PRSS1 promotes gastric cancer invasion and metastasis by induction of the epithelial-mesenchymal transition and activation of the MAPK/ERK pathway

Introduction

Gastric cancer (GC) remains among the most frequently diagnosed malignancies globally, ranking fifth for both incidence and cancer-related mortality (1). Although improved screening and advances in surgery, radiotherapy, and chemotherapy have reduced mortality for several other malignancies, outcomes for advanced GC have changed little. Most patients present at an advanced stage, and even after radical resection with comprehensive treatment regimens, recurrence and metastasis frequently drive poor survival rates (2). Conventional clinicopathologic indicators provide limited predictive accuracy for recurrence or metastasis. Because GC develops through a multistep process involving dysregulated signal transduction, oncogenes, tumor suppressor genes, DNA repair mechanisms, cell cycle regulators, and apoptosis-related factors (3,4), the identification of reliable biomarkers for prognosis and therapeutic targeting is of pressing clinical importance.

The rapid expansion of genomic and transcriptomic profiling has enabled the discovery of biomarkers critical for cancer diagnosis, treatment, and prognostication. Such markers span diverse pathways, including growth factor receptors such as HER2, cell-cycle and apoptosis regulators such as p53, adhesion molecules such as E-cadherin, immune checkpoint regulators PD-1/PD-L1, and molecules involved in DNA, RNA, exosomal cargo, or epigenetic modification (5,6). Metastasis of GC occurs through a highly orchestrated process, in which basement membrane and extracellular matrix (ECM) invasion by tumor cells represents a pivotal step (7,8). Matrix metalloproteinases (MMPs) and serine proteases are key mediators of ECM remodeling, enabling both physiological and pathological tissue turnover (9). Among these proteases, protease serine 1 (PRSS1) is of particular interest. Located on chromosome 7q34, PRSS1 encodes trypsinogen, a precursor of the serine protease trypsin (10). Synthesized by pancreatic acinar cells, trypsinogen is secreted and activated in the small intestine to its mature form (11). PRSS1 exhibits both serine endopeptidase and metal ion-binding activities, participating in processes such as ECM degradation, collagen regulation, vitamin and coenzyme metabolism, and activation of MMPs, as well as contributing to ligand-receptor interactions in neural signaling (12). Elevated PRSS1 expression has been reported in pancreatic, colorectal, and cervical cancers, suggesting its broader role in tumor biology (13-15). In GC specifically, low PRSS1 expression has been associated with ERK pathway suppression and reduced proliferation (16), but its role in invasion and metastasis has not been fully characterized.

Here, Gene Expression Omnibus (GEO) datasets were leveraged to analyze PRSS1 expression in GC patient tissues and serum, identifying its significant overexpression compared with normal controls. Using a lentiviral vector to downregulate PRSS1 expression in GC cells, we examined how it impacts migration, invasion, and peritoneal dissemination in nude mice. Our data imply that PRSS1 may enhance GC cell motility and metastatic capacity through induction of the epithelial-mesenchymal transition (EMT) and activation of the MAPK/ERK pathway. These findings position PRSS1 as an oncogenic driver of GC metastasis and underscore its potential value as an early-diagnostic biomarker and a target for therapeutic intervention. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0161/rc).

Methods

Patients and specimens

Patients were recruited from Nantong First People’s Hospital between 2021 and 2023. Twelve paired samples of primary gastric carcinoma tissue and non-cancerous tissues (≥5 cm from the surgical margin) were obtained from individuals undergoing D2 lymph node dissection. In addition, serum specimens were collected from three cohorts: (I) 50 patients who underwent D2 resection, (II) 15 patients with suspected distant metastatic GC who did not undergo surgery, and (III) 23 healthy volunteers. Clinical and pathological data recorded included age, sex, serum carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) levels, tumor diameter, histological grade, T staging, N staging, and Tumor Node Metastasis (TNM) classification. Inclusion criteria required no prior chemotherapy, radiotherapy, or immunotherapy; all cancer cases were histologically confirmed. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Institutional Ethics Committee of Nantong First People’s Hospital (No. 2023KT155). All participants provided written informed consent.

Cell culture and lentiviral transfection

The human normal gastric mucosal cell line GES-1 and six GC cell lines (HGC-27, AGS, BGC-823, MKN-45, MGC-803, SGC-7901) were purchased from Shanghai Jikai Co., Ltd. (Shanghai, China). Cells were maintained in RPMI-1640 (Gibco, Grand Island, NY, USA; PMI150110) with 10% FBS (Pricella, Wuhan, China; C04001) under a humidified 5% CO₂, 37 ℃ atmosphere.

Lentiviral transduction was performed on cells in 6-well plates when they reached 70–80% confluence. A slow infection approach was used to introduce the virus into HGC-27 and MKN-45 cells, with an MOI of 10. Stably transduced cells were selected after 14 days using puromycin (2 µg/mL). Negative control shRNA (shNC) or PRSS1-targeting shRNA (shPRSS1) was generated in HGC-27 and MKN-45 cells. Lentiviral particles (GV493) were obtained from Shanghai Jikai Co., Ltd. Target sequences included shPRSS1 (AAGGATTCATGTCAGGGTGAT), shPRSS1-1 (CTCCTCACGTGCAGTAATCAA), and shPRSS1-2 (AAGGTCTACAACTATGTGAAA). Total RNA and protein were extracted from blank, shNC, and shPRSS1 groups to evaluate PRSS1 knockdown.

Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting

Total RNA was isolated with TRIzol, and cDNA was synthesized with the Takara PrimeScript RT kit (Shiga, Japan; RR036A). Primers were designed by Shanghai Bioengineering Gene Co., Ltd. (Shanghai, China): PRSS1 forward 5'-CCACCCCCAATACGACAGGGAG-3', reverse 5'-GCGCCAGAGCTCGCAGT-3'; GAPDH forward 5'-AGAAGGCTGGGGCTCATTTG-3', reverse 5'-AGGGGCCATCCACAGTCTTC-3'. GAPDH served as the internal control. PCR conditions followed established protocols (17), with three independent replicate assays.

For protein analysis, total protein was extracted from cells and tissues using RIPA buffer (J63306.AP, Beyotime, Shanghai, China). Proteins were separated on SDS-PAGE gels (10% or 12.5%, PG112, Epizyme, Shanghai, China) and transferred to PVDF membranes (IPFL00010, Millipore, Burlington, MA, USA). Blocked membranes were incubated at 4 ℃ overnight with antibodies against PRSS1 (Abcam, Cambridge, UK, ab200997, anti-rabbit, monoclonal, 1:2,000), GAPDH (Proteintech, Rosemont, IL, USA, 60004-1-Ig, anti-mouse, monoclonal, 1:10,000), the EMT markers E-cadherin (60335-1-RR, anti-rabbit, monoclonal, 1:1,000), N-cadherin (66219-1-RR, anti-rabbit, monoclonal, 1:2,000), and vimentin (anti-rabbit, 60330-1-RR, monoclonal, 1:1,000), the EMT initiator Slug (anti-rabbit, 82755-3-RR, monoclonal, 1:2,000), the matrix metalloproteinases MMP2 (anti-rabbit, 66366-1-Ig, monoclonal, 1:800) and MMP9 (anti-rabbit, 82854-8-RR, monoclonal, 1:1,000), and the MAPK/ERK pathway proteins phospho-p38 (anti-rabbit, 81212-2-RR, monoclonal, 1:1,000), p38 (anti-rabbit, 80821-2-RR, monoclonal, 1:2,000); phospho-ERK1/2 (anti-rabbit, 28733-1-AP, polyclonal, 1:2,000), and ERK1/2 (anti-rabbit, 11257-1-AP, polyclonal, 1:2,000). All antibodies were purchased from Proteintech unless otherwise specified.

Enzyme-linked immunosorbent assays (ELISAs)

Fasting venous blood (4 mL) was collected from each participant into sterile tubes. After room temperature clotting for 30 min, samples were centrifuged for 20 min at 4 ℃ at 3,000 rpm to separate serum, which was stored at −80 ℃. Before analysis, standard gradients, biotinylated antibody, enzyme conjugate, and 1× wash buffer were prepared according to the instructions of the kit (EZGLP2, Merck, Darmstadt, Germany). Microplate wells were loaded with 100 µL of standards, test serum, or dilution buffer (blank). After incubation at 37 ℃ for 1 hour and rinsing, plates were incubated with biotinylated antibody for 1 hour at 37 ℃, washed again, and treated with enzyme conjugate for 30 min. Following five washes, TMB (T0440, Merck) was used as a substrate for reaction development using a standard approach. After terminating the reaction, absorbance was measured at 450 nm immediately. Standard curves were plotted from the known concentrations and corresponding optical density (OD) values to calculate sample concentrations.

Migration and invasion assays

Wound healing assay

Logarithmically growing cells (5×10⁵ per well) were added to 6-well plates and cultured to 80–90% confluence. A straight wound was then generated in the cell layer with a sterile 200 µL tip, followed by rinsing with phosphate-buffered saline (PBS) and adding serum-free medium. Imaging was conducted at 0, 24, and 48 h using an inverted microscope, and wound closure was quantified with ImageJ.

Transwell migration assay

Cells digested with trypsin (0.25%, 25200-072, Gibco) were resuspended at 5×10⁵/mL; 200 µL of cell suspension was added into the upper well, and 500 µL of RPMI-1640 containing 20% FBS was added to the lower well.

Invasion assay

The membrane of the upper part of the insert was pre-coated with 80 µL of Matrigel (REF354234, BD, Franklin Lakes, NJ, USA, 16:40:5) and incubated at 37 ℃ for 1 hour for gelation. Cells (1×10⁶/mL) were then seeded, and the lower chamber was filled as in the migration assay. After 24 h incubation, PBS was used for two washes of the inserts, which were fixed with 4% paraformaldehyde (PFA) for 10 min, followed by a 15-min 0.1% crystal violet staining step, further rinsing, and air-drying. Migratory or invasive cells in ten randomly selected microscopic fields per insert were quantified, and mean values were calculated. All assays were performed in triplicate.

Peritoneal metastasis model

Ten 4-week-old male BALB/c nude mice (Animal Experiment Center, Nantong University) housed under specific pathogen free conditions were randomly assigned to two groups (n=5 per group). Cells were harvested, digested with trypsin, and resuspended at 1×10⁷/mL, followed by the administration of 200 µL of either shPRSS1-transfected or control cells to each mouse. After five weeks, ether-anesthetized mice were euthanized by cervical dislocation. Mesenteric nodules were enumerated macroscopically. All animal experiments were performed under a project license (No. 2024-01474) granted by the Animal Ethics Committee of the Medical School of Nantong University, in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978).

Cytological immunofluorescence

Cells were trypsin-digested, resuspended, and seeded into 24-well plates containing sterile glass coverslips. After gentle mixing, cultures were incubated under standard conditions. Following 24 hours of adhesion, slides were rinsed three times with PBS (3 min per wash). Cells were then fixed at room temperature with 300 µL of 4% PFA for 15 min, washed with PBS, and permeabilized using 0.5% Triton X-100 (HFH10, Thermo Fisher Scientific, Waltham, MA, USA) for 20 min. Following triplicate PBS washes, coverslips were carefully removed, residual buffer aspirated, and cells underwent blocking with 5% BSA for 30 min. Without further washing, diluted primary antibodies (anti-E-cadherin and anti-vimentin) were added and incubated overnight in a humid chamber. The following day, primary antibodies were discarded, slides were rinsed thrice with PBS, and Alexa Fluor 594 (S11227, Thermo Fisher Scientific)-conjugated secondary antibody was applied for 30 min in the dark. After three additional PBS washes, nuclei were counterstained using 5 µL DAPI (R37605, Thermo Fisher Scientific) solution containing antifade reagent for 5 minutes in the dark. Immunofluorescent images were acquired via fluorescence microscopy.

Integrated gene expression dataset analyses

Pan-cancer transcriptomic profiles (HTSeq-count) were downloaded from the UCSC Xena database (https://xenabrowser.net/). The count data were normalized by log₂ transformation [log₂(x+1)] for subsequent analysis. Prognostic information was sourced from The Cancer Genome Atlas (TCGA) Prognostic Study published in Cell (18) and from the UCSC Cancer Atlas (https://xenabrowser.net/datapages/). Using R version 4.1.1, the association between gene expression (as a continuous variable) and patient outcome was assessed using a univariate Cox proportional hazards model via the coxph function in the survival package. Statistical significance was determined via log-rank tests, with P<0.05 indicating significance. Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed using the clusterProfiler package in R, with a significance threshold of P<0.05. A protein-protein interaction (PPI) network was constructed using the STRING database (version 11.5) with a minimum confidence score of 0.4. The PPI network was visualized and analyzed using Cytoscape (version 3.9.1).

Statistical analysis

Statistical procedures were performed in SPSS 26.0. Quantitative data were reported as means ± standard deviations and compared via Student’s t-tests, while categorical data were analyzed via χ² tests. Survival outcomes were assessed with the Kaplan-Meier method, and receiver operating characteristic (ROC) curves were generated to evaluate the diagnostic performance of PRSS1 for GC.

Results

Bioinformatics analysis of PRSS1 in GC

To identify genes consistently overexpressed in GC, three GEO datasets (GSE2685, GSE49051, and GSE79973) were subjected to differential expression analysis, focusing on upregulated transcripts fulfilling the criteria of |log₂FC| ≥1 and P<0.05 (for comparison of tumor vs. adjacent normal tissues). Venn diagram analysis demonstrated that 10 genes, including PRSS1, were significantly increased across all three datasets (Figure 1A). Preliminary functional annotation of these differentially expressed genes suggested potential involvement in ECM-related processes, such as ECM degradation and organization (Figure 1B). A PPI network incorporating these genes highlighted close functional relationships, with members of the MMP family showing notable enrichment among the top 25 PRSS1-interacting proteins (Figure 1C).

Figure 1 PRSS1 biological information analysis. (A) Venn diagram showing DEGs and common highly expressed genes in the three datasets. (B) GO analysis of DEG enrichment in specific biological processes. (C) A PPI network incorporating the 25 genes most strongly associated with PRSS1. DEGs, differentially expressed genes; GO, Gene Ontology; PPI, protein-protein interaction.

Evaluation of PRSS1 expression and clinical relevance in GC

We next evaluated PRSS1 dynamics in 12 paired gastric tumor and non-cancerous tissues. Western blotting and qRT-PCR both demonstrated significantly higher PRSS1 expression in tumor samples at the protein and mRNA levels (Figure 2A, P<0.05; Figure 2B, P<0.01). Survival analysis based on TCGA data indicated that subjects with elevated PRSS1 expression had markedly shorter overall survival (OS), disease-specific survival (DSS), and progression-free interval (PFI) (Figure 2C), indicating that PRSS1 upregulation is linked to poor prognosis.

Figure 2 Expression and clinical significance of PRSS1. (A) Western blotting analysis of PRSS1 in 12 GC tumors (T) and matched non-cancerous tissues (N). (B) qRT-PCR analysis of PRSS1 mRNA levels in 12 GC tumors and matched non-cancerous tissues. (C) Kaplan-Meier survival analysis of the relationships between PRSS1 levels and OS, DSS, and PFI in GC patients. (D) Serum PRSS1 levels in healthy controls (n=23), GC patients (n=50), and metastatic GC patients (n=15), as measured via ELISA. (E) ROC curves for serum PRSS1 levels in GC patients (n=50) and healthy controls (n=23). Data are presented as means ± SD. *, P<0.05; **, P<0.01. AUC, area under the curve; CI, confidence interval; DSS, disease-specific survival; ELISA, enzyme-linked immunosorbent assay; GC, gastric cancer; HR, hazard ratio; mRNA, messenger RNA; OS, overall survival; PFI, progression-free interval; qRT-PCR, quantitative real-time polymerase chain reaction; ROC, receiver operating characteristic; SD, standard deviation.

ELISAs revealed that serum PRSS1 concentrations were significantly increased in GC (n=50) relative to healthy controls (n=23) (P<0.01, Figure 2D). Levels were even higher in metastatic GC patients (n=15), differing significantly from non-metastatic cases (P<0.01, Figure 2D). ROC curve analysis demonstrated diagnostic utility of serum PRSS1 (area under the curve = 0.7965; 95% confidence interval: 0.6961–0.8970; P<0.0001), with an optimal cutoff of 70.35 ng/mL yielding 60.00% sensitivity and 91.30% specificity (Figure 2E).

To further clarify the clinical associations of PRSS1, serum levels were compared against clinicopathological variables in 50 GC patients (Table 1). The chi-square test showed significant correlations between elevated PRSS1 and tumor N staging (P=0.042), TNM staging (P=0.02), and vascular invasion (P=0.03). No associations with tumor differentiation, patient sex or age, tumor diameter, T stage, neural invasion, or CEA levels were evident (all P>0.05).

Establishment of stable PRSS1-knockdown GC cell lines

To clarify the role of PRSS1 in GC, PRSS1 expression was first quantified in normal GES-1 gastric mucosal cells and six GC cell lines (SGC-7901, AGS, BGC-823, MGC-803, HGC-27, MKN-45) by qRT-PCR and Western blotting. Both assays revealed that PRSS1 mRNA and protein levels were markedly elevated in HGC-27 and MKN-45 cells compared with GES-1 (Figure 3A,3B, P<0.01). On the basis of these findings, HGC-27 and MKN-45 were selected for functional studies. Three different shRNA lentiviral vectors targeting PRSS1 (shPRSS1, shPRSS1-1, and shPRSS1-2) and a non-targeting negative control (shNC) were introduced into these cell lines. The knockdown efficiency was validated via qRT-PCR and Western blotting, which confirmed substantial reductions in PRSS1 mRNA and protein in the shPRSS1 groups compared with shNC controls (Figure 3C,3D, P<0.05). These results demonstrate the successful establishment of stable PRSS1-silenced GC cell lines.

Figure 3 Establishment of GC cells with stable low expression of PRSS1. (A,B) Analysis of PRSS1 in GC cell lines and normal gastric mucosal cells. (C,D) Analysis of PRSS1 in GC cell lines and low expression gastric cells. Data are presented as mean ± SD. **, P<0.01. GC, gastric cancer; SD, standard deviation.

PRSS1 knockdown suppresses GC cell migration and invasion

The impact of PRSS1 downregulation on cellular motility and invasiveness was next assessed. In wound healing assays, HGC-27 and MKN-45 cells with PRSS1 knockdown (shPRSS1) exhibited significantly slower closure of scratch wounds at 24 and 48 hours compared with untreated and shNC control groups, while no difference was observed between the two control groups (Figure 4A). Transwell migration assays likewise demonstrated a marked decrease in cell migration in shPRSS1 cells relative to both controls, again with no difference between untreated and shNC groups (Figure 4B). Invasion assays using Matrigel-coated chambers showed a similar pattern, with substantially fewer invading cells in the PRSS1-silenced group (Figure 4C). To clarify the in vivo relevance of these findings, a nude mouse peritoneal metastasis model was established. Following intraperitoneal injection of PRSS1-silenced HGC-27 and MKN-45 cells, the number of mesenteric metastatic nodules was significantly reduced compared with the shNC group (P<0.01; Figure 4D), indicating that PRSS1 knockdown reduces the metastatic potential in vivo.

Figure 4 Effect of PRSS1 on GC metastasis. (A) Wound healing assay showing the impact of PRSS1 knockdown on migration in HGC-27 and MKN-45 cells (scale bar: 500 µm). (B) Transwell assay-based analysis of the effects of PRSS1 knockdown on HGC-27 and MKN-45 cell migration (crystal violet staining, scale bar: 500 µm). (C) Matrigel invasion assay-based analysis of the effects of PRSS1 knockdown on HGC-27 and MKN-45 cell invasion (crystal violet staining, scale bar: 500 µm). (D) Nude mouse intraperitoneal model assessing PRSS1 knockdown effects on in vivo metastasis. Data are presented as mean ± SD. *, P<0.05; **, P<0.01. GC, gastric cancer; SD, standard deviation.

PRSS1 drives GC cell invasion and metastatic progression through EMT induction and MAPK/ERK pathway modulation

When differentially expressed genes were subjected to KEGG pathway analysis, significant involvement in protein digestion and absorption, as well as ECM-receptor interactions was detected (Figure 5A). In line with the PPI network showing a strong association between PRSS1 and MMPs, Western blotting revealed that PRSS1 knockdown substantially reduced MMP2 and MMP9 protein levels (Figure 5B). Given the pivotal role of MMPs in ECM degradation, angiogenesis, tumor invasion, and EMT, additional assays were performed to examine EMT status. Silencing PRSS1 increased the epithelial marker E-cadherin while reducing expression of the mesenchymal markers N-cadherin, β-catenin, vimentin, and the transcription factor Slug (Figure 5C), demonstrating inhibition of EMT progression. Immunofluorescence confirmed these findings, showing enhanced E-cadherin and diminished vimentin expression in PRSS1-knockdown cells (Figure 5D). Moreover, Western blotting of MAPK/ERK signaling components revealed decreased levels of phosphorylated and total p38 as well as ERK1/2 proteins in PRSS1-silenced cells (Figure 5E). These findings suggest that PRSS1 promotes GC invasion and metastasis, at least in part by modulating EMT and MAPK/ERK signaling.

Figure 5 Regulation of PRSS1-related signaling pathway. (A) KEGG enrichment analysis results. (B) Western blotting analysis of the impact of PRSS1 silencing on MMP2 and MMP9 protein levels. (C) Western blotting analysis of the impact of PRSS1 knockdown on EMT-related transcription factors and associated pathway proteins. (D) Immunofluorescence analysis of E-cadherin and vimentin protein levels in PRSS1-knockdown cells (×400). (E) Western blotting analysis of the impact of PRSS1 knockdown on the expression MAPK/ERK proteins. Data are presented as mean ± SD. *, P<0.05; **, P<0.01; ***, P<0.001. EMT, epithelial-mesenchymal transition; KEGG, Kyoto Encyclopedia of Genes and Genomes. SD, standard deviation.

Discussion

GC develops through a multifactorial process involving dietary patterns, tobacco use, Epstein-Barr virus (EBV) infection, alcohol consumption, Helicobacter pylori infection, and a range of genetic and environmental determinants. Beyond environmental exposures, numerous molecular abnormalities, including point mutations, chromosomal alterations, transcriptional dysregulation, and epigenetic reprogramming, drive tumor initiation and progression (19). Epidemiological investigations reveal that about 10% of GC cases cluster in families, with 1–3% attributable to verified germline mutations. Hereditary diffuse GC (HDGC) represents the most common form, exhibiting autosomal dominant inheritance and a characteristic diffuse histological pattern. HDGC is largely linked to inactivating mutations of CDH1, which encodes the adhesion molecule E-cadherin, a protein essential for maintaining epithelial integrity and cell-cell adhesion (20,21). During EMT, tumor cells undergo phenotypic remodeling, shifting from a proliferative epithelial state to a more migratory and invasive mesenchymal phenotype. This process entails weakening of intercellular junctions, apical-basal polarity loss, and mesenchymal trait acquisition, enhancing motility and invasion (22,23). Consequently, EMT facilitates hematogenous and lymphatic dissemination, typically characterized by decreased E-cadherin and elevated vimentin levels (24). In this study, modulation of PRSS1 expression led to changes in EMT markers (E-cadherin, N-cadherin, vimentin) in GC cells, suggesting a link between PRSS1 and the EMT, while PRSS1-induced downregulation of E-cadherin may promote a diffuse-like invasive phenotype in sporadic GC that shares some histological features with HDGC.

Tumor biomarkers remain indispensable for early detection, diagnostic classification, therapeutic stratification, and prognostic evaluation in GC. Advances in proteomics and high-throughput sequencing continue to reveal new actionable pathways (25), thereby supporting the implementation of precision medicine approaches. Targeted therapeutics such as trastuzumab, ruxolitinib, and pacmilimab exemplify the transition toward molecularly guided interventions. Bioinformatics analyses in the present study identified PRSS1 as a gene markedly overexpressed in GC, with its elevated expression correlating strongly with unfavorable clinical outcomes. Previous reports show that germline or somatic PRSS1 mutations predispose individuals to hereditary pancreatitis and pancreatic ductal adenocarcinoma (PDAC) (26,27), conferring more aggressive tumor behavior and poorer prognosis (28,29). Additionally, PRSS1 alterations have been implicated in heightened risk and poor prognosis in colorectal, thyroid, and ovarian malignancies, significantly worsening prognosis in colorectal and thyroid cancers, and potentially augmenting platinum-based chemoresistance in ovarian cancer (30-33). These findings underscore PRSS1 as a promising molecular target for elucidating disease mechanisms and refining therapeutic strategies.

GO enrichment analysis performed in this study demonstrated a significant association between high PRSS1 expression and ECM-receptor interaction pathways. As a critical structural and signaling component of the tumor microenvironment, the ECM is integral to cancer cell invasion, angiogenesis, and metastatic dissemination (34). Invasion and metastasis represent the defining malignant features and major causes of mortality in GC (35). To achieve local invasion and distant spread, tumor cells frequently secrete proteolytic enzymes, particularly MMPs, to degrade the ECM, thereby enabling migration, vascular infiltration, and metastatic colonization (36). This proteolysis also serves as a potent inducer of EMT (37). During EMT, epithelial characteristics such as E-cadherin expression and cell-cell junctions diminish, while mesenchymal attributes such as vimentin expression and enhanced migratory capacity increase (7), facilitating systemic dissemination through blood and lymphatic vessels. EMT also contributes to immune escape and therapeutic resistance, including diminished responsiveness to PD-1/PD-L1 blockade, by increasing cellular plasticity, triggering pro-inflammatory signaling, and fostering an immunosuppressive tumor microenvironment (38,39).

The mitogen-activated protein kinase (MAPK) family encompasses several highly conserved serine/threonine kinases that integrate extracellular signals into cellular responses. This pathway typically involves a three-tiered phosphorylation cascade comprising MAPKKK, MAPKK, and MAPK (40). Five major branches have been described, including ERK1/2, JNK1/2/3, p38 MAPK (α, β, γ, δ), ERK5, and ERK3/4. Dysregulation of the ERK/MEK axis has been linked to enhanced invasion, metastasis, cytoskeletal remodeling, and adhesion turnover, frequently mediated by epidermal growth factor receptor (EGFR) signaling (41). Recent studies have further demonstrated that activation of the MAPK/ERK pathway promotes GC dissemination and progression (42,43). On the basis of these insights, it was hypothesized that PRSS1 modulates the MAPK/ERK pathway. Supporting this view, Western blot analyses in the present study revealed that silencing PRSS1 led to pronounced reductions in phosphorylated and total forms of p38 and ERK1/2.

Collectively, the present findings show that PRSS1 is markedly overexpressed in GC tissues and in patient sera, with levels rising further in advanced-stage disease, suggesting its potential as a minimally invasive early-diagnostic biomarker. Functional assays demonstrated that PRSS1 depletion significantly inhibited GC cell migration and invasion. Network and experimental analyses further revealed that PRSS1 is closely associated with MMP family members, and that its knockdown reduces MMP2 and MMP9 expression, attenuates EMT, and diminishes MAPK/ERK signaling activity. Taken together, these results support a model in which PRSS1 acts as an oncogenic driver promoting GC invasion and metastasis by orchestrating MMP expression, EMT progression, and MAPK/ERK pathway activation.

This study has several limitations. The sample size and GC clinical data were restricted by specimen availability, informed consent, and ethical approval requirements. Furthermore, the lack of Lauren classification data prevented analysis of PRSS1 expression according to subtype. Moreover, due to limited clinical follow-up information in the GEO datasets, the prognostic value of PRSS1 was primarily assessed based on TCGA data, and further validation in independent, large-scale cohorts is needed. Future research should expand the clinical database to address these limitations. Additionally, the use of ether anesthesia and cervical dislocation did not comply with current animal welfare standards, and future studies should use isoflurane anesthesia and euthanasia under deep anesthesia. Due to funding and facility constraints, comprehensive experiments could not be undertaken. Consequently, the precise molecular associations between PRSS1 and MMP regulation, as well as between MAPK/ERK signaling and the EMT, were not identified. Elucidation of the involvement of these pathways could provide novel insights and therapeutic targets for the management of GC.

Conclusions

PRSS1 is significantly overexpressed in GC and is associated with an unfavorable prognosis. The gene may promote tumor invasion and metastasis by induction of the EMT and activation of the MAPK/ERK signaling pathway. These findings suggest potential therapeutic strategies for targeted clinical interventions in GC.

Acknowledgments

None.

Footnote

Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0161/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0161/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0161/prf

Funding: This work was supported by the Nantong Municipal Health Commission Subject Project (No. MSZ2023015).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-1-0161/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Institutional Ethics Committee of Nantong First People’s Hospital (No. 2023KT155). All participants provided written informed consent. All animal experiments were performed under a project license (No. 2024-01474) granted by the Animal Ethics Committee of the Medical School of Nantong University, in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978).

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Ajani JA, D'Amico TA, Bentrem DJ, et al. Gastric Cancer, Version 2.2025, NCCN Clinical Practice Guidelines In Oncology. J Natl Compr Canc Netw 2025;23:169-91. [Crossref] [PubMed]
2. Coburn N, Cosby R, Klein L, et al. Staging and surgical approaches in gastric cancer: A systematic review. Cancer Treat Rev 2018;63:104-15. [Crossref] [PubMed]
3. Puneet, Kazmi HR, Kumari S, et al. Epigenetic Mechanisms and Events in Gastric Cancer-Emerging Novel Biomarkers. Pathol Oncol Res 2018;24:757-70.
4. Wadhwa R, Song S, Lee JS, et al. Gastric cancer-molecular and clinical dimensions. Nat Rev Clin Oncol 2013;10:643-55. [Crossref] [PubMed]
5. Abbas M, Faggian A, Sintali DN, et al. Current and future biomarkers in gastric cancer. Biomed Pharmacother 2018;103:1688-700. [Crossref] [PubMed]
6. Matsuoka T, Yashiro M. Biomarkers of gastric cancer: Current topics and future perspective. World J Gastroenterol 2018;24:2818-32. [Crossref] [PubMed]
7. Eble JA, Niland S. The extracellular matrix in tumor progression and metastasis. Clin Exp Metastasis 2019;36:171-98. [Crossref] [PubMed]
8. Glentis A, Oertle P, Mariani P, et al. Cancer-associated fibroblasts induce metalloprotease-independent cancer cell invasion of the basement membrane. Nat Commun 2017;8:924. [Crossref] [PubMed]
9. Abbaszadegan MR, Mojarrad M, Moghbeli M. Role of extra cellular proteins in gastric cancer progression and metastasis: an update. Genes Environ 2020;42:18. [Crossref] [PubMed]
10. Szmola R, Sahin-Tóth M. Uncertainties in the classification of human cationic trypsinogen (PRSS1) variants as hereditary pancreatitis-associated mutations. J Med Genet 2010;47:348-50. [Crossref] [PubMed]
11. Teich N, Rosendahl J, Tóth M, et al. Mutations of human cationic trypsinogen (PRSS1) and chronic pancreatitis. Hum Mutat 2006;27:721-30. [Crossref] [PubMed]
12. Zeng K, Liu QC, Lin JH, et al. Novel mutations of PRSS1 gene in patients with pancreatic cancer among Han population. Chin Med J (Engl) 2011;124:2065-7.
13. McWilliams RR, Bamlet WR, de Andrade M, et al. Polymorphic variants in hereditary pancreatic cancer genes are not associated with pancreatic cancer risk. Cancer Epidemiol Biomarkers Prev 2009;18:2549-52. [Crossref] [PubMed]
14. Rosendahl J, Landt O, Bernadova J, et al. CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated? Gut 2013;62:582-92. [Crossref] [PubMed]
15. Whitcomb DC, LaRusch J, Krasinskas AM, et al. Common genetic variants in the CLDN2 and PRSS1-PRSS2 loci alter risk for alcohol-related and sporadic pancreatitis. Nat Genet 2012;44:1349-54. [Crossref] [PubMed]
16. Ye D, Li Y, Zhang H, et al. Silencing PRSS1 suppresses the growth and proliferation of gastric carcinoma cells via the ERK pathway. Int J Biol Sci 2021;17:957-71. [Crossref] [PubMed]
17. Wang F, Li P, Feng Y, et al. Low expression of RASSF10 is associated with poor survival in patients with colorectal cancer. Hum Pathol 2017;62:108-14. [Crossref] [PubMed]
18. Liu J, Lichtenberg T, Hoadley KA, et al. An Integrated TCGA Pan-Cancer Clinical Data Resource to Drive High-Quality Survival Outcome Analytics. Cell 2018;173:400-416.e11. [Crossref] [PubMed]
19. Chia NY, Tan P. Molecular classification of gastric cancer. Ann Oncol 2016;27:763-9. [Crossref] [PubMed]
20. Liu X, Chu KM. E-cadherin and gastric cancer: cause, consequence, and applications. Biomed Res Int 2014;2014:637308. [Crossref] [PubMed]
21. McLean MH, El-Omar EM. Genetics of gastric cancer. Nat Rev Gastroenterol Hepatol 2014;11:664-74. [Crossref] [PubMed]
22. Lambert AW, Pattabiraman DR, Weinberg RA. Emerging Biological Principles of Metastasis. Cell 2017;168:670-91. [Crossref] [PubMed]
23. Nieto MA, Huang RY, Jackson RA, et al. EMT: 2016. Cell 2016;166:21-45. [Crossref] [PubMed]
24. Huang Y, Hong W, Wei X. The molecular mechanisms and therapeutic strategies of EMT in tumor progression and metastasis. J Hematol Oncol 2022;15:129. [Crossref] [PubMed]
25. Krug K, Jaehnig EJ, Satpathy S, et al. Proteogenomic Landscape of Breast Cancer Tumorigenesis and Targeted Therapy. Cell 2020;183:1436-1456.e31. [Crossref] [PubMed]
26. Whitcomb DC, Gorry MC, Preston RA, et al. Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet 1996;14:141-5. [Crossref] [PubMed]
27. Sikdar N, Saha G, Dutta A, et al. Genetic Alterations of Periampullary and Pancreatic Ductal Adenocarcinoma: An Overview. Curr Genomics 2018;19:444-63. [Crossref] [PubMed]
28. Liu Q, Guo L, Zhang S, et al. PRSS1 mutation: a possible pathomechanism of pancreatic carcinogenesis and pancreatic cancer. Mol Med 2019;25:44. [Crossref] [PubMed]
29. Wu H, Ding F, Chen X, et al. PRSS1 genotype is associated with prognosis in patients with pancreatic ductal adenocarcinoma. Oncol Lett 2020;19:121-6. [Crossref] [PubMed]
30. Erinjeri NJ, Nicolson NG, Deyholos C, et al. Whole-Exome Sequencing Identifies Two Discrete Druggable Signaling Pathways in Follicular Thyroid Cancer. J Am Coll Surg 2018;226:950-959.e5. [Crossref] [PubMed]
31. Koskensalo S, Hagström J, Louhimo J, et al. Tumour-associated trypsin inhibitor TATI is a prognostic marker in colorectal cancer. Oncology 2012;82:234-41. [Crossref] [PubMed]
32. Petrovchich I, Ford JM. Genetic predisposition to gastric cancer. Semin Oncol 2016;43:554-9. [Crossref] [PubMed]
33. Xing L, Tian S, Mi W, et al. PRSS1 Upregulation Predicts Platinum Resistance in Ovarian Cancer Patients. Front Cell Dev Biol 2020;8:618341. [Crossref] [PubMed]
34. Yuzhalin AE, Lim SY, Kutikhin AG, et al. Dynamic matrisome: ECM remodeling factors licensing cancer progression and metastasis. Biochim Biophys Acta Rev Cancer 2018;1870:207-28. [Crossref] [PubMed]
35. Fidler IJ. Critical determinants of metastasis. Semin Cancer Biol 2002;12:89-96. [Crossref] [PubMed]
36. Kapoor C, Vaidya S, Wadhwan V, et al. Seesaw of matrix metalloproteinases (MMPs). J Cancer Res Ther 2016;12:28-35. [Crossref] [PubMed]
37. Piperigkou Z, Manou D, Karamanou K, et al. Strategies to Target Matrix Metalloproteinases as Therapeutic Approach in Cancer. Methods Mol Biol 2018;1731:325-48. [Crossref] [PubMed]
38. Jiang Y, Zhan H. Communication between EMT and PD-L1 signaling: New insights into tumor immune evasion. Cancer Lett 2020;468:72-81. [Crossref] [PubMed]
39. Shrestha R, Prithviraj P, Bridle KR, et al. Combined Inhibition of TGF-β1-Induced EMT and PD-L1 Silencing Re-Sensitizes Hepatocellular Carcinoma to Sorafenib Treatment. J Clin Med 2021;10:1889. [Crossref] [PubMed]
40. Plotnikov A, Zehorai E, Procaccia S, et al. The MAPK cascades: signaling components, nuclear roles and mechanisms of nuclear translocation. Biochim Biophys Acta 2011;1813:1619-33. [Crossref] [PubMed]
41. Yang M, Huang CZ. Mitogen-activated protein kinase signaling pathway and invasion and metastasis of gastric cancer. World J Gastroenterol 2015;21:11673-9. [Crossref] [PubMed]
42. Liu J, Zhang Y, Yan L, et al. 3,3'-Diindolylmethane blocks the dissemination of gastric cancer cells in the peritoneal cavity through the MFGE8-MAPK/ERK signaling pathway. Cancer Cell Int 2025;26:42. [Crossref] [PubMed]
43. Zhang Y, Wang Q, He D, et al. TMEM176A drives anti-apoptotic signaling through TGM2-mediated ERK activation in gastric cancer. Int Immunopharmacol 2026;168:115798. [Crossref] [PubMed]