal control. (D) Protein expression levels of vimentin, E-cadherin, and GSK3β were analyzed by western blotting with specific antibodies. GAPDH was used as the internal control for detecting vimentin and GSK3β, while β-tubulin served as the loading control for E-cadherin. All experiments were independently repeated 2 to 3 times using biological replicates, with similar results obtained. *P<0.05, as determined by a two-sided paired Student’s t-test compared to the NC; **, P<0.01. CRC, colorectal cancer; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL-17A, interleukin-17A; NC, negative control; RT-qPCR, reverse transcription quantitative real-time polymerase chain reaction; TGF-β, transforming growth factor-beta.

Expression of candidate miRNAs in response to IL-17A and TGF-β

To identify potential candidate miRNAs involved in pathogenesis of bacterial infections, bioinformatic analyses using TargetScan (https://www.targetscan.org/vert_80/) and miRDB (https://mirdb.org/) databases were performed. The results revealed that candidate miRNAs, including miR-6733-5p, miR-6739-5p, miR-149-3p, miR-8077, and miR-501-5p, exerted potential in targeting factors associated with pathogenesis of sepsis, such as GSK3β, WAP four-disulfide core domain protein 2 (WFDC2), and MT-RNR2 Like 1 (MTRNR2L1) (17).

Further investigation using RT-qPCR was performed to analyze the expression of candidate miRNAs, including miR-6733-5p, miR-6739-5p, miR-149-3p, miR-8077, and miR-501-5p, under IL-17A stimulation (Figure 4A-4E) and TGF-β stimulation (Figure 5A-5E). These results indicate that miR-501-5p and miR-8077 are responsive to IL-17A and TGF-β stimulation. However, the predicted target relationships are based on bioinformatic analysis and do not imply direct regulatory effects.

Figure 4 Expression of candidate miRNAs under IL-17A stimulation in CRC cells. HCT 116 cells were treated with either solvent control (NC) or 25 ng/mL of IL-17A. The expression levels of candidate miRNAs, including miR-6733-5p (A), miR-6739-5p (B), miR-149-3p (C), miR-8077 (D), and miR-501-5p (E), were analyzed by RT-qPCR with U6 as the internal control. The experiment was carried out in technical triplicate. **P<0.01, as determined by a two-sided paired Student’s t-test compared to the NC. CRC, colorectal cancer; IL-17A, interleukin-17A; NC, negative control; RT-qPCR, reverse transcription quantitative real-time polymerase chain reaction.
Figure 5 Expression of candidate miRNAs under TGF-β stimulation in CRC cells. HCT116 cells were treated with either solvent control (NC) or 20 ng/mL of TGF-β. The expression levels of selected miRNAs, including miR-6733-5p (A), miR-6739-5p (B), miR-149-3p (C), miR-8077 (D), and miR-501-5p (E), were analyzed by RT-qPCR with U6 as the internal control. The experiment was carried out in technical triplicate. *P<0.05 and **P<0.01, as determined by a two-sided paired Student’s t-test compared to the NC. CRC, colorectal cancer; NC, negative control; TGF-β, transforming growth factor-beta.

The miR-501-5p influences the migration ability of CRC cells upon IL-17A treatment

Bacterial infections have been reported to promote cancer metastasis by disrupting epithelial tight junction polarity (18). Both IL-17A and TGF-β are well recognized as key drivers of CRC progression (9,20). To evaluate their effects on tumor cell invasion, we performed wound-healing assays using HCT116 CRC cells. In comparison with untreated controls, treatment with recombinant IL-17A or TGF-β significantly accelerated wound closure (Figure 6A).

Figure 6 Both mimics and inhibitors of miR-501-5p influence the migration activity of CRC cells stimulated by IL-17A. (A) IL-17A and TGF-β significantly promote the migration of CRC cells. HCT 116 cells were either untreated (control) or treated with IL-17A (25 ng/mL) or TGF-β (20 ng/mL) for 16 and 24 hours. The effects of IL-17A and TGF-β on CRC cell migration were assessed using a wound-healing assay. The rates of wound closure were quantified using ImageJ software. Representative images of wound closure are shown in the upper panel, with corresponding quantitative analysis in the lower panel. (B,C) HCT116 cells were transfected with 100 nM of control oligonucleotides for miR-501-5p mimics or inhibitors (NC), miR-501-5p mimics, or miR-501-5p inhibitors for 24 hours, followed by IL-17A treatment. The effects of IL-17A and miR-501-5p on CRC migration were assessed using a wound-healing assay. Representative images and statistical analysis of wound closure rates are shown for miR-501-5p mimics (B) and miR-501-5p inhibitors (C). Graphs represent the average calculated wound closure rates ± SD (N=7–12). *P<0.05; **P<0.01; n.s., non-significant; b.s., borderline significant, as determined by a two-sided paired Student’s t-test compared to the control group (NC). CRC, colorectal cancer; IL-17A, interleukin-17A; NC, negative control; TGF-β, transforming growth factor-beta.

Given that IL-17A and TGF-β both elevate miR-501-5p expression, we next examined whether miR-501-5p modulates the migratory behavior of CRC cells. Transient overexpression of miR-501-5p using synthetic mimics modestly enhanced the migration of IL-17A-treated cells, showing borderline statistical significance compared with controls at 24 hours (Figure 6B). Conversely, inhibition of miR-501-5p significantly suppressed wound closure at 16 hours post-scratch relative to controls (Figure 6C). These results suggest that miR-501-5p enhances migratory activity of CRC cells in response to IL-17A stimulation.

Possible prognostic roles of miR-501 in patients with colon cancer

To explore the prognostic relevance of miR-501 expression in colon cancer, we analyzed overall survival in the TCGA-COAD cohort stratified by miR-501 expression levels. Among stage IV patients, those with high miR-501 expression exhibited approximately a twofold increased risk of mortality compared with those with low expression [hazard ratio (HR) =2.12, 95% confidence interval (CI): 1.11–4.49, P=0.050, Table 2]. Kaplan-Meier analysis depicted a trend toward poorer survival in high-expression group, despite the difference did not reach statistical significance (log-rank P=0.12; Figure 7). No significant prognostic association was observed in patients with stage I–III disease (data not shown).

Table 2

Association between miR-501 expression and prognosis in stage IV colorectal cancer (TCGA-COAD cohort)

MiR-501 N HR (95 % CI) P value*
Low 41 1
High 26 2.12 (1.11–4.49) 0.050

*, adjusted for age and sex. CI, confidence interval; HR, hazard ratio; TCGA-COAD, The Cancer Genome Atlas colon adenocarcinoma.

Figure 7 Prognostic significance of miR-501 expression in stage IV COAD patients. Kaplan-Meier overall survival analysis of TCGA-COAD stage IV patients stratified by high versus low miR-501 expression. Patients with high miR-501 expression exhibited a trend toward poorer overall survival compared with those with low expression, although the difference did not reach statistical significance (log-rank P=0.12). COAD, colon adenocarcinoma; OS, overall survival; TCGA-COAD, The Cancer Genome Atlas colon adenocarcinoma.

Discussion

While radical surgery can be an effective treatment for CRC, patients often experience postoperative recurrence and metastasis. CRC patients are particularly susceptible to bacterial infections due to the disruption of normal defense functions, and these infections further exacerbate the progression and metastasis of CRC (21-23), leading to a poor survival rate (24). Thus, identifying biological indicators to evaluate cytokines associated with bacterial infections in CRC, is crucial for improving patient survival.

Accumulating evidence suggests that bacterial infections contribute to metastatic progression and organ selectivity by modulating the microenvironment at both primary and secondary tumor sites (7). In CRC, the liver is the most common site of distant metastasis (7,25), and bacterial infections have been shown to alter hepatic innate immune responses (7,26). For instance, accumulation of hepatic natural killer T (NKT) cells was shown to be mediated by gut bacteria-regulated bile acid metabolism (26).

It has been shown that NKT cells can rapidly produce IL-17A in an IL-6-dependent manner (27). Similarly, TGF-β has been demonstrated to induce the development of the T(H)17 lineage, a subset of effector CD4+ T cells characterized by their production of IL-17 (28). These findings suggest that TGF-β and IL-17 may play a significant role in the progression of distant metastasis, particularly in liver metastasis triggered by bacterial infection. This hypothesis was investigated to uncover potential molecular mechanisms and contributing factors, including novel miRNAs.

Schematic summary of the results in current study was showed in Figure 8. We demonstrated CM from PHA-stimulated PBMCs triggers activation of CRC cells via the IL-17 signaling cascade (Figures 1,2). Both IL-17 and TGF-β contribute to increased expression of miR-501-5p (Figures 4,5) and induction of EMT markers such as vimentin, thereby facilitating enhanced migratory behavior (Figures 3,5). Notably, elevated miR-501-5p expression correlates with reduced overall survival in stage IV COAD patients (Table 2 and Figure 7), indicating a plausible mechanistic connection between immune-derived signals, EMT promotion, and unfavorable clinical outcomes.

Figure 8 Schematic summary of IL-17A/TGF-β-mediated regulation of miR-501-5p and EMT in colorectal cancer. CM derived from PHA-stimulated PBMCs activates CRC cells through IL-17 signaling pathway. Both IL-17 and TGF-β upregulate miR-501-5p expression and enhance EMT marker expression (e.g., vimentin), thereby promoting migratory potential. Elevated miR-501-5p levels are associated with poorer overall survival in stage IV COAD patients, suggesting a potential mechanistic link between immune stimulation, EMT induction, and adverse clinical outcomes. CM, conditioned media; COAD, colon adenocarcinoma; CRC, colorectal cancer; EMT, epithelial-mesenchymal transition; IL-17A, interleukin-17A; PBMC, peripheral blood mononuclear cell; PHA, phytohemagglutinin; TGF-β, transforming growth factor-beta.

Conditioned medium from stimulated PBMCs activated IL-17-related genes in HCT116 cells, with GSEA confirming IL-17 signaling as one of the most enriched pathways. These findings support the concept that circulating mediators released by activated immune cells may directly modulate CRC transcriptional programs. Our results align with previous reports, stating that IL-17A links chronic inflammation to tumor progression through EMT induction and metastasis. This underscores the dual role of immune responses in both host defense and tumor promotion. The IL-17 axis emerges as a key crosstalk between immune and tumor compartments, providing a mechanistic basis for inflammation-associated CRC progression.

EMT plays a crucial role in tumor progression and metastasis, as its occurrence enhances the migration and invasion capabilities of tumor cells. N-cadherin and vimentin are commonly regarded as mesenchymal cell markers, while E-cadherin serves as an epithelial cell marker. During EMT, the expression levels of N-cadherin and vimentin are upregulated, whereas E-cadherin expression is downregulated. EMT has been described in a growing number of tumors, including CRC, where it is strongly associated with an aggressive and metastatic phenotype (29). Strong EMT inducers, such as TGF-β, can initiate EMT and regulate metastasis in CRC (30). Our findings align with these observations. Both IL-17A and TGF-β were shown to elevate the expression of the EMT biomarker vimentin and promote the migration of CRC cells. Furthermore, our results demonstrated that IL-17A and TGF-β significantly stimulated the expression of miR-501-5p. The transient overexpression of miR-501-5p mimics and inhibitors, suggesting that miR-501-5p may influence the migration ability of CRC cells in response to IL-17A stimulation.

Although bioinformatic analyses predicted GSK3β as a potential target of miR-501-5p, GSK3β protein levels did not decrease following IL-17A and TGF-β stimulation. This discrepancy suggests that GSK3β expression may be regulated by multiple cytokine-activated pathways, potentially overriding miRNA-mediated post-transcriptional effects. In addition, miRNA regulation is often context-dependent and may exert indirect or modest effects within complex signaling networks. Importantly, the miR-501-5p-GSK3β interaction identified here is based on bioinformatic prediction and has not been functionally validated. Further studies are required to confirm whether GSK3β is a direct target of miR-501-5p.

In gastric cancer, elevated levels of miR-501-5p have been shown to stimulate the Wnt/β-catenin signaling cascade and promote the acquisition of stem cell-like characteristics by targeting Dickkopf-related protein 1 (DKK1), naked cuticle homolog 1 (NKD1), and GSK3β (31). Furthermore, miR-501-5p has been demonstrated to facilitate cell proliferation and migration in gastric cancer through the downregulation of lysophosphatidic acid receptor 1 (LPAR1) (32). Similarly, upregulation of miR-501-5p has been implicated in promoting proliferation and metastasis in other cancers, including head and neck squamous cell carcinoma (HNSCC) (33) and hepatocellular carcinoma (HCC) (34). In HCC, miR-501-5p expression was elevated in tumor specimens and cell lines, where it directly targeted the 3' untranslated region (3'UTR) of cylindromatosis lysine 63 deubiquitinase (CYLD) (34). In contrast, our research highlights a distinct role for miR-501-5p in the context of IL-17A and TGF-β functions. Current findings suggest that miR-501-5p has the potential to enhance the migration of CRC cells induced by IL-17A and increase the risk of mortality in stage IV patients with colon cancer, indicating its involvement in the inflammatory cytokine-driven progression of CRC.

We observed that increased expression of miR-501 was associated with unfavorable prognosis in stage IV, but not in earlier stages (I–III) of CRC patients in the TCGA-COAD cohort. This stage-dependent association may reflect the biological role of miR-501 in tumor progression. In earlier stages, prognosis is largely determined by local tumor control achieved through multiple therapeutic modalities, and the influence of individual microRNAs may be masked by other clinicopathological factors. In contrast, in advanced disease, systemic dissemination and metastatic potential become the key determinants of survival. Given the established role of miR-501 in promoting EMT and cell migration, its overexpression may amplify pro-metastatic signaling cascades, such as the IL-17/TGF-β axis, thereby contributing to poorer outcomes in stage IV patients.

In the survival analysis of the TCGA-COAD stage IV cohort, higher miR-501 expression was associated with an increased risk of death in the Cox proportional hazards model after adjustment for age and sex. However, the Kaplan-Meier analysis using the log-rank test did not reach statistical significance. This discrepancy may reflect the relatively small sample size of the analyzed subgroup and the influence of clinical covariates, as the Kaplan-Meier analysis represents an unadjusted comparison of survival distributions whereas the Cox model accounts for potential confounders. Therefore, the observed association should be interpreted with caution. Future studies with larger cohorts and additional validation are warranted to further clarify the prognostic relevance of miR-501 in advanced CRC.

One limitation of this study is that the in vitro experiments were performed using a single CRC cell line (HCT116). HCT116 cells are a widely used human CRC model characterized by microsatellite instability (MSI) and KRAS mutation, and they have been frequently applied to investigate inflammatory signaling and EMT-related processes in CRC. However, considering the substantial molecular and biological heterogeneity of CRC, including differences between MSI and microsatellite-stable tumors as well as diverse genetic backgrounds, the responses observed in this model may not fully represent the variability across CRC subtypes. Therefore, validation in additional CRC cell lines with distinct molecular characteristics, as well as in patient-derived models, would be valuable to further confirm the generalizability of the IL-17A-miR-501-5p regulatory axis identified in this study.


Conclusions

Taken together, our study demonstrates that IL-17 signaling may contribute to CRC progression and poor clinical outcomes in advanced disease, in part through the induction of miR-501-5p. The potential molecular mechanisms by which miR-501-5p mediates immune-related cancer metastasis warrant further investigation.


Acknowledgments

We sincerely appreciate our department members for providing great support.


Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2843/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2843/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2843/prf

Funding: This study was supported by National Natural Science Foundation of China (No. 82203879); Natural Science Foundation of Hubei Province (No. 2022CFB883); China Postdoctoral Science Foundation (No. 2021MD703960); Wuhan Science and Technology Bureau’s Exploration Program (Chen Guang Program) (No. 2024040801020362); and General Hospital of Central Theater Command of Chinese People’s Liberation Army Foundation (No. ZZYCZ202107).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-1-2843/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Tripathi AK, Srivastava Y. The Overlapping Biology of Sepsis and Cancer and Therapeutic Implications. Biomedicines 2025;13:1280. [Crossref] [PubMed]
  2. Ture Z, İskender G, Serhat Şahinoğlu M, et al. Epidemiology and prognosis of sepsis in cancer patients: A multicenter prospective observational study. Am J Med Sci 2025;369:679-88. [Crossref] [PubMed]
  3. Li Q. Bacterial infection and microbiota in carcinogenesis and tumor development. Front Cell Infect Microbiol 2023;13:1294082. [Crossref] [PubMed]
  4. Mirouse A, Vigneron C, Llitjos JF, et al. Sepsis and Cancer: An Interplay of Friends and Foes. Am J Respir Crit Care Med 2020;202:1625-35. [Crossref] [PubMed]
  5. Williams JC, Ford ML, Coopersmith CM. Cancer and sepsis. Clin Sci (Lond) 2023;137:881-93. [Crossref] [PubMed]
  6. Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229-63. [Crossref] [PubMed]
  7. Seely KD, Morgan AD, Hagenstein LD, et al. Bacterial Involvement in Progression and Metastasis of Colorectal Neoplasia. Cancers (Basel) 2022;14:1019. [Crossref] [PubMed]
  8. Al-Qahtani AA, Alhamlan FS, Al-Qahtani AA. Pro-Inflammatory and Anti-Inflammatory Interleukins in Infectious Diseases: A Comprehensive Review. Trop Med Infect Dis 2024;9:13. [Crossref] [PubMed]
  9. Doganyigit Z, Eroglu E, Akyuz E. Inflammatory mediators of cytokines and chemokines in sepsis: From bench to bedside. Hum Exp Toxicol 2022;41:9603271221078871. [Crossref] [PubMed]
  10. Zhang X, Li B, Lan T, et al. The role of interleukin-17 in inflammation-related cancers. Front Immunol 2024;15:1479505. [Crossref] [PubMed]
  11. Ge Y, Huang M, Yao YM. Biology of Interleukin-17 and Its Pathophysiological Significance in Sepsis. Front Immunol 2020;11:1558. [Crossref] [PubMed]
  12. Razi S, Baradaran Noveiry B, Keshavarz-Fathi M, et al. IL-17 and colorectal cancer: From carcinogenesis to treatment. Cytokine 2019;116:7-12. [Crossref] [PubMed]
  13. van der Vlegel M, Polinder S, Toet H, et al. Anxiety, depression and post-traumatic stress symptoms among injury patients and the association with outcome after injury. Eur J Psychotraumatol 2022;13:2023422. [Crossref] [PubMed]
  14. Annese T, Tamma R, De Giorgis M, et al. microRNAs Biogenesis, Functions and Role in Tumor Angiogenesis. Front Oncol 2020;10:581007. [Crossref] [PubMed]
  15. Mourenza Á, Lorente-Torres B, Durante E, et al. Understanding microRNAs in the Context of Infection to Find New Treatments against Human Bacterial Pathogens. Antibiotics (Basel) 2022;11:356. [Crossref] [PubMed]
  16. Patil N, Allgayer H, Leupold JH. MicroRNAs in the Tumor Microenvironment. Adv Exp Med Biol 2020;1277:1-31. [Crossref] [PubMed]
  17. Glibetic N, Shvetsov YB, Aan FJ, et al. Transcriptome profiling of colorectal tumors from patients with sepsis reveals an ethnic basis for viral infection risk and sepsis progression. Sci Rep 2022;12:20646. [Crossref] [PubMed]
  18. Khatun S, Appidi T, Rengan AK. The role played by bacterial infections in the onset and metastasis of cancer. Curr Res Microb Sci 2021;2:100078. [Crossref] [PubMed]
  19. Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc 2007;2:329-33. [Crossref] [PubMed]
  20. Zenobia C, Hajishengallis G. Basic biology and role of interleukin-17 in immunity and inflammation. Periodontol 2000 2015;69:142-59. [Crossref] [PubMed]
  21. Dougherty MW, Jobin C. Intestinal bacteria and colorectal cancer: etiology and treatment. Gut Microbes 2023;15:2185028. [Crossref] [PubMed]
  22. Xu C, Fan L, Lin Y, et al. Fusobacterium nucleatum promotes colorectal cancer metastasis through miR-1322/CCL20 axis and M2 polarization. Gut Microbes 2021;13:1980347. [Crossref] [PubMed]
  23. Engelsberger V, Gerhard M, Mejías-Luque R. Effects of Helicobacter pylori infection on intestinal microbiota, immunity and colorectal cancer risk. Front Cell Infect Microbiol 2024;14:1339750. [Crossref] [PubMed]
  24. Mo TW, Zhang ZJ, Chen YL, et al. Risk factors for metachronous peritoneal carcinomatosis after radical resection for patients with nonmetastatic pT3-4 colon cancer. J Surg Oncol 2022;126:757-71. [Crossref] [PubMed]
  25. Kow AWC. Hepatic metastasis from colorectal cancer. J Gastrointest Oncol 2019;10:1274-98. [Crossref] [PubMed]
  26. Ma C, Han M, Heinrich B, et al. Gut microbiome-mediated bile acid metabolism regulates liver cancer via NKT cells. Science 2018;360:eaan5931. [Crossref] [PubMed]
  27. Perez LG, Kempski J, McGee HM, et al. TGF-β signaling in Th17 cells promotes IL-22 production and colitis-associated colon cancer. Nat Commun 2020;11:2608. [Crossref] [PubMed]
  28. Mangan PR, Harrington LE, O'Quinn DB, et al. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 2006;441:231-4. [Crossref] [PubMed]
  29. Han X, Jiang S, Gu Y, et al. HUNK inhibits epithelial-mesenchymal transition of CRC via direct phosphorylation of GEF-H1 and activating RhoA/LIMK-1/CFL-1. Cell Death Dis 2023;14:327. [Crossref] [PubMed]
  30. Lu J, Kornmann M, Traub B. Role of Epithelial to Mesenchymal Transition in Colorectal Cancer. Int J Mol Sci 2023;24:14815. [Crossref] [PubMed]
  31. Fan D, Ren B, Yang X, et al. Upregulation of miR-501-5p activates the wnt/β-catenin signaling pathway and enhances stem cell-like phenotype in gastric cancer. J Exp Clin Cancer Res 2016;35:177. [Crossref] [PubMed]
  32. Ma X, Feng J, Lu M, et al. microRNA-501-5p promotes cell proliferation and migration in gastric cancer by downregulating LPAR1. J Cell Biochem 2020;121:1911-22. [Crossref] [PubMed]
  33. Li B, Jiang YP, Zhu J, et al. MiR-501-5p acts as an energetic regulator in head and neck squamous cell carcinoma cells growth and aggressiveness via reducing CLCA4. Mol Biol Rep 2020;47:2181-7. [Crossref] [PubMed]
  34. Huang DH, Wang GY, Zhang JW, et al. MiR-501-5p regulates CYLD expression and promotes cell proliferation in human hepatocellular carcinoma. Jpn J Clin Oncol 2015;45:738-44. [Crossref] [PubMed]
Cite this article as: Zhang Y, Wang P, Zhang J, Shen W, Ma D, Yang C, Feng B, Liu H, Huang Y, Wu H, Huang H. Immune-driven induction of miR-501-5p by IL-17A enhances colorectal cancer progression. Transl Cancer Res 2026;15(5):374. doi: 10.21037/tcr-2025-1-2843

Download Citation