TRIM32 drives head and neck squamous cell carcinoma progression via TP53 suppression and lysosomal/autophagy dysregulation
Highlight box
Key findings
• TRIM32 expression is significantly elevated in head and neck squamous cell carcinoma (HNSCC) tumour tissues compared to adjacent normal tissues, and higher expression correlates with worse overall survival for patients.
• role in HNSCC: in vitro—knockdown of TRIM32 in HSC-3 and FADU HNSCC cell lines suppressed cell proliferation, migration, and invasion. In vivo—knockdown of TRIM32 inhibited tumour growth in a xenotransplantation model using nude mice.
What is known and what is new?
• TRIM32 expression promotes the initiation and progression of multiple cancer types. The tumour protein 53 (TP53) pathway and autophagy are frequently dysregulated in various cancers, including HNSCC, and this dysregulation drives HNSCC progression.
• We found that TRIM32 plays a critical role in the proliferation, migration, and invasion of HNSCC. TRIM32 expression influences the TP53 pathway and autophagy in HNSCC, thereby affecting HNSCC progression.
What is the implication, and what should change now?
• TRIM32 expression levels could be developed into a clinical prognostic tool to stratify HNSCC patients into high-risk and low-risk groups, aiding in personalized treatment decisions.
• Further studies are needed to clarify the exact molecular mechanism by which TRIM32 regulates TP53 (e.g., is it through direct ubiquitination?) and how this precisely impacts autophagy/lysosomal pathways.
Introduction
Head and neck squamous cell carcinoma (HNSCC) rank as the sixth most common cancer globally, with its incidence continuing to rise. It is projected to cause 1.08 million new cases annually by 2030, representing a 30% increase in the burden of HNSCC patients (1,2). Despite advancements in surgical resection, immunotherapy, and targeted therapies, only marginal improvements have been yielded in in survival outcomes, and recurrence rates and mortality remain persistently high. Consequently, patient prognosis remains suboptimal (3). Further exploration of the molecular mechanisms underpinning HNSCC pathogenesis and progression is therefore imperative to identify novel therapeutic targets and improve patient outcomes.
TRIM32 is a novel oncogene implicated in promoting tumour growth, metastasis, and chemotherapy resistance. It participates in diverse cellular processes, including proliferation, transcriptional regulation, and apoptosis, thereby contributing to tumourigenesis and progression. Wang et al. demonstrated that TRIM32 may antagonise Sonic Hedgehog signalling to promote granule neuron precursors (GNPs) differentiation and medulloblastoma (MB) formation, positioning it as a critical regulatory factor (4). Their findings revealed co-expression of TRIM32 with phosphorylated Signal transducer and activator of transcription 3 (STAT3) in triple-negative breast cancer (TNBC) tissues, with elevated expression levels correlating positively with unfavourable patient prognosis. This suggests TRIM32 as a potential predictive biomarker for radioresistance in TNBC (5).
Paradoxically, TRIM32 also exhibits tumour suppressor functions in certain cancer types, while being overexpressed in others. Emerging evidence supports its involvement in glycolysis-mediated cellular growth, providing a plausible mechanism for biomass accumulation during regeneration and tumourigenesis (6). Overexpression of TRIM32 ameliorates spinal cord injury in mice and suppresses pyroptosis in LPS-treated BV-2 cells (lipopolysaccharide-treated microglial cells). Furthermore, acting as an E3 ligase, TRIM32 promotes ubiquitination of NIMA related kinase 7 (NEK7) at lysine 64 (K64), leading to its downregulation; crucially, inhibition of NEK7 ubiquitination reverses TRIM32-mediated suppression of pyroptosis (7).
Luo et al. identified pivotal roles for TRIM32 and the deubiquitinase ubiquitin specific peptidase 11 (USP11) in controlling ARID1A stability. Depletion of TRIM32 suppresses squamous cell carcinoma (SCC) cell proliferation, metastasis, and chemoresistance by stabilising AT-rich interaction domain 1A (ARID1A). Conversely, depletion of USP11 promotes SCC development through enhanced ARID1A degradation. Their data indicate syndecan-2 (SDC2) as a downstream target of ARID1A and USP11, and SDC2 knockout eliminates the carcinogenic function caused by ARID1A deficiency (8).
This study aims to investigate the influence of TRIM32 on the proliferative, invasive, and apoptotic capacities of HNSCC cells, and to elucidate potential mediating signalling pathways implicated in HNSCC pathogenesis. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0873/rc).
Methods
Clinical sample and data acquisition
The pan-cancer dataset The Cancer Genome Atlas (TCGA) TARGET GTEx (PANCAN, N=19,131, G=60,499) was obtained from the UCSC XenaBrowser database following uniform normalisation. TRIM32 gene expression data were extracted from HNSCC samples within this cohort. Additionally, fifteen paired HNSCC tumour tissues and corresponding normal adjacent tissues were procured from Guangzhou Institute of Cancer Research, the Affiliated Cancer Hospital, Guangzhou Medical University (this includes 8 males and 7 females, all aged between 20–70 years). This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Guangzhou Institute of Cancer Research, the Affiliated Cancer Hospital, Guangzhou Medical University (No. GYZL-2024-KY52). All patients in this study provided informed written consent.
Bioinformatics analysis
R software (version 4.1.0) was employed to analyse TRIM32 expression differences between HNSCC and normal tissues. The survminer package identified the optimal TRIM32 expression cut-off value (2.3953) for stratifying patients into high- and low-expression groups. Survival analysis was subsequently performed. The c2.cp.kegg.v7.4.symbols.gmt subcollection from the Molecular Signatures Database was utilised, with gene set sizes constrained to 5–5,000 genes. Bootstrapping resampling was iterated 1,000 times; statistical significance was defined as P values <0.05 and false discovery rate (FDR) <0.25. Tumour microenvironment scores were computed using the ESTIMATE algorithm (v1.0.13), and immune cell infiltration levels were evaluated via the Timer method from the IOBR package.
Cell culture
HSC-3 (Cell Bank of Chinese Academy of Sciences) and FADU cell lines (American Type Culture Collection, ATCC: HTB-43) were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% foetal bovine serum (FBS; Gibco, New South Wales, Australia) at 37 ℃ under 5% CO2. All cell cultures undergo weekly mycoplasma testing, with consistently negative results to date.
Gene silencing
TRIM32 and tumour protein 53 (TP53) were silenced using small interfering RNAs (siRNAs) (Cas9X, Jiangsu, China). Transfection was performed with Lipofectamine 3000 reagent (Invitrogen, Lithuania, USA) per the manufacturer’s protocol. Briefly, cells were seeded at 70–80% confluence. siRNA-Lipofectamine 3000 complexes were incubated at ambient temperature for 15 min, applied to the culture medium, and replaced with fresh DMEM (10% FBS) after 8 hours. Cells were harvested 48 hours post-transfection.
Cell Counting Kit-8 (CCK-8) assay
Cells were seeded into 96-well plates at ~2×103 cells/well. Following incubation, CCK-8 solution (Beyotime, Shanghai, China) was added to each well in triplicate, followed by incubation at 37 ℃ for 1 hour. Optical density (OD) values were measured using a microplate reader.
Colony formation assay
Cells were seeded in six-well plates at ~1,000 cells/well. After 10 days, colonies were fixed, stained with crystal violet (0.1%), and quantified using an inverted microscope. Experiments were performed in triplicate; data represent mean ± standard deviation (SD).
Wound healing assay
Cells are cultured in a 6-well plate until 95–100% fusion occurs. Use a sterile 200 µL pipette tip to create uniform scratches perpendicular to the pre marked line at the bottom of the plate. After gently washing 2–3 times with PBS to remove all isolated cell debris, the cells were incubated in DMEM supplemented with 1% FBS. Under an inverted phase contrast microscope with the same acquisition parameters, wound closure was imaged in identical pre-labeled areas at 0 and 48 hours.
Transwell invasion assay
Cells were seeded in Matrigel-coated Transwell inserts (8 µm pores; Beyotime, China). After 24 h incubation, migrated cells were fixed in 4% paraformaldehyde, stained with 0.1% crystal violet, and observed under light microscopy.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was isolated from cell cultures using a commercial RNA extraction kit (TIANGEN BIOTECH, Beijing, China), following the manufacturer’s protocol. All procedures were performed under RNase-free conditions to prevent RNA degradation. RNA concentration and purity were quantified using a microplate reader by measuring absorbance at 260 and 280 nm. RNA concentration (µg/mL) was calculated using the formula: RNA concentration = A260 × dilution factor × 40, where A260 =1 corresponds to 40 µg/mL of RNA. RNA purity was assessed by the A260/A280 ratio, with values between 1.8 and 2.0 considered acceptable for downstream applications. Each sample was measured in triplicate to ensure reproducibility. One microgram of total RNA was reverse-transcribed into cDNA using the Primer Script RT Kit (Enzyme-linked Biotechnology Co., Ltd., Shanghai, China), following the manufacturer’s instructions. The reaction included RNase inhibitor to safeguard RNA integrity and was performed at 42 ℃ for 15 min, followed by enzyme inactivation at 85 ℃ for 5 s. The resulting cDNA was diluted 1:5 in nuclease-free water and stored at −20 ℃ until use. Quantitative real-time PCR was performed on a CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) using EvaGreen qPCR Master Mix (Vazyme Biotech, Jiangsu, China). Each quantitative PCR reaction was prepared in a total volume of 20 µL, containing 1 µL of 1:10 diluted cDNA, 10 µL of 2× SYBR Green Master Mix, and 0.8 µL of forward/reverse primer (10 µM each). The amplification protocol consisted of an initial denaturation at 95 ℃ for 30 s, followed by 40 cycles of 95 ℃ for 10 s and 60 ℃ for 30 s, with fluorescence acquisition at the end of each extension step. A melting curve analysis was conducted to confirm amplicon specificity.
Relative gene expression levels were calculated using the 2−ΔΔCt method. with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the endogenous reference gene. All primer sequences used are provided in Table 1.
Table 1
| Gene | Forward primer (5'–3') | Reverse primer (3'–5') |
|---|---|---|
| TRIM32 | GTGGACTCGTCGGAGCC | AGCTCAGAACTGAACAGCACA |
| TP53 | CAGCACATGACGGAGGTTGT | TCATCCAAATACTCCACACGC |
| GAPDH | AGCAAGAGCAAGAGGAAG | GGTTGAGCACAGGGTACTTT |
qRT-PCR, quantitative real-time polymerase chain reaction.
Western blotting
Cells were lysed in Racial and Identity Profiling Act (RIPA) buffer (Beyotime, Shanghai, China) containing protease inhibitors. Protein concentrations were determined using a bicinchoninic acid (BCA) assay kit (Beyotime, Shanghai, China). Equal protein quantities were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene difluoride (PVDF) membranes, and probed with primary antibodies against TRIM32, p53, LAMP1/2, and LC3B (Proteintech, Wuhan, China, 10326-1-AP, 10442-1-AP, 21997-1-AP, 66301-1-Ig, 14600-1-AP), followed by horseradish peroxidase (HRP)-conjugated secondary antibodies (Proteintech, China). Proteins were visualised using an electrochemiluminescence (ECL) substrate kit.
Immunofluorescence
Cells grown on glass coverslips were fixed, permeabilised, and incubated with anti-TRIM32 and anti-p53 antibodies (Proteintech, China). Alexa Fluor conjugated secondary antibodies (Invitrogen, USA) were applied after washing. Images were acquired using a confocal microscope.
Xenotransplantation model
TRIM32-knockdown HSC-3 and FADU cell lines were established using siRNA. Male BALB/c nude mice, aged 6–8 weeks, were purchased from Guangdong Medical Laboratory Animal Center (China, N000020). Based on the power analysis using G * power (v3.1.9.7), a sample size of n=4 was predetermined for each group. Feeding conditions: light and darkness alternated for 12 h, relative humidity 50%±10%, temperature 23±2 ℃, given free access to food and water. A total of 8 mice were randomly divided into 2 cages according to the random number method, with 1 cage for every 4 mice, and kept for 1 week to adapt to the environment before receiving the tumor cells. For the subcutaneous xenograft model, 1×107 cells suspended in 100 µL phosphate-buffered saline (PBS) were injected into the forelimb axilla of each BALB/c nude mice. Mice were anesthetized with pentobarbital intraperitoneal injection, and after confirming successful anesthesia, the mice were euthanized by cervical dislocation. Tumour growth was monitored for 7 days before euthanasia. Tumours were excised, weighed, and processed for histopathology. Tumour control: the tumour weight in the control group is ≤10% of the body weight. Welfare measures: use anesthesia/analgesics throughout the operation and regularly monitor the animal’s condition. This study confirms that the maximum tumour size/burden of the animals has not been exceeded. All animal experiments were conducted at Ruiye Model Animal (Guangzhou) Biotechnology Co., Ltd., under a project license (No. RYEth-20250625807) granted by its Ethics Committee, in compliance with its institutional guidelines for the care and use of animals.
Statistical analysis
Data were analysed using GraphPad Prism 8.0. Continuous variables are expressed as mean ± SD. Group comparisons employed Student’s t-test or one-way analysis of variance (ANOVA) with Tukey’s post-hoc test. Survival curves were generated via the Kaplan-Meier method with log-rank testing. Statistical significance was defined as P<0.05.
Results
TRIM32 exhibits elevated expression in HNSCC tissues, positioning it as a promising prognostic biomarker for this malignancy
The pan-cancer dataset TCGA TARGET GTEx (PANCAN, N=19,131, G=60,499), which had undergone uniform normalisation, was obtained from the UCSC database (https://xenabrowser.net/). We extracted TRIM32 expression data across all samples, revealing significantly higher expression in HNSCC tissues compared to normal head and neck tissues. Notably, a marked difference in TRIM32 expression was observed between HNSCC tumour tissues and their corresponding adjacent normal tissues (Figure 1A-1C). To validate these results, we obtained 15 HNSCC specimens from Guangzhou Institute of Cancer Research, the Affiliated Cancer Hospital, Guangzhou Medical University. Immunohistochemical analysis confirmed that the expression level of TRIM32 in HNSCC tissues was significantly higher than that in paired normal tissues, and the expression level of TRIM32 in stage III–IV patient tissues was significantly higher than that in stage I–II patients (Figure 1D-1F). T-test showed that the expression of TRIM32 was significantly correlated with pathologic T stage (P=0.002), pathologic N stage (P=0.02) and clinical stage (P=0.004, Table 2).
Table 2
| Characteristics | Groups | Number | P value | TRIM32 expression (mean ± SEM) |
|---|---|---|---|---|
| Gender | Female | 7 | 0.10 | 2.14±1.22 |
| Male | 8 | |||
| Pathologic T stage | T1–2 | 9 | 0.002 | 3.61±0.96 |
| T3–4 | 6 | |||
| Pathologic N stage | N0 | 6 | 0.02 | 3.06±1.10 |
| N1–3 | 9 | |||
| HPV | + | 8 | 0.43 | 1.07±1.33 |
| − | 7 | |||
| Smoker | Yes | 10 | 0.08 | 2.40±1.28 |
| No | 5 | |||
| Clinical stage | Stage I–II | 5 | 0.004 | 3.60±1.04 |
| Stage III–IV | 10 |
HNSCC, head and neck squamous cell carcinoma; HPV, human papillomavirus; N, node; SEM, standard error of the mean; T, tumor.
To establish the optimal cut-off value for TRIM32 expression in HNSCC, we conducted additional analyses based on the gene’s expression profile. The cut-off value was determined using criteria requiring minimum subgroup sample size >25% and maximum subgroup sample size <75%, yielding a final threshold of 2.3953. Patients were subsequently stratified into high-risk and low-risk groups based on this value. Using R software, we analysed survival differences between these groups, identifying significant prognostic disparities (P=2.9×103) (Figure 1G). This finding suggests TRIM32’s potential as a prognostic biomarker for HNSCC.
TRIM32 knockdown suppresses proliferation, migration and invasion in HNSCC
To identify the impact of TRIM32 on HNSCC development, we firstly explored the pathway analysis in TCGA samples. According to the expression levels of TRIM32, samples were divided into two groups: a high-expression group (≥50%) and a low-expression group (<50%). To investigate the associated biological pathways and molecular mechanisms, the c2.cp.kegg.v7.4.symbols.gmt gene set was downloaded from the Molecular Signatures Database (http://www.gsea-msigdb.org/gsea/downloads.jsp). Gene Set Enrichment Analysis (GSEA) was performed based on gene expression profiles and phenotypic grouping, with the following parameters: minimum gene set size of 5, maximum gene set size of 5,000, and 1,000 resampling iterations. Both a P value <0.05 and an FDR <0.25 were considered statistically significant. GSEA enrichment analysis identified that TRIM32 expression in HNSCC was significantly associated with the PATHWAYS_IN_CANCER, CELL_CYCLE, and APOPTOSIS biological pathways. These findings suggest that high TRIM32 expression is closely linked to the occurrence, development, proliferation, and apoptosis of HNSCC (Figure 2A).
Then, we disturbed the expression of TRIM32 in HSC-3 and FaDu cell lines to clarify the role of TRIM32 in in vitro cell assays. To validate transfection efficiency, quantitative PCR (qPCR) assays and Western blot (WB) experiments were performed. The results demonstrated that siTRIM32-2 effectively reduced TRIM32 expression in HNSCC cells, with consistent knockdown levels observed (Figure 2B,2C). CCK-8 assays and colony formation assays revealed that knocking down TRIM32 expression in the HSC-3 and FADU cell lines significantly inhibited the proliferation of HNSCC cells (Figure 2D-2F). Additionally, wound healing assays and Transwell invasion experiments showed that TRIM32 knockdown significantly reduced the migration and invasion capabilities of HNSCC cells (Figure 2G-2J). In addition, results from the xenograft tumor model revealed that TRIM32 knockdown inhibited the tumor growth of both HSC-3 and FaDu cell lines in vivo (Figure 2K,2L).
TRIM32 negatively regulates TP53, thereby influencing the proliferation of HNSCC cells
Further studies were carried out to investigate how TRIM32 expression influences the incidence and progression of HNSCC. Previous research has shown that TRIM32 acts as a negative regulator of TP53. GSEA identified a significant correlation between TRIM32 expression levels and the TP53 pathway (Figure 3A). Protein-protein interaction network analysis suggests that there is a potential mutual regulatory relationship between TRIM32 and P53, which influences lysosomal function and autophagy processes in HNSCC cells (Figure 3B).
WB assays demonstrated that TRIM32 knockdown led to increased TP53 expression levels (Figure 3C). Co-immunofluorescence staining was employed to assess the co-expression patterns of TRIM32 and TP53. The results revealed that knocking down TRIM32 was associated with reduced co-expression levels with TP53, although residual co-expression between the two proteins was observed (Figure 3D).
Based on these observations, we propose that TRIM32 may exert a negative regulatory effect on TP53, potentially impacting HNSCC progression. To confirm the effectiveness of TP53 knockdown, qPCR assays were performed using TP53-si#2 in HNSCC cells. The data showed that TP53-si#2 successfully downregulated TP53 mRNA levels in both cell lines, indicating reliable transfection efficiency (Figure 3E). TRIM32 knockdown was achieved using siTRIM32-2 in HSC-3 and FADU cells. Subsequently, TP53 expression was further suppressed with TP53si#2, and qPCR analysis revealed that TP53si#2 abolished the inhibitory effect of TRIM32 on TP53 (Figure 3F). The CCK-8 assay and colony formation assays results indicated that knocking out TP53 expression partially restored the inhibitory effect of low TRIM32 expression on HNSCC cell proliferation (Figure 3G-3I).
Collectively, these findings suggest that TRIM32 knockdown triggers TP53 upregulation, which in turn affects lysosomal function and autophagy processes in HNSCC cells. This modulation of cellular pathways potentially contributes to the inhibition of tumour proliferation.
Knockdown of TRIM32 expression has been observed to significantly impact lysosomal function and autophagy in HNSCC cells
Previous studies have reported that TRIM32 is required for autophagy induction in several cancers (9). We conducted GSEA enrichment analysis and demonstrated a significant correlation between TRIM32 expression levels and lysosomal function in HNSCC cells (Figure 4A). WB experiments were conducted to validate these findings, revealing that knocking down TRIM32 expression in HSC-3 and FADU cell lines led to a notable reduction in the expression of lysosome-associated proteins LAMP1 and LAMP2 (Figure 4B). Furthermore, GSEA analysis also identified a significant association between TRIM32 expression and autophagy-related pathways (Figure 4C). WB assays were extended to examine LC3BⅠ and LC3BⅡ protein levels following TRIM32 knockdown. While no significant changes in LC3BⅠ expression were observed in HSC-3 cells, a notable upregulation was detected in FADU cells. In contrast, LC3BⅡ expression consistently decreased across both cell lines upon TRIM32 knockdown (Figure 4D). These results collectively suggest that TRIM32 plays a critical role in regulating lysosomal function and autophagy processes within HNSCC cells, potentially contributing to the inhibition of tumour proliferation.
TRIM32 expression in HNSCC is closely related to immune infiltration
To investigate whether TRIM32 expression in HNSCC is closely related to tumour immune suppression, we first analyzed TRIM32 expression data from HNSCC samples. Expression values were normalized using the transformation formula log2(x + 0.001). Gene expression profiles for each tumour were extracted and mapped to gene symbols. To assess immune infiltration, we utilized the ESTIMATE package (version 1.0.13) in R. This analysis provided stromal, immune, and comprehensive ESTIMATE scores for each tumour sample. Ultimately, immune infiltration scores were obtained for 517 HNSCC tumour samples. Pearson’s correlation coefficients were computed using the corr.test function from the psych package (version 2.1.6). This approach identified significant correlations between TRIM32 expression levels and immune infiltration scores (Figure 5A).
Additionally, the Timer method, implemented in the IOBR R package, was employed to reassess immune cell infiltration scores [B cells, T cell CD4, T cell CD8, neutrophils, macrophages, and dendritic cells (DCs)] based on gene expression data. Significant correlations were observed between TRIM32 expression and infiltration scores for T cell CD4, neutrophils, macrophages, and DCs in HNSCC samples (Figure 5B).
Discussion
This study elucidates the oncogenic role of TRIM32 in HNSCC and its underlying molecular mechanisms. Our investigation demonstrates that TRIM32 is significantly upregulated in HNSCC tissues and correlates with poor patient prognosis, suggesting its potential as a novel prognostic marker and therapeutic target for HNSCC. These findings align with studies in other malignant tumours, such as Glioma and Colorectal Cancer, further underscoring TRIM32’s role as an oncogene (10,11). Knocking down TRIM32 expression was found to significantly inhibit the proliferation, migration, and invasion of HNSCC cells. This result is consistent with previous research on SCC, where TRIM32 has been shown to promote tumour progression by regulating ARID1A stability (8). Furthermore, our GSEA revealed significant associations between TRIM32 expression and cancer-related pathways, the cell cycle, and apoptosis, providing a systems biology perspective on TRIM32’s multifaceted role in HNSCC.
Notably, TRIM32 knockdown led to reduced expressions of lysosomal markers LAMP1/2 and autophagy marker LC3BⅡ, extending our understanding of TRIM32’s involvement in cellular metabolism regulation. Interestingly, the regulatory effects of TRIM32 on autophagy exhibited cell line-specific differences, hinting at a more complex regulatory network. Protein-protein interaction analyses suggest that these intricate regulations may be closely tied to TP53’s involvement. Regarding the relationship between TRIM32 and TP53, our study supports TRIM32 as a negative regulator of TP53. This finding is consistent with previous reports where TRIM32 controls tumour suppressor proteins via the ubiquitin-proteasome system (12). Given that the TP53 pathway plays a crucial role in HNSCC, these findings offer novel insights into understanding upstream regulation of this critical tumour-suppressive pathway.
We found a significant correlation between TRIM32 expression and immune cell infiltration (such as CD4/CD8 T cells and macrophages) using ESTIMATE and Timer algorithms, which is very limited. More research on immune activity models is needed in the future to prove this viewpoint. The TRIM32-TP53 axis emerges as a potential therapeutic target in HNSCC, particularly considering TP53’s central role in tumour suppression. Given that TRIM32 overexpression correlates with poor outcomes in HNSCC patients, it is proposed as a promising prognostic biomarker. The small sample size in the study limits the statistical power and correlation analysis for more clinical subgroups. Additionally, targeting TRIM32 or its downstream effectors could represent novel strategies for treating HNSCC, especially in addressing treatment resistance to existing therapies. Particularly, considering HNSCC’s resistance to current therapeutic regimens, interventions targeting the TRIM32-TP53-autophagy axis may improve treatment responses.
Conclusions
TRIM32 expression is significantly elevated in HNSCC, indicating its potential as an adverse prognostic marker. Experimental evidence demonstrates that TRIM32 facilitates cellular proliferation and migration, significantly influences lysosomal function and autophagy processes within HNSCC cells, and was verified to negatively regulate TP53. These mechanisms contribute to the aggressive behaviour of HNSCC.
Acknowledgments
We would like to thank Ruiye Model Animal (Guangzhou) Biotechnology Co., Ltd. for their technical support in animal experiments, and TCGA, UCSC Xena, and Sangerbox for providing open-access data and analysis platforms that supported this study.
Footnote
Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0873/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0873/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0873/prf
Funding: This work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0873/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Guangzhou Institute of Cancer Research, the Affiliated Cancer Hospital, Guangzhou Medical University (No. GYZL-2024-KY52), and written informed consent was obtained from all patients. The animal experiments were conducted at Ruiye Model Animal (Guangzhou) Biotechnology Co., Ltd., under a project license (No. RYEth-20250625807) granted by its Ethics Committee, in compliance with its institutional guidelines for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Zhao M, Schoenfeld JD, Egloff AM, et al. T cell dynamics with neoadjuvant immunotherapy in head and neck cancer. Nat Rev Clin Oncol 2025;22:83-94. [Crossref] [PubMed]
- Shi Y, Guo W, Wang W, et al. Finotonlimab with chemotherapy in recurrent or metastatic head and neck cancer: a randomized phase 3 trial. Nat Med 2024;30:2568-75. [Crossref] [PubMed]
- Leddon JL, Gulati S, Haque S, et al. Phase II Trial of Adjuvant Nivolumab Following Salvage Resection in Patients with Recurrent Squamous Cell Carcinoma of the Head and Neck. Clin Cancer Res 2022;28:3464-72. [Crossref] [PubMed]
- Wang M, Luo W, Zhang Y, et al. Trim32 suppresses cerebellar development and tumorigenesis by degrading Gli1/sonic hedgehog signaling. Cell Death Differ 2020;27:1286-99. [Crossref] [PubMed]
- Tang J, Li J, Lian J, et al. CDK2-activated TRIM32 phosphorylation and nuclear translocation promotes radioresistance in triple-negative breast cancer. J Adv Res 2024;61:239-51. [Crossref] [PubMed]
- Bawa S, Piccirillo R, Geisbrecht ER. TRIM32: A Multifunctional Protein Involved in Muscle Homeostasis, Glucose Metabolism, and Tumorigenesis. Biomolecules 2021;11:408. [Crossref] [PubMed]
- Yu J, Feng D, Bao L, et al. TRIM32 Inhibits NEK7 Ubiquitylation-Dependent Microglia Pyroptosis After Spinal Cord Injury. Mol Biotechnol 2025;67:138-48. [Crossref] [PubMed]
- Luo Q, Wu X, Nan Y, et al. TRIM32/USP11 Balances ARID1A Stability and the Oncogenic/Tumor-Suppressive Status of Squamous Cell Carcinoma. Cell Rep 2020;30:98-111.e5. [Crossref] [PubMed]
- Mandell MA, Saha B, Thompson TA. The Tripartite Nexus: Autophagy, Cancer, and Tripartite Motif-Containing Protein Family Members. Front Pharmacol 2020;11:308. [Crossref] [PubMed]
- Xu J, Liu W, Chen L, et al. TRIM32 promotes anoikis resistance and metastasis in NSCLC by degrading CHEK2 to enhance IL-6 secretion. Cell Death Differ 2026;33:126-39. [Crossref] [PubMed]
- Ning J, Cai X, Su Y, et al. Inhibitory Effect and Mechanism of the Down-Regulation of TRIM32 in Colorectal Cancer. Int J Mol Sci 2025;26:5047. [Crossref] [PubMed]
- Liu J, Zhang C, Wang XL, et al. E3 ubiquitin ligase TRIM32 negatively regulates tumor suppressor p53 to promote tumorigenesis. Cell Death Differ 2014;21:1792-804. [Crossref] [PubMed]

