ALOX12 suppresses colon cancer progression by promoting p53-mediated ferroptosis through upregulating ROS-induced stress
Highlight box
Key findings
• ALOX12 is a promotor of p53-mediated ferroptosis in colon cancer (CC) and associated with positive prognosis.
• p53 can indirectly activate ALOX12 function by suppressing SLC7A11 in ALOX12-dependent ferroptosis.
What is known and what is new?
• Existing knowledge has recognized p53-mediated ferroptosis as a critical regulator of diverse biological processes. ALOX12 status is closely correlated with the prognosis of patients with colorectal cancer.
• This study is the first to systematically elucidate the specific molecular mechanisms into the regulation of ALOX12 in p53-mediated ferroptosis.
What is the implication, and what should change now?
• Our study helps to better understand the function of p53/SLC7A11/ALOX12 axis and provide insights for potential new biomarkers and novel therapies in CC.
Introduction
Colon cancer (CC) is the fifth most commonly diagnosed malignancy and cause of cancer-related mortality worldwide, accounting for more than 1.1 million new cases and 50,000 deaths annually (1). The standard treatment of CC includes surgical resection, chemotherapy, or radiotherapy. Despite the tremendous advances achieved in CC, the prognosis of patients at advanced stages, especially those with metastatic diseases, remains unsatisfactory (2). Moreover, CC represents a heterogeneous disease characterized by distinct etiologies. Although several etiological pathways (3), including adenoma-carcinoma sequence, serrated pathway and inflammatory pathway, have been proposed, many biological behaviors of CC remain unexplained. Therefore, it is particularly important to explore new biomarkers and mechanisms to improve the prognosis of CC in future.
Ferroptosis is a distinct form of regulated cell death (RCD), characterized by its iron-dependence and the accumulation of intracellular reactive oxygen species (ROS), differing from apoptosis, necrosis, and autophagy morphologically and mechanistically (4). This RCD predominantly affects cell membranes rich in polyunsaturated fatty acids (PUFAs), leading to lipid peroxidation (LPO) and subsequent cellular demise. Recently, ferroptosis has been implicated in biological processes of various tumors (5,6), including colorectal cancer (7). However, many aspects of the precise mechanisms in CC are still to be elucidated.
Inactivation of p53 is a key event in development of most human cancers. p53 is the most common tumor suppressor in human cancers, playing a crucial role in cancer inhibition by regulating various cellular processes as a transcription factor (8). Although the classical activities of p53, including cell cycle arrest, apoptosis, and necrosis, are widely recognized as primary molecular mechanisms of tumor suppression (9-11), recent researchers have indicated that the unconventional mechanisms also contribute significantly to this progression (12,13). Furthermore, studies have identified p53 as a core molecule in regulating ferroptosis in cancers through its metabolic targets (14-16).
The ALOX12 gene, located on human chromosome 17p13.1, is closely positioned near the p53 locus (17), coding for the ALOX12 enzyme that metabolizes PUFAs into bioactive lipid mediators, such as 12-hydroxyeicosatetraenoic acid (12-HETE) and lipoxins (18). These metabolites have been recognized for their roles in various pathophysiological conditions, including malignancies (17), hypertension (19), and retinopathy (20), through ferroptosis pathway. Despite the emerging evidence supporting the involvement of ALOX12-mediated ferroptosis in these diseases, research specifically addressing its role in CC is sparse. Moreover, the precise mechanisms by which ALOX12 modulates ferroptosis in CC cells have not yet been clearly defined. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0503/rc).
Methods
Ethical statement
The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Zhongda Hospital Southeast University (No. 2024ZDSYLL301-P01). Written informed consent was obtained from all participants and their legal representatives prior to enrollment.
All animal experiments were performed under a project license (No. 20240221009) granted by the Ethics Committee of Southeast University, in compliance with “Regulation on the Administration of Experimental Animals” for the care and use of animals. According to the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals [2020], animals were euthanized by inhalation of carbon dioxide after being anesthetized with isoflurane.
ALOX12 gene expression and survival analysis
Data were sourced from two public repositories. RNA-seq data for the colon adenocarcinoma cohort were obtained from The Cancer Genome Atlas (TCGA; https://portal.gdc.cancer.gov/). In parallel, 565 ferroptosis-related genes (FRGs) were retrieved from the FerrDb database (http://www.zhounan.org/ferrdb/).
To identify differentially expressed genes (DEGs) between normal and tumor samples, we employed the DESeq2 and edgeR packages in R software (version 4.3.2). From the overlap between DEGs and FRGs sets, we defined ferroptosis-related DEGs (FRDEGs) and selected ALOX12 for further analysis. The pan-cancer expression profile of ALOX12 was assessed across 33 common human malignancies using the Sangerbox (http://www.sangerbox.com/) platform, which integrates data from TCGA cohorts and the Genotype-Tissue Expression (GTEx; https://www.gtexportal.org/) project to facilitate comparisons. Finally, the prognostic value of ALOX12 expression on patient survival was evaluated using the Kaplan-Meier Plotter (https://kmplot.com/analysis/).
Clinical specimens
Clinical specimens were collected from patients undergoing radical colectomy for CC at our institution. Tissues were obtained within 30 minutes post-excision, washed with phosphate-buffered saline (PBS), and promptly preserved in liquid nitrogen for subsequent analysis. We extracted total protein from these samples and quantified protein concentrations using a BCA protein assay kit (AP12L025; Life-iLab, Shanghai, China). All methods were performed in accordance with the relevant guidelines and regulations.
Cell culture and stable lines
The HCT116, DLD-1, SW480, SW620 and HT-29 cancer lines were acquired from Zhongqiaoxinzhou Biotech (Shanghai, China). All cell lines were confirmed to be free from mycoplasma contamination. Cells were cultured in a 37 ℃ incubator with an atmosphere of 5% CO2. Culture media for all cell lines consisted of their respective basal media supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 µg/mL streptomycin (all from Zhongqiaoxinzhou Biotech). To generated stable cell lines overexpressing ALOX12, HCT116 and DLD-1 cells were transfected with lentiviral vector Ubi-ALOX12-3FLAG (GV492; GeneChem, Shanghai, China). The efficiency of transfection was confirmed through western blotting and quantitative reverse transcription polymerase chain reaction (qRT-PCR).
Western blotting and antibodies
The protein extraction and homogenization protocol were well established using reagents obtained from Beyotime (Shanghai, China). Protein extracts were analyzed by western blotting according to standard protocols, using primary antibodies against p53 (A0263, Abclonal, 1:1,000), SLC7A11 (CY7046, Abways, 1:1,000), ALOX12 (CY8070, Abways, 1:1,000), GAPDH (AB0037, Abways, 1:5,000), and GPX4 (A11243, Abclonal, 1:1,000), followed by an HRP-conjugated goat anti-rabbit secondary antibody (AS014, Abclonal, 1:5,000). The raw western blotting data are provided in western blotting data file (Appendix 1).
Ablation of endogenous p53 and ALOX12 by siRNA
Knockdown of p53 and ALOX12 mRNAs and proteins was performed by transfection of HCT116 and DLD-1 cells with siRNA duplex oligoset (GenePharma, Shanghai, China) combined with siRNA-mate plus (G04008; GenePharma) for 24 h according to the manufacturer’s protocol. The siRNAs used to target p53 (si-p53) and ALOX12 (si-ALOX12) were listed in Table 1.
Table 1
| siRNA | Strand | Sequence (5'→3') |
|---|---|---|
| si-p53-1 | Sense | CCCGGACGAUAUUGAACAATT |
| Antisense | UUGUUCAAUAUCGUCCGGGTT | |
| si-p53-2 | Sense | CCACCAUCCACUACAACUATT |
| Antisense | UAGUUGUAGUGGAUGGUGGTT | |
| si-p53-3 | Sense | GAUGUUCCGAGAGCUGAAUTT |
| Antisense | AUUCAGCUCUCGGAACAUCTT | |
| si-p53-4 | Sense | CCAUCUACAAGCAGUCACATT |
| Antisense | UGUGACUGCUUGUAGAUGGTT | |
| si-ALOX12-1 | Sense | GAUCUACCUCCAAAUAUGATT |
| Antisense | UCAUAUUUGGAGGUAGAUCTT | |
| si-ALOX12-2 | Sense | GGCCCUAUGAAUAUCUGAATT |
| Antisense | UUCAGAUAUUCAUAGGGCCTT | |
| si-ALOX12-3 | Sense | GCACGAGAUCCAGUAUCACTT |
| Antisense | GUGAUACUGGAUCUCGUGCTT | |
| si-ALOX12-4 | Sense | GGAGAGAAGCAAUACCUGGTT |
| Antisense | CCAGGUAUUGCUUCUCUCCTT |
qRT-PCR
qRT-PCR analysis was performed to evaluate mRNA levels of p53, SLC7A11 and ALOX12. Total RNA was extracted using RNA Easy Kit (R0027; Beyotime, Shanghai, China). cDNA was reversed using HiScript III RT SuperMix (R323-01; Vazyme, Nanjing, China). qPCR was carried out using Taq Pro Universal SYBR qPCR Master Mix (Q712-02; Vazyme, Nanjing, China). All experiments were carried out according to the manufacturer’s protocols. The following primers (Table 2) were used for qRT-PCR of human transcripts:
Table 2
| Gene | Strand | Sequence (5'→3') |
|---|---|---|
| p53 | Forward | GCCCATCCTCACCATCATCACAC |
| Reverse | GCACAAACACGCACCTCAAAGC | |
| SLC7A11 | Forward | ACGGTGGTGTGTTTGCTGTCTC |
| Reverse | GCTGGTAGAGGAGTGTGCTTGC | |
| ALOX12 | Forward | CTGGCTCCTGGCAAAGTCCTG |
| Reverse | ATGGTGGCGACAGCGATGAC | |
| GPX4 | Forward | CCCGATACGCTGAGTGTGGTTTG |
| Reverse | TCTTCGTTACTCCCTGGCTCCTG | |
| GAPDH | Forward | GTGGACCTGACCTGCCGTCTAG |
| Reverse | GAGTGGGTGTCGCTGTTGAAGTC |
qPCR, quantitative polymerase chain reaction.
Cell proliferation and death assay
The classic ferroptosis pathway, which depended on the inactivation of SLC7A11, was induced with the treatment of erastin. For p53-mediated ferroptosis, we used Nutlin-3 and low-dose tert-Butyl Hydroperoxide (TBH), a ROS generator more stable than H2O2, to activate p53 and provide ROS. Similar experiments using TBH and its analogs treatment to induce ferroptosis were also reported by others (17,21). In cell proliferation and death assay, cells were pre-inoculated in 96-well plates at an appropriate number according to specific requirements and then quantified through a Cell Counting Kit-8 Plus (K1018; Apex Bio, Shanghai, China). Cells in 6-well plates, after treatment with drugs or inhibitors, were observed under a microscope to visualize cell death.
Drugs and inhibitors
TBH (B802372; Macklin, Shanghai, China) served as ROS generator while Nutlin-3 (HY-50696; MCE, Shanghai, China) was used to activate p53. Specific cell death inhibitors and ALOX12 activity inhibitor used in our work were as follows: 3-methyladenine (3-MA, autophagy inhibitor) (HY-19312; MCE, Shanghai, China), Z-VAD-FMK (Z-VAD, apoptosis inhibitor) (HY-16658B; MCE, Shanghai, China), necrostatin-1 (Nec-1, necroptosis inhibitor) (HY-15760; MCE, Shanghai, China), ferrostatin-1 (Fer-1, ferroptosis inhibitor) (SJ-MX0049; SparkJade, Shandong, China), liproxstatin-1 (Lip-1, ferroptosis inhibitor) (HY-12726; MCE, Shanghai, China) and ML355 (ALOX12 inhibitor) (HY-12341; MCE, Shanghai, China). All drugs and inhibitors mentioned above were used at different doses depending on the experiment; see respective figure legends.
Intracellular ROS assay
The intracellular ROS levels were determined using ROS Fluorometric Assay Kit (Red) (E-BC-F005; Elabscience, Wuhan, China). Briefly, cells were incubated with 10 µM dihydroethidium (DHE) in serum-free medium at 37 ℃ for 30 min. Cells were then washed twice with PBS, followed by analysis of ROS levels using a microplate reader (Varioskan LUX; Thermo Fisher Scientific) with excitation/emission wavelengths set at 518/610 nm. Data were normalized to the cell number in each well, as determined by cell counting.
Intracellular LPO assay
Intracellular LPO was assessed by intracellular malondialdehyde (MDA) levels, terminal product of LPO, using a Lipid Peroxidation MDA Assay Kit (S0131S; Beyotime, Shanghai, China). Total cell protein was extracted and protein concentration was determined by BCA assay. A serial dilution of MDA standards (from 1 to 32 µM) was used to generate a standard curve. In each reaction, 100 µL of standard or sample was added, mixed with 200 µL of MDA detection working solution, incubated at 100 ℃ for 15 min, and then centrifuged. Subsequently, 200 µL of the supernatant was transferred to a 96-well plate, and the absorbance was measured at 532 nm using a microplate reader as above. Finally, the MDA results were normalized to the total protein concentration as determined by the BCA assay.
Intracellular ferrous iron (Fe2+) detection
The labile iron pool was measured using the FerroOrange kit (F374; Dojindo). Cells were incubated with 1 µM FerroOrange working solution in Hank’s Balanced Salt Solution (HBSS) at 37 ℃ for 30 min, followed by analysis of Fe2+ levels using a microplate reader as above with excitation/emission wavelengths set at 543/580 nm.
Co-immunoprecipitation (Co-IP) assay
To validate the interaction between SLC7A11 and ALOX12, reciprocal Co-IP assays were performed using an Immunoprecipitation Kit (P2179S; Beyotime, Shanghai, China) or a Flag-tag Protein IP Assay Kit (P2181S; Beyotime, Shanghai, China). Briefly, the cells were harvested and lysed on ice for 10 min. Then, the cell lysate was centrifuged at 15,000 rpm for 15 min at 4 ℃. SLC7A11 (CY7046, Abways, 1:50) antibody, which was first conjugated to magnetic beads at room temperature for 1 h, or anti-Flag magnetic beads were incubation with the supernatants overnight at 4 ℃. The immunoprecipitates were eluted with flag peptide or sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample loading buffer for subsequent protein activity assays or western blotting.
ALOX12 activity assay in vitro
Since arachidonic acid (AA) is the primary substrate for ALOX12, which metabolizes it 12-HETE, we measured 12-HETE levels as an indicator for ALOX12 activity using a Human 12-HETE enzyme-linked immunosorbent assay (ELISA) Kit (EH1977; Fine Test, Wuhan, China).
To test ALOX12 activity in vitro, 1 µg purified ALOX12 was incubated with 100 µM AA (Y269621; Beyotime, Shanghai, China) in 200 µL of PBS containing 0.1 mM ATP (D7378; Beyotime, Shanghai, China) and 0.4 mM Ca2+ (C399247; Aladdin, Shanghai, China), with or without treatment, at 37 ℃ for 10 min. The reaction was terminated by adding an equal volume of ice-cold methanol.
For the ELISA procedure, purified 12-HETE standards were serially diluted to construct a standard curve (from 0 to 20 ng/mL). Next, 50 µL of each standard or reaction sample was loaded into a 96-well plate pre-coated with anti-12-HETE antibodies. Subsequently, 50 µL of the antibody working solution was added to each well, and the plate was incubated at 37 ℃ for 45 min. The plate was washed 3 times and 200 µL of HRP-streptavidin conjugate working solution was added to each well before incubated at 37 ℃ for 30 min. Next, the plate was washed 5 times and 90 µL 3,3',5,5'-tetramethylbenzidine (TMB) substrate was added to each well before incubated in the dark at 37 ℃ for 15 min. Finally, 50 µL stop solution was added, and the absorbance was read at 450 nm.
Xenograft mouse model
The sample size was calculated using G*Power software (version 3.1.9.7). We set the effect size at 0.8, α=0.05, and power (1−β) =0.8. The calculation indicated that 6 mice per group were required to detect statistically significant differences. Considering potential accidental death or exclusion, we included 8 mice per group.
To minimize selection bias, mice were randomly allocated into treatment groups prior to tumor cell inoculation using a computer-generated random number table (Microsoft Excel). Randomization was stratified by initial body weight to ensure balanced baseline characteristics across groups.
Investigators involved in daily animal care, tumor measurement (using precision analytical balance), and endpoint tissue processing [including immunohistochemistry (IHC and molecular analyses] were blinded to the group allocation. The researcher responsible for inoculation was the only individual aware of the grouping to ensure accurate dosing. All data analyses were performed by an investigator who remained unaware of the experimental groups until the statistical analysis was completed.
Ctrl and ALOX12 overexpression (ALOX12-OE) HCT116 cells in 100 mm-petri dishes were trypsinized and collected in 1.5 mL centrifuge tubes, and subsequently resuspend in culture medium stored on ice before injection. A total of 5×106 HCT116 cells indicated above were subcutaneously injected into the right inguinal region of 4-week-old BALB/c nude mice (Cavens, Changzhou, China). After injection, we measured mice body weight observed tumor growth every 5 days; 21 days after injection, the mice were sacrificed and tumors were excised carefully and weighed. In detail, animals were euthanized by inhaling carbon dioxide at a flow rate of 3 L/min, displacing 30% of the home cage volume, after being anesthetized with 5% isoflurane. Protein extracted from part of the excised tumors were retained for subsequent western blotting analysis and the remaining tissues were fix in tissue fixative (G1101; Servicebio, Wuhan, China) for IHC testing.
IHC
In IHC, tissues from Ctrl and ALOX12-OE xenograft mouse models were immersed in fixative solution overnight and subsequently embedded in paraffin. The Paraffin-embedded tissues were sectioned, and the resultant tissue slides were deparaffinized using xylene, followed by rehydration via a graded ethanol series. Subsequently, antigen retrieval was performed by microwave heating in citrate buffer (pH 6.0). Endogenous peroxidase activity was quenched prior to overnight incubation of the tissue sections with the ALOX12 primary antibody (MA5-26911; Thermo Fisher Scientific; 1:100) at 4 ℃. The slides were then reacted with secondary antibody (AFIHC001; Aifang Biological) in 37 ℃ for 30 min, followed by diaminobenzidine substrate staining for 10 min.
Statistical analysis and reproducibility
All experiments were independently repeated at least three times. Data are presented as mean ± standard deviation (SD). For comparisons between two groups, unpaired two-tailed Student’s t-tests were performed. For comparisons among three or more groups, one-way analysis of variance (ANOVA) with Tukey’s post hoc test was applied. WB images were compiled in Adobe Photoshop (version 26.0), followed by grayscale value measurement using ImageJ (version 1.54g). Statistic analysis was carried out using Microsoft Excel or GraphPad Prism 9.5 to assess the differences between the experimental groups. Figures provided in this study were arranged in Adobe Illustrator (version 29.0). P values of less than 0.05 were considered statistically significant. To more intuitively represent the differences between experimental groups, we used the following symbols to denote statistical analysis results: “ns” for not significant, “*” for P<0.05, “**” for P<0.01, “***” for P<0.001, and “****” for P<0.0001.
Results
ALOX12 is downregulated in CC and is associated with favorable prognosis
In this study, we analyzed RNA-seq data of 465 patients with CC from TCGA-COAD cohort. We obtained 565 FRGs from FerrDb website and performed differential mRNA expression profiling between tumor and adjacent normal tissues using both DESeq2 and edgeR packages, subsequently identifying 273 FRDEGs (Figure 1A). Specifically, ALOX12, member of the ALOXs family, was found to be expressed at relatively low levels in tumor tissues. In pan-cancer analysis, ALOX12 was shown to be underexpressed in more than half of these malignancies (19/34) (Figure 1B), including analyses specific to colon and rectal cancers, whether considered separately or jointly (Figure S1A).
Using Kaplan-Meier plotter, we evaluated the prognostic significance of ALOX12 in CC. Our results suggested that high ALOX12 expression correlates with longer overall survival (OS) and relapse-free survival (RFS) in early-stage (stage I) patients (Figure 1C). Conversely, reduced expression of ALOX12 during tumor recurrence was linked with poor prognosis (Figure 1D). Further analysis revealed that ALOX12’s impact on RFS varies by tumor location. High levels of ALOX12 are positively correlated with prognosis in right-sided CC (Figure S1B), whereas the opposite trend is observed in left-sided CC (Figure S1C). These findings indicate the potential roles for ALOX12 in different subtypes of CC, suggesting its utility as a biomarker for guiding prognosis and management of recurrence.
We continuously analyzed the expression of ALOX12 in our center, obtaining similar results (Figure 1E and Figure S1D). Moreover, ALOX12 was downregulated in CC cell lines such as HCT116, DLD-1, SW480, SW620, and HT-29 (Figure 1F).
ALOX12 increases oxidative stress and promotes ferroptosis in CC
Given the absence of CC cell lines natively expressing ALOX12, we successfully established stable ALOX12-OE HCT116 and DLD-1 cell lines (Figure S2A,S2B). Additionally, ALOX12 knockdown was achieved using siRNA (Figure S2C,S2D). In cell proliferation assay, we observed that ALOX12 slightly suppressed the proliferation of HCT116 and DLD-1 cells, which could be reversed by ML355 or ALOX12 silencing (Figure 2A). In light of the role of ALOX12 enzyme in producing biologically active lipids, we assessed the oxidative stress level in CC cells. Notably, ALOX12 significantly elevated intracellular ROS levels (Figure 2B). Elevated intracellular ROS levels are closely associated with LPO. As indicated, ALOX12 markedly increased MDA production, an end-product of intracellular LPO, which could be reversed by ML355, ALOX12 knockdown or ferroptosis inhibitors including Fer-1 and Lip-1 (Figure 2C). Consistently, analysis of the intracellular labile iron pool yielded comparable findings (Figure 2D). These results suggest that ALOX12 may suppress tumorigenesis in CC cells by promoting ferroptosis pathway. To further validate the impact of ALOX12 on cell proliferation, we established a xenograft mouse model (Figure 2E), in which ALOX12 expression was confirmed through IHC staining and western blotting, respectively (Figure 2F,2G). As hypothesized, ALOX12 overexpression significantly suppressed the growth of xenograft tumors (Figure 2H). Collectively, our findings establish ALOX12 as a negative modulator of tumorigenesis in CC cells through ferroptosis upon modulating ROS-induced stress.
ALOX12 is essential for p53-mediated ferroptosis in CC
The activation of p53 can be induced by Nutlin-3, a small-molecule inhibitor of Mdm2, which inhibits the MDM2-p53 interaction, thereby stabilizing p53 protein. In most human cancer cells, Nutlin-mediated p53 activation leads to reversible cell cycle arrest instead of cell death. Our work indicated that low doses of Nutlin-3 significantly activate p53 primarily at the protein level, without impacting p53 mRNAs (Figure 3A). Furthermore, higher doses of Nutlin-3 did not induce significant cell death, regardless of ALOX12 status (Figure S3A). Similar results were also observed when cells were treated along with low-dose TBH (Figure S3B). Notably, obvious cell death was exclusively observed in ALOX12-OE cells when treated with the combination of Nutlin-3 and TBH (Figure 3B), which could significantly be reversed by ML355 or Fer-1, instead of by inhibitors targeting other RCDs, such as 3-MA (autophagy inhibitor), Z-VAD (apoptosis inhibitor), or Nec-1 (necrosis inhibitor) (Figure 3C). Furthermore, a significant increase in intracellular LPO (Figure 3D,3E) and labile iron levels (Figure 3F) was detected at the same time. Moreover, although ALOX12 alone slightly enhanced ferroptosis, activation of p53 markedly accelerated this process (Figure S3C-S3E). Together, these results indicate that ALOX12 is a key mediator of p53-dependent ferroptosis in CC, driven by the combined effects of p53 activation and elevated oxidative stress.
Mechanisms into the regulation of ALOX12 in p53-mediated ferroptosis.
As is shown in Figure 4A, ALOX12 status had no significant effect on p53 and its transcriptional target such as SLC7A11. Meanwhile, the specific requirement for ALOX12 in p53-dependent ferroptosis raised the possibility that ALOX12 activity may be regulated by p53. To this end, we performed a siRNA-mediated loss-of-function screen of p53 in CC cell lines (Figure S4A). Although SLC7A11 levels were negatively regulated by p53, no obvious alterations in ALOX12 levels were detected upon either p53 activation, silencing, or combined treatment (Figure 4B,4C, Figure S4B,S4C). Therefore, we further investigated whether ALOX12 function is regulated by established p53 targets in ferroptosis like SLC7A11, member of System Xc-. SLC7A11 is a major suppressor of ferroptosis in various malignancies by mediating cystine uptake, which is subsequently converted into glutathione (GSH) via the enzymes glutamate cysteine ligase (GCL) and glutathione synthetase (GSS) (22). LPO are typically eliminated by GPX4 and its substrate GSH, while ferroptosis can be induced by pharmacological agents like GPX4 inhibitors (22) and erastin (4), primarily through GPX4 inactivation and GSH depletion. Despite the significant ferroptosis-promoted tumor suppression induced by erastin (Figure 4D-4G), our findings showed that similar cell death was observed considering ALOX12 status (Figure 4H), with a significant increase in corresponding ferroptosis-related markers (Figure S4D-S4F). These results indicate that ALOX12 is not involved in ferroptosis induced by erastin.
Therefore, we further tested whether ALOX12 directly interacts with SLC7All. As shown in Figure 4I, purified ALOX12 bound to SLC7A11 in an in vitro pull-down assay, indicating a direct interaction between the two proteins. Furthermore, Co-IP analysis confirmed that endogenous ALOX12 and SLC7A11 also interact in cell lines (Figure 4J). Collectively, these data identify ALOX12 as a bona fide binding partner of SLC7A11.
To determine the functional outcome of this interaction, we investigated whether SLC7A11 influences ALOX12 enzyme activity. As is shown in Figure 4K, ALOX12 enzyme was significantly inactivated under ML355 treatment. Given that SLC7A11 is transcriptionally regulated by p53, we found that Nutlininduced p53 activation led to decreased SLC7A11 levels and a concomitant increase in ALOX12 activity in HCT116 and DLD‑1 cells, which was reversed by p53 knockdown (Figure 4K). Furthermore, in ALOX12-OE cells, ferroptosis is also largely dependent on SLC7A11 status (Figure 4L,4M). Collectively, these findings demonstrate that p53 activates ALOX12 enzyme by downregulating SLC7A11, thus promoting ferroptosis.
Discussion
Ferroptosis is a recently described iron-dependent form of RCD driven by LPO, which differs from other forms of RCD morphologically and mechanistically. As one of the earliest discovered tumor suppressor genes, p53 can either promote (14,23-25) or suppress (26,27) the process of ferroptosis depending on specific conditions. Although the precise mechanisms by which p53 induces ferroptosis still require further elucidation, our study demonstrates the tumor-suppressive role of p53 in CC ferroptosis, in which the importance of ROS is emphasized. In our study, a p53-mediated ferroptosis model was established in CC cell lines, where necessary additional oxidative stress was provided by low-dose TBH. In this model, both p53 activation and ROS-induced stress were indispensable, resulting in significant increasing oxidative stress levels and subsequent ferroptotic response. In fact, apart from TBH treatment, others have reported that similar p53-mediated ferroptosis can also be induced by other forms of ROS inducers, such as H2O2 and paraquat (17). Besides, iPLA2β, another potential transcriptional target of p53, could inhibit p53-driven ferroptosis through lipid detoxification (28). Thus, p53 promotes tumor suppression at least in part by making CC lines more sensitive to ROS-induced ferroptosis.
Up to date, although several bioinformatics analyses have identified ALOX12 as a FRG closely associated with CC (29,30), the precise molecular mechanisms underlying its role in CC-associated ferroptosis remain unexplored. Our findings demonstrate that ectopic overexpression of ALOX12 alone induces only a modest degree of ferroptotic cell death in CC cell lines, which is markedly potentiated upon concurrent p53 activation and exposure to additional oxidative stress. These observations are likely explained by our lentiviral overexpression model, wherein supraphysiological levels of ALOX12 exceed the binding capacity or inhibitory threshold of endogenous SLC7A11, thereby initiating detectable LPO and consequent cell death. Notably, when SLC7A11expression is suppressed, the inhibitory constraint on ALOX12is relieved, resulting in a pronounced acceleration of the ferroptotic process.
Erastin is known as a classic inducer of ferroptosis by inhibiting the uptake of cystine through SLC7A11 (4,31), leading to a subsequent decrease in GSH synthesis and reduced ROS clearance. In contrast to the ferroptotic cell death induced by erastin, both HCT116 and DLD-1 Ctrl cells are resistant to p53-mediated ferroptosis, despite the fact that SLC7A11 is downregulated by p53 activation alone with Nutlin-3 treatment. In contrast, these cells turn to be sensitive to p53-mediated ferroptosis, but not erastin-induced ferroptosis, through the ectopic expression of ALOX12. Similar results are also reported in other diseases (17,28,32). Of note, our study and others (26) find that CC cells appear to exhibit resistance to erastin-induced ferroptosis, making our research significant in exploring new mechanisms of ferroptosis pathways in CC.
In summary, we found that p53 can indirectly activate ALOX12 enzymes through transcriptional repression of SLC7A11, causing ALOX12-dependent ferroptosis upon ROS stress. Additionally, SLC7A11 serves as an inhibitor of ALOX12 enzyme through protein-protein interactions, but the specific mechanism requires further investigation. Moreover, our study provided new possibilities for addressing erastin-induced ferroptosis resistance in CC cells, making ALOX12 a potential target of therapeutic strategies for these patients. Regrettably, our study is unable to clarify the precise mechanism between SLC7A11 and ALOX12 at protein level. Despite these limitations, our study helps to better understand the function of p53/SLC7A11/ALOX12 axis and provide insights for potential new biomarkers and novel therapies in CC.
Conclusions
In this study, we delineate a novel mechanism by which p53 drives ferroptosis in CC through the ALOX12 pathway. We demonstrate that p53 activation sensitizes CC cells to ferroptosis by transcriptionally repressing SLC7A11. While SLC7A11 is known to inhibit ferroptosis by limiting cystine uptake, our data reveal an additional layer of regulation whereby SLC7A11 suppresses ALOX12 enzymatic activity via protein-protein interactions. This inhibition can be overcome by p53-mediated SLC7A11 downregulation combined with exogenous ROS stress, leading to robust ALOX12-dependent LPO.
Notably, we show that CC cells are not sensitive to classical ferroptosis inducers like erastin; however, ectopic ALOX12 expression restores sensitivity to p53-mediated ferroptosis in these cells. Although ALOX12 overexpression alone induces only mild ferroptosis—likely due to exceeding the inhibitory threshold of endogenous SLC7A11—its full activation is achieved through the synergistic effect of p53 signaling and oxidative stress.
Collectively, our findings establish the p53/SLC7A11/ALOX12 axis as a critical regulator of ferroptosis in CC, distinct from canonical pathways. This work not only clarifies the controversial role of p53 in ferroptosis but also positions ALOX12 as a promising biomarker and a potential therapeutic target for overcoming erastin-resistance in CC treatment.
Acknowledgments
We are grateful to the staff in Biobank of Zhongda Hospital Southeast University for technical assistance.
Footnote
Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0503/rc
Data Sharing Statement: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0503/dss
Peer Review File: Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0503/prf
Funding: This study was funded by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2026-0503/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Zhongda Hospital Southeast University (No. 2024ZDSYLL301-P01). Written informed consent was obtained from all participants and their legal representatives prior to enrollment. All animal experiments were performed under a project license (No. 20240221009) granted by the Ethics Committee of Southeast University, in compliance with “Regulation on the Administration of Experimental Animals” for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 2021;71:209-49. [Crossref] [PubMed]
- Cervantes A, Adam R, Roselló S, et al. Metastatic colorectal cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Ann Oncol 2023;34:10-32. [Crossref] [PubMed]
- Keum N, Giovannucci E. Global burden of colorectal cancer: emerging trends, risk factors and prevention strategies. Nat Rev Gastroenterol Hepatol 2019;16:713-32. [Crossref] [PubMed]
- Dixon SJ, Lemberg KM, Lamprecht MR, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 2012;149:1060-72. [Crossref] [PubMed]
- Jiang M, Jike Y, Liu K, et al. Exosome-mediated miR-144-3p promotes ferroptosis to inhibit osteosarcoma proliferation, migration, and invasion through regulating ZEB1. Mol Cancer 2023;22:113. [Crossref] [PubMed]
- Yu J, Zhong B, Zhao L, et al. Fighting drug-resistant lung cancer by induction of NAD(P)H:quinone oxidoreductase 1 (NQO1)-mediated ferroptosis. Drug Resist Updat 2023;70:100977. [Crossref] [PubMed]
- Sun R, Lin Z, Wang X, et al. AADAC protects colorectal cancer liver colonization from ferroptosis through SLC7A11-dependent inhibition of lipid peroxidation. J Exp Clin Cancer Res 2022;41:284. [Crossref] [PubMed]
- Boutelle AM, Attardi LD. p53 and Tumor Suppression: It Takes a Network. Trends Cell Biol 2021;31:298-310. [Crossref] [PubMed]
- Liu Y, Su Z, Tavana O, et al. Understanding the complexity of p53 in a new era of tumor suppression. Cancer Cell 2024;42:946-67. [Crossref] [PubMed]
- Acosta J, Li Q, Freeburg NF, et al. p53 restoration in small cell lung cancer identifies a latent cyclophilin-dependent necrosis mechanism. Nat Commun 2023;14:4403. [Crossref] [PubMed]
- Boon NJ, Oliveira RA, Körner PR, et al. DNA damage induces p53-independent apoptosis through ribosome stalling. Science 2024;384:785-92. [Crossref] [PubMed]
- Humpton T, Vousden KH. Taking up the reins of power: metabolic functions of p53. J Mol Cell Biol 2019;11:610-4. [Crossref] [PubMed]
- Wang CK, Chen TJ, Tan GYT, et al. MEX3A Mediates p53 Degradation to Suppress Ferroptosis and Facilitate Ovarian Cancer Tumorigenesis. Cancer Res 2023;83:251-63. [Crossref] [PubMed]
- Zhou HM, Liu Y, Shi F, et al. CLK2 Regulates the KEAP1/NRF2 and p53 Pathways to Suppress Ferroptosis in Colorectal Cancer. Cancer Res 2025;85:4734-50. [Crossref] [PubMed]
- Liu Y, Stockwell BR, Jiang X, et al. p53-regulated non-apoptotic cell death pathways and their relevance in cancer and other diseases. Nat Rev Mol Cell Biol 2025;26:600-14. [Crossref] [PubMed]
- Dibra D, Xiong S, Moyer SM, et al. Mutant p53 protects triple-negative breast adenocarcinomas from ferroptosis in vivo. Sci Adv 2024;10:eadk1835.
- Chu B, Kon N, Chen D, et al. ALOX12 is required for p53-mediated tumour suppression through a distinct ferroptosis pathway. Nat Cell Biol 2019;21:579-91. [Crossref] [PubMed]
- Zheng Z, Li Y, Jin G, et al. The biological role of arachidonic acid 12-lipoxygenase (ALOX12) in various human diseases. Biomed Pharmacother 2020;129:110354. [Crossref] [PubMed]
- Liu C, Shen Y, Cavdar O, et al. Angiotensin II-induced vascular endothelial cells ferroptosis via P53-ALOX12 signal axis. Clin Exp Hypertens 2023;45:2180019. [Crossref] [PubMed]
- Zhang F, Lin B, Huang S, et al. Melatonin Alleviates Retinal Ischemia-Reperfusion Injury by Inhibiting p53-Mediated Ferroptosis. Antioxidants (Basel) 2023;12:1173. [Crossref] [PubMed]
- Saint-Germain E, Mignacca L, Vernier M, et al. SOCS1 regulates senescence and ferroptosis by modulating the expression of p53 target genes. Aging (Albany NY) 2017;9:2137-62. [Crossref] [PubMed]
- Yang WS. Regulation of ferroptotic cancer cell death by GPX4. Cell 2014;156:317-31. [Crossref] [PubMed]
- Zhang J, Tian T, Li X, et al. p53 inhibits OTUD5 transcription to promote GPX4 degradation and induce ferroptosis in gastric cancer. Clin Transl Med 2025;15:e70271. [Crossref] [PubMed]
- Zeng K, Huang N, Liu N, et al. LACTB suppresses liver cancer progression through regulation of ferroptosis. Redox Biol 2024;75:103270. [Crossref] [PubMed]
- Jian Z, Song J, Lu L, et al. AGR2 suppresses ferroptosis via the p53/FPN1 regulatory axis and drives therapeutic vulnerabilities in pancreatic cancer. Cell Death Dis 2025;16:877. [Crossref] [PubMed]
- Xie Y, Zhu S, Song X, et al. The Tumor Suppressor p53 Limits Ferroptosis by Blocking DPP4 Activity. Cell Rep 2017;20:1692-704. [Crossref] [PubMed]
- Tarangelo A, Magtanong L, Bieging-Rolett KT, et al. p53 Suppresses Metabolic Stress-Induced Ferroptosis in Cancer Cells. Cell Rep 2018;22:569-75. [Crossref] [PubMed]
- Chen D, Chu B, Yang X, et al. iPLA2β-mediated lipid detoxification controls p53-driven ferroptosis independent of GPX4. Nat Commun 2021;12:3644. [Crossref] [PubMed]
- Shao Y, Jia H, Huang L, et al. An Original Ferroptosis-Related Gene Signature Effectively Predicts the Prognosis and Clinical Status for Colorectal Cancer Patients. Front Oncol 2021;11:711776. [Crossref] [PubMed]
- Miao YD, Kou ZY, Wang JT, et al. Prognostic implications of ferroptosis-associated gene signature in colon adenocarcinoma. World J Clin Cases 2021;9:8671-93. [Crossref] [PubMed]
- Koppula P, Zhuang L, Gan B. Cystine transporter SLC7A11/xCT in cancer: ferroptosis, nutrient dependency, and cancer therapy. Protein Cell 2021;12:599-620. [Crossref] [PubMed]
- Jiang L, Kon N, Li T, et al. Ferroptosis as a p53-mediated activity during tumour suppression. Nature 2015;520:57-62. [Crossref] [PubMed]

