METTL17 promotes gastric cancer progression via inhibiting glycogen synthase kinase-3β to activate Wnt/β-catenin signaling

Introduction

Gastric cancer (GC) is a prevalent and highly malignant neoplasm, ranking fifth globally in incidence and mortality among all malignant tumors (1), with an overall 5-year survival rate of merely 5% (2). Identifying novel and effective therapeutic targets alongside biomarkers for early detection is crucial for improving treatment outcomes in GC.

Integrated genomic profiling has revealed that dysregulation of the Wnt/β-catenin pathway occurs in approximately 46% of GC cases (3). The activation status of the canonical Wnt/β-catenin signaling pathway is a key regulator of multiple malignant biological behaviors in tumors, including cell proliferation, migration and invasion (4,5). β-catenin acts as the core component of the Wnt pathway (6), and its intracellular level is tightly regulated by the destruction complex containing glycogen synthase kinase-3β (GSK-3β). In the absence of Wnt signaling, cytoplasmic β-catenin is phosphorylated by GSK-3β and subsequently undergoes ubiquitination and degradation via the destruction complex (7). Upon pathway activation, GSK-3β is inhibited, enabling cytoplasmic β-catenin to accumulate, translocate to the nucleus and initiate a cascade of downstream transcriptional events (8).

METTL17, a member of the methyltransferase-like (METTL) family, is a mitochondrial protein predicted to target m⁴C, m⁵C, m³C, m⁷G and m⁶A modifications of mitochondrial RNA (mt-RNA). Through this mechanism, it modulates the translational efficiency of mitochondrial protein-coding genes, thereby maintaining mitochondrial homeostasis and cellular energy metabolism (9,10). Research has revealed that METTL17 promotes the progression of cancers such as oral cancer, breast cancer, colorectal cancer, and osteosarcoma through mechanisms including activation of the JAK1/STAT3 signaling pathway (11), interaction with the estrogen receptor (12), and regulation of cancer cell sensitivity to ferroptosis (10). However, the expression status and biological functions of METTL17 in GC remain unknown. Investigating the role of METTL17 in GC development and its epigenetic mechanisms may yield novel biomarkers and therapeutic targets for this cancer.

The present study was designed to elucidate the functional role of METTL17 in GC. We first compared METTL17 expression levels between GC cells and normal gastric epithelial cells, and further analyzed the correlation between METTL17 expression and the clinicopathological characteristics of GC patients to explore its prognostic significance in this patient cohort. Additionally, the effects of METTL17 on GC cell biological behaviors were evaluated via a series of in vitro and in vivo experiments. Ultimately, we identified that METTL17 may modulate GC progression by regulating GSK-3β and thereby activating the Wnt/β-catenin signaling pathway. Collectively, our findings demonstrate that METTL17 has the potential to serve as a novel prognostic biomarker and a promising therapeutic target for GC patients in clinical practice. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0785/rc).

Methods

Cell culture

Human GC cell lines (MKN1, HGC-27, AGS, MKN7), human gastric mucosal epithelial cells (GES1) and HEK293T cells were obtained from Shanghai Yaji Biotechnology Co., Ltd. Cells were cultured in DMEM medium (Gibco, USA, C11995500BT), supplemented with 10% fetal bovine serum (Gibco, USA, A5256701) and 1% penicillin/streptomycin (Gibco, USA, 15640055). All cell lines were maintained at 37 °C, 5% CO₂.

Clonogenic assay

Seed cells into a 6-well plate at a density of 1,000 cells per well, and change the culture medium every 3 days. After 14 days, fix the cells with methanol for 30 minutes, stain with 0.1% crystal violet solution for 20 minutes, wash with phosphate buffered saline (PBS), and photograph. All experiments were repeated three times.

Wound-healing assay

Seed cells into a 6-well plate at a density of 3×10⁵ cells per well. When cell confluence reaches 90%, use a pipette tip to create a straight scratch. Remove the suspended cells and replace the medium with serum-free medium. At 0 and 24 hours after scratching, capture images of the scratch at the same location under a microscope. All experiments were repeated three times.

Lentiviral transduction

All plasmids used in this study were purchased from Shanghai GeneChem Co., Ltd. Specifically, recombinant lentiviral vectors for METTL17 knockdown and overexpression were constructed based on the GV493 and GV492 lentiviral vectors, respectively. The recombinant vectors were co-transfected with a lentiviral packaging helper plasmid into HEK293T cells. Cell supernatants were collected 48 hours later, filtered through a 0.45 µm membrane filter, and then centrifuged to concentrate the solution. The resulting high-titer recombinant lentivirus was aliquoted and stored at −80 °C.

Quantitative polymerase chain reaction (qPCR)

Following the instructions, total cellular RNA was extracted using an RNA isolation kit (Vazyme, China, RC122-01), and cDNA was synthesized using a reverse transcription kit (Vazyme, China, R412-01) with the RNA sample as a template. The resulting cDNA was used to prepare reaction mixtures with qPCR reaction reagents (Vazyme, China, Q712-02), and quantitative real-time polymerase chain reaction (qRT-PCR) was performed on a Thermo 7500 Fast real-time PCR system (Thermo Fisher Scientific, USA). The relative expression levels of the target genes were calculated using the 2^−ΔΔCq method. Primer information: METTL17 forward primer: CATCCCCTTCAGCTGGAACA, reverse primer: GACAGGCTGAGTGATACGGG. GAPDH forward primer: GGAGCGAGATCCCTCCAAAAT, reverse primer: GGCTGTTGTCATACTTCTCATGG.

Western blot

When cell confluence reaches 80–90%, harvest the cells and lyse them with RIPA lysis buffer (Biosharp, China) for 30 minutes. Centrifuge to collect the supernatant, add protein loading buffer (Biosharp, China), and heat at 95 °C for 10 minutes. Equal volumes of protein were subjected to sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to a membrane, and blocked with skim milk, followed by incubation with primary and secondary antibodies, respectively. Protein bands were visualized using an enhanced chemiluminescence assay. Antibody information: GAPDH (1:10000, Proteintech, 10494-1-AP), METTL17 (1:1000, BOSTER, A14339-1), GSK-3β (1:2000, Abmart, MT3006), β-catenin (1:1000, Abmart, M24002).

Cell counting kit-8 (CCK-8) cell proliferation assay

Cells were seeded into 96-well plates at a density of 3×10³ cells per well and cultured overnight to allow adherence. At 24, 48, and 72 hours after treatment, CCK-8 reagent (Beyotime, C0037) was added according to the manufacturer’s instructions. Following incubation for 2 hours in the cell incubator under light protection, the absorbance at 450 nm was measured using a microplate reader (BIO-DL, 51711011). All experiments were performed in triplicate.

Transwell migration and invasion assay

When cell confluence reached 80–90%, the cells were digested and centrifuged, then resuspended in serum-free medium. A total of 3×10⁴ cells were seeded into the upper chamber of the Transwell (some with Matrigel, some without) (Corning, CLS3415-48EA), while the lower chamber was filled with medium containing 20% fetal bovine serum. After 24 hours of culture, the cells were fixed with methanol for 20 minutes, then stained with 0.1% crystal violet for 20 minutes. The upper chamber was gently wiped with a cotton swab, and photographs were taken and cell counts performed under a microscope. All experiments were repeated three times.

Human gastric tissue samples

The pathological specimens used in this study were obtained from Bayannur Hospital. None of the patients had received chemotherapy or radiotherapy prior to surgery or biopsy. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Bayannur Hospital (No. BSYY2008086). Written informed consent was obtained from all participants.

Tissue microarray (TMA) construction and immunohistochemistry (IHC)

Preparation of TMA: gastric tissue samples were fixed in 10% formalin, dehydrated, and embedded in paraffin. 4-µm-thick sections were prepared and set aside for use.

IHC: sections were deparaffinized and rehydrated, followed by antigen retrieval using citrate buffer. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide (H₂O₂), and non-specific binding was blocked with 5% bovine serum albumin (BSA). After incubation with primary and secondary antibodies, 3,3'-diaminobenzidine (DAB) staining was performed, followed by hematoxylin counterstaining, dehydration, and mounting for microscopic observation.

Result evaluation: staining results were scored blindly by two experienced pathologists using a double-blind method. A total score ≥3 was defined as positive expression, and <3 as negative. All experiments were repeated 3 times to ensure reliability.

Subcutaneous tumor model

BALB/c immunodeficient nude mice (6-week-old, male, Vital River) were used, with 6 mice in each group. Tumor cells in the logarithmic growth phase were adjusted to a concentration of 1×10⁷ cells/ml, and 150 µL of the cell suspension was subcutaneously injected into the back of each nude mouse. At the end of the experiment, mice were euthanized, and subcutaneous tumors were dissected, weighed, and photographed. Animal experiments were performed under a project license (No. YKD202401136) granted by the Ethics Committee of Bayannur Hospital, in compliance with institutional guidelines for the care and use of animals. A protocol was prepared before the study without registration.

Astral-data-independent acquisition (DIA) quantitative proteomics analysis

MKN1 cells from METTL17 knockdown and CTRL control groups (3 biological replicates per group) were harvested for total protein extraction, followed by protein quantification, tryptic digestion and desalination. Narrow-window DIA (nDIA/Astral-DIA) was performed on an Orbitrap Astral high-resolution mass spectrometer to acquire raw proteomic mass spectrometry data. DIA-NN software was applied for protein identification by database searching against the human Uniprot database. Gene Ontology [GO, including molecular function, cellular component and biological process (BP)] and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were conducted for differentially expressed proteins, with enrichment significance calculated via the hypergeometric test.

METTL17 expression in database

In the present study, clinical and transcriptomic data of GC patients were retrieved from The Cancer Genome Atlas (TCGA) database, including 50 normal gastric mucosa tissue samples and 350 primary gastric adenocarcinoma tumor samples. To precisely characterize gene expression alterations during malignant transformation, an additional 30 paired samples (tumor tissues and adjacent normal tissues from the same patients) were incorporated into the analysis. Subsequent data processing was performed using the Pandas library in Python, statistical tests were conducted via SciPy, and data visualization was implemented with Matplotlib and Seaborn libraries.

Statistical analysis

All experimental data in this study were analyzed and plotted using SPSS 19.0 and GraphPad Prism 8.0. Comparisons of measured data among multiple groups were performed using one-way analysis of variance (ANOVA), with pairwise comparisons between groups conducted using the LSD-t test; comparisons of measured data between two groups were performed using the independent samples t-test; comparisons of categorical data were performed using the chi-square test (χ² test). Spearman’s rank correlation analysis was used to assess the correlation between immunohistochemical (IHC) staining results and clinical pathological characteristics. All experiments were independently repeated three times, and a P value <0.05 was considered statistically significant.

Results

METTL17 expression in the TCGA-Stomach Adenocarcinoma (STAD) database

We first used Python to analyze METTL17 expression levels in STAD patients from the TCGA database. Compared with normal gastric tissue, METTL17 mRNA expression was significantly upregulated in GC tissue (P<0.05) (Figure 1A). Within the same patient, METTL17 mRNA levels were higher in tumor tissue than in adjacent normal tissue (P<0.05) (Figure 1B). METTL17 mRNA levels increased progressively from tumor stage T1 to T4 (P<0.05) (Figure 1C). Kaplan-Meier survival analysis indicated that high METTL17 mRNA expression was associated with poor prognosis in GC patients (P<0.05) (Figure 1D). Subsequently, we used qRT-PCR and Western blotting to detect METTL17 mRNA and protein expression in the normal gastric mucosal epithelial cell line GES1 and GC cell lines (HGC-27, MKN1, AGS and MKN7). Compared with GES1 cells, both mRNA and protein levels of METTL17 were significantly higher in HGC-27, MKN1, AGS and MKN7 cells (P<0.001) (Figure 1E,1F). Representative images showing no expression, low expression, and high expression of METTL17 in GC tissue samples by IHC (scale bar =50 µm) (Figure 1G).

Figure 1 METTL17 expression in the TCGA-STAD database. (A) Based on the TCGA database, the mRNA expression level of METTL17 was significantly higher in GC tissues than in normal gastric tissues (P<0.05). (B) Paired sample analysis showed that METTL17 mRNA expression in tumor tissues was significantly higher than that in matched adjacent normal tissues from the same GC patients (P<0.05). (C) METTL17 mRNA expression gradually increased with the progression of pathological T stage (T1–T4) (P<0.05). (D) Kaplan-Meier survival analysis revealed that patients in the METTL17 mRNA high-expression group had a significantly shorter overall survival than those in the low-expression group. (E,F) qRT-PCR and Western blotting demonstrated that the mRNA and protein expression levels of METTL17 were significantly higher in GC cell lines (HGC-27, MKN1, AGS and MKN7) than in the normal gastric mucosal epithelial cell line GES1 (P<0.05). (G) Representative images showing no expression, low expression, and high expression of METTL17 in GC tissue samples as determined by IHC (scale bar =50 µm). ***, P<0.001; ****, P<0.0001. GC, gastric cancer; GES1, gastric epithelial strain 1; IHC, immunohistochemistry; mRNA, messenger RNA; qRT-PCR, quantitative reverse transcription polymerase chain reaction; STAD, Stomach Adenocarcinoma; T, tumor; TCGA, The Cancer Genome Atlas; TNM, tumor-node-metastasis.

Correlation between METTL17 expression and clinicopathological features

TMA IHC analysis revealed that METTL17 was highly expressed in GC tissues, whereas expression was weak in adjacent non-tumor tissues (P<0.001) (Table S1). High METTL17 expression was associated with tumor invasion depth (P<0.001), distant metastasis (P<0.001), and TNM staging (P<0.001) (Table 1).

High METTL17 expression correlates with adverse prognosis in GC patients

We evaluated the clinical prognosis of GC patients using multivariate analysis. The results showed that METTL17 protein expression (P<0.001), differentiation grade (P<0.001), distant metastasis (P<0.001), and TNM staging (P<0.001) were all independent prognostic factors for GC patients (Figure 2, Table S2). These findings suggest that METTL17 expression can serve as an independent prognostic biomarker for GC patients and provides valuable insights for predicting patient prognosis.

Figure 2 High METTL17 expression correlates with adverse prognosis in GC patients. (A) Kaplan-Meier survival curves show that GC patients with high METTL17 expression have a significantly shorter overall survival than those with low METTL17 expression (log-rank test: χ²=119.159, P<0.001). (B) Kaplan-Meier survival curves show that GC patients with poor differentiation have a significantly shorter overall survival than those with well/moderate differentiation (log-rank test: χ²=13.339, P=0.001). (C) Kaplan-Meier survival curves show that GC with distant metastasis (M1) have a significantly shorter overall survival than those without distant metastasis (M0) (log-rank test: χ²=223.322, P<0.001). (D) Kaplan-Meier survival curves show that the overall survival of GC patients decreases with advanced TNM stage (log-rank test: χ²=99.606, P<0.001). GC, gastric cancer; TNM, tumor-node-metastasis.

METTL17 knockdown inhibits malignant biological behaviors of MKN1 cells in vitro and in vivo

To investigate the functional role of METTL17 in GC cells, we knocked down METTL17 expression in the GC cell line MKN1 and validated the knockdown using qRT-PCR and Western blotting (P<0.001) (Figure 3A,3B). We then used the CCK-8 assay to assess changes in the proliferative capacity of MKN1 cells following METTL17 knockdown (P<0.01) (Figure 3C), the wound healing assay to evaluate changes in cell migration (P<0.01) (Figure 3D), the Transwell assay to measure changes in cell migration vand invasion (P<0.01) (Figure 3E), and the colony formation assay to determine changes in single-cell proliferation capacity (P<0.05) (Figure 3F). These experiments demonstrated that, compared with the control group, MKN1 cells with METTL17 knockdown (shMETTL17) exhibited significantly reduced proliferation, migration, and invasion capabilities. Subsequently, to determine the role of METTL17 in GC progression in vivo, we established a tumor xenograft model in nude mice. The results showed that, compared with the control group, tumor volume and weight were significantly reduced in the METTL17 knockdown group (P<0.001) (Figure 3G).

Figure 3 Knockdown of METTL17 suppresses the malignant biological behaviors of MKN1 cells in vitro and in vivo. (A,B) qRT-PCR and Western blot analyses confirmed the successful knockdown of METTL17 in MKN1 cells. (C) CCK-8 assay showed that the proliferation of MKN1 cells was significantly decreased after METTL17 knockdown. (D) Wound healing assay showed that the migration ability of MKN1 cells was significantly decreased after METTL17 knockdown. Scale bar: 500 µm. (E) Transwell migration and invasion assays showed that the migration and invasion abilities of MKN1 cells were significantly decreased after METTL17 knockdown. Invaded cells were stained with crystal violet. Scale bar: 100 µm. (F) Colony formation assay showed that the colony formation ability of MKN1 cells was significantly decreased after METTL17 knockdown. Cell colonies were fixed with methanol and stained with 0.1% crystal violet. (G) Xenograft tumor assay showed that the tumorigenicity of MKN1 cells in vivo was significantly decreased after METTL17 knockdown (left panel: representative images of xenograft tumors; right panel: quantitative analysis of tumor weight). *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001; ns, not significant. CCK-8, cell counting kit-8; NC, negative control; qRT-PCR, quantitative reverse transcription polymerase chain reaction.

METTL17 overexpression promotes malignant biological behaviors of HGC-27 cells in vitro and in vivo

To validate these findings, we overexpressed METTL17 in HGC-27 cells. qRT-PCR and Western blotting experiments confirmed successful overexpression (P<0.001) (Figure 4A,4B). CCK-8 assays indicated that METTL17 overexpression enhanced the proliferation of GC cells (P<0.001) (Figure 4C); wound healing assays demonstrated increased cell migration capacity (P<0.001) (Figure 4D); Transwell assays revealed elevated cell migration and invasion capabilities (P<0.001) (Figure 4E); and colony formation assays revealed enhanced single-cell proliferation capacity (P<0.001) (Figure 4F). Consistent with these findings, the tumor xenograft model showed that, compared with the control group, both the volume and weight of subcutaneous tumors in METTL17-overexpressing mice were significantly increased (P<0.001) (Figure 4G).

Figure 4 Overexpression of METTL17 promotes the malignant biological behaviors of HGC-27 cells in vitro and in vivo. (A,B) qRT-PCR and Western blot analyses confirmed the successful overexpression of METTL17 in HGC-27 cells. (C) CCK-8 assay showed that the proliferation of HGC-27 cells was significantly increased after METTL17 overexpression. (D) Wound healing assay showed that the migration ability of HGC-27 cells was significantly increased after METTL17 overexpression. Scale bar: 500 µm. (E) Transwell migration and invasion assays showed that the migration and invasion abilities of HGC-27 cells were significantly increased after METTL17 overexpression. Invaded cells were stained with crystal violet. Scale bar: 100 µm (×200). (F) Colony formation assay showed that the colony formation ability of HGC-27 cells was significantly increased after METTL17 overexpression. Cell colonies were fixed with methanol and stained with 0.1% crystal violet. (G) Xenograft tumor assay showed that the tumorigenicity of HGC-27 cells in vivo was significantly increased after METTL17 overexpression (left panel: representative images of xenograft tumors; right panel: quantitative analysis of tumor weight). ***, P<0.001; ****, P<0.0001; ns, not significant. CCK-8, cell counting kit-8; NC, negative control; OE, overexpression; qRT-PCR, quantitative reverse transcription polymerase chain reaction.

METTL17 activates the Wnt/β-catenin signaling pathway by regulating GSK-3β in MKN1 and HGC-27 cells

To explore the downstream molecules and signaling pathways regulated by METTL17 in GC metastasis, Astral-DIA quantitative proteomics analysis was performed on METTL17-knockdown MKN1 cells and control cells, with three biological replicates per group. Differential analysis identified 74 upregulated proteins and 66 downregulated proteins (Figure 5A). Subcellular localization analysis of differentially expressed proteins (DEPs) showed that DEPs were mainly enriched in the nucleus and cytoplasm (Figure 5B). Notably, GSK-3β was significantly differentially expressed between the two groups, with higher levels in the shMETTL17 group (P<0.05) (Figure 5C,5D). Docking models based on the GRAMM platform predicted that GSK-3β protein could interact with METTL17 protein at the putative binding site (Figure 5E). To validate the potential interaction between METTL17 and GSK-3β predicted by molecular docking, we conducted reciprocal co-immunoprecipitation assays in MKN1 cells. The results demonstrate that METTL17 directly interacts with GSK-3β in GC cells (Figure 5F).

Figure 5 METTL17 activates the Wnt/β-catenin signaling pathway by regulating GSK-3β in MKN1 and HGC-27 cells. (A) Bar chart of differentially expressed protein counts. (B) Bar chart of subcellular localization analysis for DEPs. (C) Correlation heatmap. (D) Box plot. (E) Molecular docking model generated by the GRAMM platform, predicting the interaction between METTL17 and GSK-3β protein at specific binding sites. (F) Co-IP assay confirmed the interaction between METTL17 and GSK-3β in MKN1 cells. (G,H) GO-BP and KEGG enrichment analysis showed that DEPs were significantly enriched in BPs such as the canonical Wnt signaling pathway (P<0.05). (I) qRT-PCR analysis revealed that METTL17 knockdown increased GSK-3β mRNA levels in MKN1 cells, while METTL17 overexpression reduced GSK-3β mRNA levels in HGC-27 cells. (J) Western blot assays further showed that METTL17 knockdown in MKN1 cells upregulated GSK-3β protein expression and downregulated β-catenin protein expression. Conversely, METTL17 overexpression in HGC-27 cells exerted the opposite effects. *, P<0.05; **, P<0.01; ****, P<0.0001. Co-IP, co-immunoprecipitation; DEP, differentially expressed protein; GO-BP, Gene Ontology Biological Process; GRAMM, Global Range Alignment for Molecular Modeling; GSK-3β, glycogen synthase kinase-3β; KEGG, Kyoto Encyclopedia of Genes and Genomes; mRNA, messenger ribonucleic acid; NC, negative control; OE, overexpression; qRT-PCR, quantitative reverse transcription polymerase chain reaction.

To decipher the core biological functions and key signaling pathways involved in DEPs induced by METTL17 knockdown, GO-BP enrichment analysis and KEGG pathway enrichment analysis were performed on genes encoding DEPs. GO-BP enrichment analysis showed that DEPs induced by METTL17 knockdown were significantly enriched in BPs such as the canonical Wnt signaling pathway (P<0.05) (Figure 5G). KEGG pathway enrichment analysis also indicated significant enrichment of the Wnt signaling pathway (P<0.05) (Figure 5H), suggesting that METTL17 may affect the malignant phenotype of GC cells by regulating the Wnt signaling pathway.

To validate these findings, we examined the expression levels of GSK-3β and other key factors (β-catenin) in the Wnt signaling pathway following METTL17 knockdown or overexpression. METTL17 knockdown upregulated GSK-3β mRNA and protein expression levels and decreased β-catenin protein expression in MKN1 cells. Conversely, METTL17 overexpression decreased the expression levels of GSK-3β mRNA and protein and increased the protein expression level of β-catenin in HGC-27 cells (Figure 5I,5J).

Discussion

The METTL family of proteins is a sub-family of seven-beta-strand (7BS) methyltransferases, harboring S-adenosylmethionine-binding domains that mediate the modification of DNA, RNA, and proteins. Methylation by METTL proteins contributes to epigenetic regulation, while their RNA modifications facilitate epitranscriptomic control of multiple BPs (13). METTL proteins exhibit a broad substrate spectrum and are involved in diverse biological events, including tumorigenesis (14) and cardiovascular diseases (15). As a member of the METTL family, METTL17 is a mitochondrial protein that targets m⁴C, m⁵C, m³C, m⁷G, and m⁶A modifications of mt-RNA, playing a pivotal role as a methyltransferase stabilizing mitochondrial ribosomal RNA (10,16). It promotes mitochondrial ribosome assembly, thereby facilitating the differentiation of normal mouse embryonic stem cells (16), and also acts as a checkpoint for Fe-S clusters, exerting a critical function in the translation of Fe-S cluster-containing oxidative phosphorylation (OXPHOS) proteins (17).

Currently, research on METTL17 in malignant tumors remains limited, with only preliminary reports focusing on breast cancer, colorectal cancer, and oral cancer. These studies suggest that METTL17 regulates the malignant biological behavior of cancer cells through various mechanisms, including activation of the JAK1/STAT3 signaling pathway (11), regulation of estrogen receptor and estrogen target gene expression (12), and modulation of mitochondrial translation to mediate ferroptosis (10). In this study, we focused on investigating the role and mechanisms of METTL17 in GC. Through functional assays, including CCK-8 and colony formation assays, conducted after knocking down or overexpressing METTL17 in multiple GC cell lines, we found that METTL17 knockdown and overexpression can inhibit and promote the proliferation, invasion, and migration of GC cells, respectively. Therefore, we conclude that METTL17 plays a key role in promoting GC metastasis.

Dysregulation of the Wnt/β-catenin signaling pathway serves as a key driver of cancer initiation and progression. The canonical Wnt/β-catenin pathway exists in two states: inactive and active. In the inactive state, the intracellular destruction complex composed of GSK-3β, Axin, and APC phosphorylates β-catenin and mediates its ubiquitination and degradation, maintaining low intracellular β-catenin levels and preventing the transcription of downstream target genes (18,19). Conversely, when the pathway is activated, binding of Wnt ligands to their receptors inhibits the activity of the destruction complex, attenuating GSK-3β-mediated phosphorylation of β-catenin. This allows β-catenin to escape degradation, accumulate in the cytoplasm, and translocate to the nucleus to activate the transcription of downstream target genes, ultimately promoting malignant biological behaviors such as proliferation, migration, and invasion of tumor cells (20,21). In the present study, molecular docking models initially suggested that METTL17 may interact with GSK-3β. Western blotting further confirmed that METTL17 knockdown in GC cells upregulated GSK-3β and downregulated β-catenin, whereas METTL17 overexpression exerted the opposite effects. We therefore concluded that METTL17 may promote GC progression by negatively regulating GSK-3β to activate the Wnt/β-catenin signaling pathway.

Despite systematically investigating the biological function and molecular mechanism of METTL17 in GC, the present study has several limitations that warrant further refinement in future research. For example, we performed gene knockdown and overexpression in two separate cell lines in this study. While this design helps minimize the confounding effects of cell-specific intrinsic characteristics on the experimental results, it makes direct comparison between knockdown and overexpression outcomes difficult. In future studies, we will address this limitation by using multiple cell lines and conducting both knockdown and overexpression assays within the same cell line to strengthen the conclusions. Regarding mechanism validation, the specific manner by which METTL17 modulates GSK-3β remains unclear. In subsequent studies, we will explore whether METTL17 exerts its effects through its own methyltransferase activity or by directly binding to GSK-3β to regulate its ubiquitination, degradation, or transcriptional levels.

Conclusions

In summary, this study demonstrates that METTL17 may promote the progression of GC by negatively regulating GSK-3β to activate the Wnt/β-catenin signaling pathway. METTL17 holds promise as a future prognostic biomarker and novel therapeutic target for GC patients.

Acknowledgments

We thank Gabrielle White Wolf, PhD, from Liwen Bianji (Edanz) (www.liwenbianji.cn) for editing the English text of a draft of this manuscript.

Footnote

Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0785/rc

Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0785/dss

Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0785/prf

Funding: This work was supported by grants from National Natural Science Foundation of China (No. 82360117), Central Government Guides Local Science and Technology Development Funds (No. 2024ZY0121), Natural Science Foundation of Inner Mongolia Autonomous Region (Nos. 2024LHMS08021, 2025ZD009, 2024LHMS08069, and 2025LHMS08070), Inner Mongolia Autonomous Region Science and Technology Plan Project (Nos. 2025YFSH0016, 2025YFSH0018, 2025YFSH0113, and 2025YFSH0017), Inner Mongolia Autonomous Region Health Science and Technology Plan Project (Nos. 202202402, 202201625, 202202405, and 202201282), and Key Research and Development Plan Projects of Ningxia Hui Autonomous Region (No. 2022BEG02048).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0785/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Bayannur Hospital (No. BSYY2008086). Written informed consent was obtained from all participants. Animal experiments were performed under a project license (No. YKD202401136) granted by the Ethics Committee of Bayannur Hospital, in compliance with institutional guidelines for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229-63. [Crossref] [PubMed]
2. Joshi SS, Badgwell BD. Current treatment and recent progress in gastric cancer. CA Cancer J Clin 2021;71:264-79. [Crossref] [PubMed]
3. Akhavanfar R, Shafagh SG, Mohammadpour B, et al. A comprehensive insight into the correlation between ncRNAs and the Wnt/β-catenin signalling pathway in gastric cancer pathogenesis. Cell Commun Signal 2023;21:166. [Crossref] [PubMed]
4. Liu J, Xiao Q, Xiao J, et al. Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities. Signal Transduct Target Ther 2022;7:3. [Crossref] [PubMed]
5. Maurice MM, Angers S. Mechanistic insights into Wnt-β-catenin pathway activation and signal transduction. Nat Rev Mol Cell Biol 2025;26:371-88. [Crossref] [PubMed]
6. Wu X, Que H, Li Q, et al. Wnt/β-catenin mediated signaling pathways in cancer: recent advances, and applications in cancer therapy. Mol Cancer 2025;24:171. [Crossref] [PubMed]
7. Kang T, Wang Y, Jiang Y, et al. The SGK3/GSK3β/β-catenin signaling promotes breast cancer stemness and confers resistance to alpelisib therapy. Int J Biol Sci 2025;21:2462-75. [Crossref] [PubMed]
8. Xie F, Lyu Y, Chen B, et al. STK3 is a transcriptional target of YAP1 and a hub component in the crosstalk between Hippo and Wnt signaling pathways during gastric carcinogenesis. Mol Cancer 2025;24:186. [Crossref] [PubMed]
9. Zhang H, Sun F, Jiang S, et al. METTL protein family: focusing on the occurrence, progression and treatment of cancer. Biomark Res 2024;12:105. [Crossref] [PubMed]
10. Li H, Yu K, Hu H, et al. METTL17 coordinates ferroptosis and tumorigenesis by regulating mitochondrial translation in colorectal cancer. Redox Biol 2024;71:103087. [Crossref] [PubMed]
11. Zhang H, Sun F, Ding X, et al. Bufalin targeting METTL17 inhibits the occurrence and metastasis of oral cancer through JAK1/STAT3 signaling pathway. Eur J Med Chem 2026;301:118197. [Crossref] [PubMed]
12. Du P, Yuan B, Cao J, et al. Methyltransferase-like 17 physically and functionally interacts with estrogen receptors. IUBMB Life 2015;67:861-8. [Crossref] [PubMed]
13. Wong JM, Eirin-Lopez JM. Evolution of Methyltransferase-Like (METTL) Proteins in Metazoa: A Complex Gene Family Involved in Epitranscriptomic Regulation and Other Epigenetic Processes. Mol Biol Evol 2021;38:5309-27. [Crossref] [PubMed]
14. Campeanu IJ, Jiang Y, Liu L, et al. Multi-omics integration of methyltransferase-like protein family reveals clinical outcomes and functional signatures in human cancer. Sci Rep 2021;11:14784. [Crossref] [PubMed]
15. Chen J, Wei X, Yi X, et al. RNA Modification by m(6)A Methylation in Cardiovascular Disease. Oxid Med Cell Longev 2021;2021:8813909. [Crossref] [PubMed]
16. Mashkovskaia AV, Mariasina SS, Serebryakova MV, et al. Testing a Hypothesis of 12S rRNA Methylation by Putative METTL17 Methyltransferase. Acta Naturae 2023;15:75-82. [Crossref] [PubMed]
17. Ast T, Itoh Y, Sadre S, et al. METTL17 is an Fe-S cluster checkpoint for mitochondrial translation. Mol Cell 2024;84:359-374.e8. [Crossref] [PubMed]
18. Chen X, Yang M, Luo X, et al. SNHG5 enhances colorectal cancer metastasis through RNA-protein interaction with GNB2 and activation of canonical Wnt signaling. Noncoding RNA Res 2026;17:128-49. [Crossref] [PubMed]
19. Xu H, Zeng S, Wang M, et al. Cytoplasmic SIRT1 enhances the stemness of polyploid giant cancer cells by promoting β-catenin protein stability and nuclear accumulation in ovarian carcinoma upon neoadjuvant chemotherapy. Cancer Lett 2026;639:218193. [Crossref] [PubMed]
20. Nakhaei A, Afshari S, Mohatshami E, et al. Harnessing the connection of the Wnt/beta-catenin pathway and other signaling pathways in glioblastoma multiforme. Crit Rev Oncol Hematol 2026;219:105127. [Crossref] [PubMed]
21. Xu G, Yang Q, Zhang S, et al. Berberine promotes β-catenin ubiquitination and inhibits its nuclear translocation by targeting USP22 in colorectal cancers. Phytomedicine 2026;152:157765. [Crossref] [PubMed]